ID: 950910953

View in Genome Browser
Species Human (GRCh38)
Location 3:16591218-16591240
Sequence ATCCCGCCGTCTATCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950910953_950910954 -3 Left 950910953 3:16591218-16591240 CCAACATGGATAGACGGCGGGAT 0: 1
1: 0
2: 0
3: 5
4: 25
Right 950910954 3:16591238-16591260 GATCAGAAATCAGATTTTTCTGG 0: 1
1: 0
2: 4
3: 36
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950910953 Original CRISPR ATCCCGCCGTCTATCCATGT TGG (reversed) Intronic
904593259 1:31627026-31627048 ATCCAGCTGTCTTTCCATGAGGG - Exonic
904625439 1:31799602-31799624 ACCCCTCCCTCTATCCATCTGGG + Intronic
924422938 1:243926090-243926112 ATCCCGACGTCTATCTCAGTAGG - Intergenic
1063119535 10:3095343-3095365 AACCAGCCTTCTAACCATGTAGG - Intronic
1063413432 10:5854210-5854232 CTCCCTCGGTCTCTCCATGTGGG - Intergenic
1067969674 10:50955070-50955092 TTCCTGCCCTCTATCCATATTGG - Intergenic
1087080791 11:94169225-94169247 ACCCCACCCTCTCTCCATGTTGG - Intronic
1088375035 11:109131709-109131731 ATCCATCCATCCATCCATGTAGG + Intergenic
1099967402 12:89463796-89463818 ATCACCCCCTCTATCCATGTAGG + Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1139661908 16:68426871-68426893 ATCCTGCCATCAATCCACGTAGG + Intronic
1141324745 16:83045928-83045950 ATCCTCCAGTCTACCCATGTTGG + Intronic
938605380 2:132887385-132887407 ATCCATCCATCCATCCATGTTGG + Intronic
942766822 2:179467188-179467210 ATCCTTCAGTCTATCCATTTAGG + Intronic
946252397 2:218421586-218421608 CTCCTGCCCTCTACCCATGTTGG - Intronic
948537010 2:238653943-238653965 ATCCCTCCCTCTACCCATGATGG + Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175924252 20:62464312-62464334 ACAGCTCCGTCTATCCATGTGGG + Exonic
950910953 3:16591218-16591240 ATCCCGCCGTCTATCCATGTTGG - Intronic
961645354 3:128389890-128389912 GTCCCACCTTCTTTCCATGTTGG + Intronic
980392802 4:132168921-132168943 ATCACGTCGTCTCTCCATGAAGG - Intergenic
984251218 4:177337645-177337667 ATCCAGCCATCCATCCATCTAGG + Intronic
1002183971 5:177445552-177445574 ATCCTGCCATCTATCCCTGGAGG - Intergenic
1023849356 7:44141501-44141523 ATCCTGCTGTCTATCCATCCTGG + Intergenic
1035793122 8:2325924-2325946 ATGCCGCTGTCTGTCCATGGTGG + Intergenic
1035799682 8:2395781-2395803 ATGCCGCTGTCTGTCCATGGTGG - Intergenic
1058217505 9:102253566-102253588 ATCTCACAGTCTATCTATGTGGG - Intergenic
1202277082 Y:23134002-23134024 ATCCCACTTTCTATCCATGTTGG - Intronic
1202288946 Y:23286687-23286709 ATCCCACTTTCTATCCATGTTGG + Intronic
1202430074 Y:24767715-24767737 ATCCCACTTTCTATCCATGTTGG - Intronic
1202440718 Y:24902372-24902394 ATCCCACTTTCTATCCATGTTGG + Intronic