ID: 950910980

View in Genome Browser
Species Human (GRCh38)
Location 3:16591539-16591561
Sequence CTTCAGAGGGAGGCTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2429
Summary {0: 1, 1: 1, 2: 25, 3: 274, 4: 2128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950910980_950910987 -7 Left 950910980 3:16591539-16591561 CCTACCTCAGCCTCCCTCTGAAG 0: 1
1: 1
2: 25
3: 274
4: 2128
Right 950910987 3:16591555-16591577 TCTGAAGTAGCTGGGACTACAGG 0: 146
1: 3945
2: 60424
3: 225200
4: 284051
950910980_950910988 12 Left 950910980 3:16591539-16591561 CCTACCTCAGCCTCCCTCTGAAG 0: 1
1: 1
2: 25
3: 274
4: 2128
Right 950910988 3:16591574-16591596 CAGGCGTGCACCATCACAACTGG 0: 3
1: 73
2: 1658
3: 11107
4: 37935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950910980 Original CRISPR CTTCAGAGGGAGGCTGAGGT AGG (reversed) Intronic
Too many off-targets to display for this crispr