ID: 950910980 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:16591539-16591561 |
| Sequence | CTTCAGAGGGAGGCTGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2429 | |||
| Summary | {0: 1, 1: 1, 2: 25, 3: 274, 4: 2128} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 950910980_950910987 | -7 | Left | 950910980 | 3:16591539-16591561 | CCTACCTCAGCCTCCCTCTGAAG | 0: 1 1: 1 2: 25 3: 274 4: 2128 |
||
| Right | 950910987 | 3:16591555-16591577 | TCTGAAGTAGCTGGGACTACAGG | 0: 146 1: 3945 2: 60424 3: 225200 4: 284051 |
||||
| 950910980_950910988 | 12 | Left | 950910980 | 3:16591539-16591561 | CCTACCTCAGCCTCCCTCTGAAG | 0: 1 1: 1 2: 25 3: 274 4: 2128 |
||
| Right | 950910988 | 3:16591574-16591596 | CAGGCGTGCACCATCACAACTGG | 0: 3 1: 73 2: 1658 3: 11107 4: 37935 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 950910980 | Original CRISPR | CTTCAGAGGGAGGCTGAGGT AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||