ID: 950912342

View in Genome Browser
Species Human (GRCh38)
Location 3:16607118-16607140
Sequence CTACTTACCTTGAATAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 4, 2: 1, 3: 13, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950912340_950912342 16 Left 950912340 3:16607079-16607101 CCCTTTAATGAAAAGCTCACAAT 0: 1
1: 0
2: 2
3: 28
4: 355
Right 950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG 0: 1
1: 4
2: 1
3: 13
4: 204
950912341_950912342 15 Left 950912341 3:16607080-16607102 CCTTTAATGAAAAGCTCACAATA 0: 1
1: 0
2: 3
3: 16
4: 311
Right 950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG 0: 1
1: 4
2: 1
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950912342 Original CRISPR CTACTTACCTTGAATAAGAA TGG Intronic
900080340 1:852205-852227 TTACTGAATTTGAATAAGAACGG + Intergenic
907745551 1:57209554-57209576 CCTCTTACCTTGAAAAACAAAGG - Intronic
909034179 1:70578698-70578720 CTTCTTTCCTTGAATGAAAATGG + Intergenic
909115313 1:71526732-71526754 CTAATTAACGTGAATAAGACGGG - Intronic
909443169 1:75720341-75720363 CTGCTTACCTTGAAATAGATGGG + Intergenic
911909689 1:103617021-103617043 TTACTTACCTTGAGTTGGAAGGG + Exonic
912267883 1:108177417-108177439 ATAATTACCTTGAACATGAATGG + Intronic
913454920 1:119020857-119020879 CCACTTTCTTTGACTAAGAAAGG - Intergenic
913933309 1:125007956-125007978 CCACTTTCTTTGACTAAGAAAGG - Intergenic
916904230 1:169264248-169264270 ATACTAACCTTGAATATAAATGG + Intronic
917634465 1:176921494-176921516 CTACTCACTTTGTAAAAGAAAGG + Intronic
917821015 1:178764455-178764477 ATACTTACCTTGAATGTAAATGG - Intronic
922378417 1:224994656-224994678 ATAATTACCTTGAATATAAATGG - Intronic
924073067 1:240303083-240303105 TTACTTTCCTGGAATAAGAAGGG - Intronic
924099221 1:240586306-240586328 TTAATTACCTGGAATAAAAATGG - Intronic
1063873632 10:10447368-10447390 TTAATTACTGTGAATAAGAATGG - Intergenic
1066037008 10:31501358-31501380 CAACTTTTCTTGAATTAGAAAGG - Intronic
1066310514 10:34191530-34191552 CTACTTAGGTTTAATCAGAAGGG - Intronic
1066976204 10:42369972-42369994 CTACTTAGCATGAATATAAAAGG - Intergenic
1067196171 10:44120770-44120792 GTACTTACCTTGGATAAGTTAGG - Intergenic
1067670223 10:48313691-48313713 CAACTTACATTAAATAAAAAGGG - Intronic
1068113322 10:52707223-52707245 CTACTGAAGTTGAATAAGAATGG + Intergenic
1068331413 10:55575819-55575841 CTAAGTACCTTGAAGAAGTAAGG - Intronic
1068597213 10:58915864-58915886 TTACTTAACTGAAATAAGAAAGG + Intergenic
1068749526 10:60575812-60575834 CAACTTACCTTTAATAGAAAAGG + Intronic
1071067597 10:81655124-81655146 ATAATTACCTTGAATGTGAATGG - Intergenic
1071881977 10:89909390-89909412 CTACTAACCTTGAATGTAAATGG - Intergenic
1073867526 10:107821936-107821958 CTACTTACGTGGAATAAATAAGG + Intergenic
1075699434 10:124459622-124459644 CTACTGGCCTTGAATACAAAGGG - Intergenic
1076580941 10:131510470-131510492 CTACTTTCTTTGACTAGGAAAGG + Intergenic
1078829493 11:14965959-14965981 ATTCCTACCTTGAATAAGGAAGG + Intronic
1080197321 11:29627581-29627603 CTATTTTGATTGAATAAGAATGG - Intergenic
1080771705 11:35348062-35348084 GCACTTTCCATGAATAAGAAAGG - Intronic
1081043465 11:38240961-38240983 CTACTAACCTTGAATGTAAATGG - Intergenic
1083098043 11:60272868-60272890 ATATTAACCTTGAATATGAATGG - Intergenic
1085536581 11:77224100-77224122 CGGCTTCCCTTGACTAAGAAAGG + Intronic
1086526264 11:87729861-87729883 CCCCTTACCTTGAATCTGAATGG + Intergenic
1086803960 11:91216386-91216408 TTACTTAACTTTAATAATAATGG + Intergenic
1086965636 11:93025036-93025058 CTCCTTACCTTGAGTGATAAAGG - Intergenic
1087337357 11:96861679-96861701 ATACTAACCTTGAATATAAATGG - Intergenic
1087378585 11:97375938-97375960 CTCCTTACCTGAAAAAAGAATGG + Intergenic
1087451620 11:98330679-98330701 CCACTTTCCTTGACTAGGAAAGG + Intergenic
1088259676 11:107932208-107932230 CTACTTGCCTGAAATAAAAAGGG + Intronic
1090684716 11:129102351-129102373 CTACTAACCTTGAATGTAAATGG + Intronic
1091254185 11:134169250-134169272 ATACTTACCTTGGATTAGAAAGG - Intronic
1092151641 12:6253010-6253032 CTACTTGCCTGGTTTAAGAATGG - Intergenic
1092190639 12:6517485-6517507 CTACTTACCTTGCAGGAGAAAGG - Exonic
1092596421 12:10010084-10010106 CTACTTAACGTGAGTATGAATGG - Intronic
1093232967 12:16570803-16570825 TCACTTACCTTGAATAGGTAAGG + Intronic
1093986940 12:25544792-25544814 ATACTTACCTTGAATCACAAAGG + Intronic
1094018979 12:25894226-25894248 CTAATTACCCTGAATTGGAAAGG + Intergenic
1095217017 12:39561058-39561080 ATAATTACCTTGAATATTAATGG + Intronic
1095729787 12:45493820-45493842 CCACTCATCTTGGATAAGAATGG + Intergenic
1095753388 12:45735312-45735334 TTTCCTTCCTTGAATAAGAAGGG - Intronic
1097163151 12:57064508-57064530 CTACTCTCCTTGATTCAGAAAGG - Intronic
1098207179 12:68123800-68123822 ATAATTACCTTGAATATAAATGG - Intergenic
1098632655 12:72742692-72742714 ATACTAACCTTGAATATAAATGG + Intergenic
1098704225 12:73666176-73666198 ATACTAACCTTGAATATAAATGG - Intergenic
1100411058 12:94320334-94320356 ATACTGACCTTGAATATAAATGG - Intronic
1100496525 12:95130317-95130339 CTACTTACATTGAATCAGGCAGG + Intronic
1100530388 12:95456540-95456562 CTGCAAACCTTGAAAAAGAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102031656 12:109743429-109743451 CTCCTTACCCTGAATGGGAAGGG - Intronic
1107417032 13:40210344-40210366 CAACTAACCTTGAAAAAGGATGG + Intergenic
1109763093 13:66856876-66856898 CTTTTTACCTTGAAAAGGAATGG + Intronic
1109864125 13:68239773-68239795 CTACTTTCCTTGAAAATCAATGG + Intergenic
1111728103 13:92038759-92038781 CTCAATACCTTGAAAAAGAATGG + Intronic
1115939017 14:38588606-38588628 ATACTAACCTTGAATATAAATGG - Intergenic
1117287516 14:54301293-54301315 CTACTTGCCTTTAAAAGGAAAGG - Intergenic
1119186136 14:72643822-72643844 CCACTCACCTTGTCTAAGAAAGG + Intronic
1121189548 14:92013928-92013950 CAACTGACTTTGAAGAAGAAAGG + Intronic
1124829825 15:33137402-33137424 CTGCCTACCTTGAATGAGAAGGG + Intronic
1126545624 15:49871039-49871061 CTACTTATCTTTACAAAGAAGGG + Intronic
1129775568 15:78234173-78234195 CTACTTAGCATGGCTAAGAAAGG - Intronic
1131199261 15:90383058-90383080 CTACTAACATTGCATAAGAGTGG + Intergenic
1136646817 16:31627218-31627240 ATACTTACCTTAAATAAAACGGG + Intergenic
1137712734 16:50577775-50577797 ATGCCTACCTTGATTAAGAATGG - Intronic
1138120767 16:54399383-54399405 CTCCTTACCTTGAAGAGCAAAGG + Intergenic
1138896796 16:61215567-61215589 CTATTTTCCTGGAATATGAATGG - Intergenic
1140770821 16:78202357-78202379 CTACGTACCTGGAAAAGGAAGGG - Intronic
1141123514 16:81382515-81382537 CTAATTACATGGAATAAGAGAGG - Exonic
1147480673 17:40759556-40759578 ATAATTACCTTGAATATAAATGG - Intergenic
1155726139 18:29085896-29085918 TTACTTACATTCCATAAGAAAGG + Intergenic
1156686125 18:39648959-39648981 TTACTTTCCTAGAATACGAAAGG - Intergenic
1157065743 18:44348185-44348207 CTATCTACGTTGAATAAGAGTGG + Intergenic
1157325033 18:46662823-46662845 CTAGTTACCTTGAGAAATAAGGG - Intergenic
1158100591 18:53825386-53825408 ATATTTACCTTGAATACAAATGG + Intergenic
1159071756 18:63631075-63631097 ATAGTTACCTTGAATATAAATGG + Intergenic
1159536245 18:69718581-69718603 CTATTTAGCTTAAAAAAGAAAGG + Intronic
927224617 2:20751212-20751234 CTTTTTACCTTTAAAAAGAAAGG - Intronic
928408695 2:31036119-31036141 CTAATTACATTGAATATAAATGG - Intronic
931797451 2:65724708-65724730 CTACTTACCTTGAAAATTATGGG + Intergenic
934219692 2:90070850-90070872 ATATTTACCTGGAATAAAAAAGG + Intergenic
936868081 2:117099850-117099872 CTACGTACCTAGAATAATACTGG + Intergenic
937498099 2:122446697-122446719 ATAATTACCTTGAATGTGAATGG - Intergenic
937779814 2:125824140-125824162 ACACTTACCTTGAATATGCAGGG - Intergenic
941146217 2:161849429-161849451 GGACTTATGTTGAATAAGAATGG + Intronic
941409014 2:165129640-165129662 TTACTTTCTTTGAAGAAGAAAGG + Intronic
941878777 2:170461089-170461111 CTAGTTAATTTGAATAAAAAGGG + Intronic
942156804 2:173137906-173137928 CTACTTACCTGGAATAAATGAGG - Intronic
943294946 2:186126364-186126386 CTACATCCCTTGACTAAGACAGG - Intergenic
945810124 2:214539156-214539178 CTACTGCACTTGATTAAGAATGG + Intronic
946136107 2:217648513-217648535 CTGCTGACCTTGATTAAGATAGG + Intronic
946629890 2:221655753-221655775 CTACTTGCCTGGAATAAAACAGG + Intergenic
1171247217 20:23621241-23621263 CGGCTTCCCTTGGATAAGAAAGG + Intergenic
1177196350 21:17907549-17907571 CTGATTTCCTTGAATATGAATGG - Intronic
1177389263 21:20445551-20445573 ATACTTTTCTTGAATAATAAGGG + Intergenic
1177662338 21:24101377-24101399 GTACTAACCTTGAATATAAATGG - Intergenic
1178124498 21:29502273-29502295 CTTCTTTCCTTGAACATGAAAGG - Intronic
1184756832 22:46521057-46521079 CTACTTAGCCTGAAAAAGGACGG - Intronic
950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG + Intronic
951317060 3:21200963-21200985 ATATTAACCTTGAATATGAATGG - Intergenic
951456189 3:22894807-22894829 CAACTTACATTGATTAAGATTGG + Intergenic
952560783 3:34591041-34591063 ATACTAACCTTGAATGAAAATGG - Intergenic
956487546 3:69739168-69739190 CTACTTAATATGAATAAGAATGG - Intergenic
957968586 3:87353919-87353941 TTGCTTACATTTAATAAGAAAGG + Intergenic
960933300 3:122876589-122876611 CTGCTCACCTTGAGTGAGAAAGG + Intronic
963175179 3:142290429-142290451 CCACTTACTTTGACTAGGAAAGG - Intergenic
964079568 3:152736857-152736879 ATATTTACCTTGAATAAACATGG + Intergenic
964597877 3:158457176-158457198 CTTTTTACTTTGAACAAGAAAGG - Intronic
965810756 3:172589639-172589661 ATACTAACCTTGAATATAAATGG - Intergenic
970489431 4:16557297-16557319 CCCCTTACTTTGACTAAGAAAGG - Intronic
970919555 4:21377170-21377192 CTACATATCTTTAATTAGAATGG - Intronic
972550037 4:40124025-40124047 TTACTTAGATTGAGTAAGAATGG + Intronic
972701004 4:41493174-41493196 ATACTTACCTTAAATATAAATGG - Intronic
972899392 4:43664424-43664446 CAAGTTGCCTTGTATAAGAATGG + Intergenic
972927249 4:44025407-44025429 CCACATACCTTGAATGATAAAGG + Intergenic
973300284 4:48574734-48574756 CTAATTCTCTTGGATAAGAAGGG + Intronic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
977469253 4:97421502-97421524 CTACTTAGGCTGTATAAGAATGG - Intronic
978241277 4:106519638-106519660 ATACTAACCTTGAATGTGAATGG - Intergenic
981602628 4:146507720-146507742 CTCCTTACCTTGCATAGTAAAGG - Intronic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982755813 4:159217488-159217510 CTACTAGCCTTAAAAAAGAATGG - Intronic
982956080 4:161768316-161768338 CTACCTTCCTTGAAAACGAATGG - Intronic
984631880 4:182069850-182069872 GTCCTTACCTTGAAGAAGAGGGG - Intergenic
985108084 4:186518767-186518789 ATACTAACATTGAATATGAATGG - Intronic
987646029 5:20673092-20673114 TTACTTACCTTGAGAAATAATGG + Intergenic
988581036 5:32469001-32469023 GAACTGACCTTGAACAAGAAGGG - Intergenic
988638345 5:33012440-33012462 GTAATTACCTTGAATATAAATGG - Intergenic
989522488 5:42418330-42418352 CTGCTTCCCTTGGCTAAGAAAGG + Intergenic
991916837 5:71614097-71614119 CTATTTCCCTTAAATAGGAAAGG + Intronic
993441806 5:87965979-87966001 CTGGAAACCTTGAATAAGAATGG - Intergenic
994613994 5:102080259-102080281 ATACTAACCTTGAATGAAAATGG + Intergenic
995270804 5:110217751-110217773 ATACTAACCTTGAATATAAATGG - Intergenic
995541817 5:113193096-113193118 CTGCTGGCCTTGAATATGAAGGG - Intronic
996998049 5:129723327-129723349 CTTATTACCTGGCATAAGAATGG + Intronic
997042251 5:130271235-130271257 CTAATTAATTTAAATAAGAAAGG - Intergenic
997073672 5:130646352-130646374 CTACTTCCCTTCAAAAAGATAGG - Intergenic
998275735 5:140751693-140751715 ATACTAACCTTGAATATAAATGG - Intergenic
998617670 5:143758445-143758467 CTCCTTGGCTTAAATAAGAATGG - Intergenic
1004974127 6:20945954-20945976 CTAGATACGTTGTATAAGAAGGG - Intronic
1008138922 6:47809295-47809317 CTTCTTCCCTTGAATAAGTAAGG + Intronic
1008297640 6:49797264-49797286 CCACTTCCTTTGACTAAGAAAGG + Intergenic
1008823608 6:55664162-55664184 ATACTAACCTTGAATGTGAATGG - Intergenic
1009033019 6:58082861-58082883 ATACTTACCTTGAACATAAATGG + Intergenic
1009034546 6:58100312-58100334 TTACTAACCTTGAATATAAATGG + Intergenic
1009208636 6:60834629-60834651 ATACTTACCTTGAACATAAATGG + Intergenic
1011368677 6:86609001-86609023 ACGCTTACCTTGAATAAGAAAGG + Intergenic
1013839523 6:114374074-114374096 GTAGTTACCTTTGATAAGAAAGG + Intergenic
1014090372 6:117397775-117397797 CTACTTAAGTGGAAAAAGAAAGG + Intronic
1015318894 6:131849088-131849110 CTAGATACCTTGAATAAGCCAGG - Intronic
1016107957 6:140186225-140186247 ATACTGACCTTGAATATAAATGG + Intergenic
1016121339 6:140345548-140345570 CTACCTTCCTTGAATCTGAATGG + Intergenic
1017345247 6:153372062-153372084 ATACTAACCTTGAATATAAATGG + Intergenic
1020424938 7:8054577-8054599 ATATTTACCTTGAATAACCATGG - Intronic
1020579682 7:9980101-9980123 TTACTTATCTGGAATAAGAGAGG - Intergenic
1023005101 7:35856653-35856675 CTCCTTACCCTGAATGAGACTGG + Intronic
1023235051 7:38076822-38076844 CTACTAACCTTGAATGTAAATGG - Intergenic
1024441170 7:49419813-49419835 CAAATCACATTGAATAAGAAGGG - Intergenic
1026273428 7:68856093-68856115 ATCTTTACCTTGAACAAGAAAGG + Intergenic
1026369756 7:69687492-69687514 CTAGTTACCTTAGATAAGAGAGG - Intronic
1028034177 7:85958981-85959003 CTACCTACATTGAATGGGAAGGG + Intergenic
1028542426 7:91957584-91957606 CTACTAACCTAAAATATGAAAGG - Intronic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028879451 7:95863645-95863667 CTAGTTACCTTGAAAAATAAAGG - Intronic
1029059805 7:97785833-97785855 CTGCTTTCCTTGACTAGGAAAGG - Intergenic
1030444423 7:109631507-109631529 TTACATACCTTGAAAAATAATGG + Intergenic
1031295011 7:119991112-119991134 ATACTAACCTTGAATACAAATGG + Intergenic
1032354682 7:131199548-131199570 CCACTTCCCTTGGAGAAGAAAGG + Intronic
1032392997 7:131568585-131568607 CCACCCAACTTGAATAAGAACGG + Intergenic
1033480667 7:141737375-141737397 ATACTTACCATGAATTACAATGG + Intergenic
1033822880 7:145155244-145155266 CTACTTTCCTTGACTGTGAACGG - Intergenic
1034714890 7:153232996-153233018 GTACTAACCTTAAATAAAAATGG - Intergenic
1035525175 8:306704-306726 TTACTGAATTTGAATAAGAACGG - Intergenic
1037413817 8:18626451-18626473 ATACTTACTTTGATTAAGCATGG - Intronic
1037640967 8:20742920-20742942 CTGCTTCCCTTGGCTAAGAAAGG - Intergenic
1037952078 8:23025668-23025690 GTAGTTACCTGAAATAAGAAGGG + Intronic
1043396712 8:79844442-79844464 CTACTAACCTTAAATGTGAATGG + Intergenic
1048804961 8:138231582-138231604 CAACTTACCAGGAATATGAAAGG + Intronic
1055187904 9:73477862-73477884 AAACTTACATTGAATATGAAAGG + Intergenic
1056713173 9:89008031-89008053 ATACTTACATTGATTAAAAACGG - Intergenic
1057753682 9:97812123-97812145 GTACTTACCTTGAATTGGCAAGG + Intergenic
1058944526 9:109843700-109843722 CCACTTTCCTTTAATAAGCAAGG - Intronic
1059607375 9:115848625-115848647 CCACATACCTTGCATATGAAAGG - Intergenic
1060451049 9:123740470-123740492 CTACTTTCCCTGAATGAGCAAGG + Intronic
1060461321 9:123857353-123857375 GTAACAACCTTGAATAAGAAAGG + Intronic
1186364693 X:8879217-8879239 CTAGGTATCTTTAATAAGAAGGG + Intergenic
1186555744 X:10556424-10556446 CTACTTAGCTTGGTTTAGAAAGG + Intronic
1186988806 X:15045734-15045756 CTACTTAATGTGAAGAAGAATGG - Intergenic
1188711679 X:33408297-33408319 CTACTAACCTTGAATGAAAATGG - Intergenic
1188826200 X:34838198-34838220 ATAATTACCTTGAATATAAATGG - Intergenic
1189749509 X:44205350-44205372 ATACTAACCTTGAATATAAATGG + Intronic
1191217245 X:57946246-57946268 ATACTAACCTTGAATAAAAATGG - Intergenic
1192829780 X:74739954-74739976 CTTTTTACTTTGAAAAAGAAGGG + Intronic
1193019964 X:76781017-76781039 CAGCTTACCTTGACTAAAAAAGG + Intergenic
1193066757 X:77268373-77268395 CCACTTCCCTTGACTAGGAAAGG - Intergenic
1193079994 X:77397385-77397407 CTACTGACTTTGAAGAAGGAAGG - Intergenic
1193384512 X:80854690-80854712 CTACTTGGCTTCAAAAAGAAAGG - Intergenic
1193591837 X:83397923-83397945 TTATTCACCTTGAATATGAATGG + Intergenic
1193610686 X:83628534-83628556 ATACTAACCTTGAATGTGAATGG - Intergenic
1193888995 X:87019305-87019327 ATACTAACCTTGAATGTGAATGG + Intergenic
1195544330 X:106098488-106098510 ATACTAACCTTGAATATAAATGG - Intergenic
1196082191 X:111644979-111645001 ATAATTACCTTGAATATAAATGG - Intergenic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1197132635 X:123022154-123022176 ATACTAACATTGAATATGAATGG + Intergenic
1197285551 X:124591221-124591243 ATATTTACCTTGAATATAAATGG - Intronic
1197370385 X:125619667-125619689 ATACTAACCTTGAATATAAATGG - Intergenic
1199682146 X:150232909-150232931 CTGCTTACTTTGGCTAAGAAGGG + Intergenic
1202282177 Y:23200667-23200689 CTACTTATCTTGAATAAGAATGG + Intergenic
1202283714 Y:23217852-23217874 CTACTTATCTTGAATAAGAATGG - Intergenic
1202433849 Y:24815052-24815074 CTACTTATCTTGAATAAGAATGG + Intergenic
1202435390 Y:24832238-24832260 CTACTTATCTTGAATAAGAATGG - Intergenic