ID: 950915290

View in Genome Browser
Species Human (GRCh38)
Location 3:16638356-16638378
Sequence GAGAGTAGTGGGAAAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950915290_950915294 -3 Left 950915290 3:16638356-16638378 CCTGCAGTTTTCCCACTACTCTC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 950915294 3:16638376-16638398 CTCTGTTGTTTTACTGGTCCAGG 0: 1
1: 0
2: 3
3: 9
4: 154
950915290_950915295 9 Left 950915290 3:16638356-16638378 CCTGCAGTTTTCCCACTACTCTC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 950915295 3:16638388-16638410 ACTGGTCCAGGATCCAATCCAGG 0: 1
1: 5
2: 52
3: 287
4: 734
950915290_950915293 -9 Left 950915290 3:16638356-16638378 CCTGCAGTTTTCCCACTACTCTC 0: 1
1: 0
2: 0
3: 18
4: 220
Right 950915293 3:16638370-16638392 ACTACTCTCTGTTGTTTTACTGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950915290 Original CRISPR GAGAGTAGTGGGAAAACTGC AGG (reversed) Intronic
901592074 1:10352710-10352732 TAGAGTTGTGGGAAGACTTCAGG - Exonic
902706926 1:18212070-18212092 CAGAGAAGTGGGATAGCTGCAGG + Intronic
902936785 1:19770163-19770185 CAGAGTGGGGAGAAAACTGCTGG + Intronic
903803685 1:25988979-25989001 GTGACTGGAGGGAAAACTGCAGG + Intronic
905302556 1:36995732-36995754 CAGAGAACTGGGAAAACTGCAGG - Intronic
905923458 1:41733893-41733915 GAGAGGAGTGGGACACCTGGAGG - Intronic
906020273 1:42622075-42622097 AAGAGTAGTGGGGAAATTGGGGG - Intronic
908095316 1:60731413-60731435 GAGGCTATTGGGAAAACTTCAGG - Intergenic
911646769 1:100345553-100345575 TGGAGTAGTGGAAAAAATGCTGG - Intergenic
913089287 1:115465751-115465773 TAGACTAGTTGGAAACCTGCGGG + Intergenic
913207252 1:116551446-116551468 GAGAGAGGTGAGAAAGCTGCAGG - Intronic
914684588 1:149967252-149967274 GAGAGTAGAGGGAAGAGTGTGGG + Intronic
915243528 1:154540903-154540925 GGGAGCAGAGGGAATACTGCAGG + Intronic
915988005 1:160485620-160485642 GAGTGCATTGGGAAACCTGCAGG + Exonic
916679412 1:167090399-167090421 GTGAGAAGAGGGAAAATTGCAGG - Exonic
918934053 1:190897497-190897519 AAGGGTAGTGGGAAAACAGGAGG - Intergenic
919983308 1:202656038-202656060 GAGAGGAGTGGGTGAACAGCGGG + Intronic
920402473 1:205684905-205684927 GACATTAGTGGAAAAACTGGTGG + Intergenic
921005387 1:211087981-211088003 GCGATTTGTGGGAAAACTGGGGG + Intronic
923859457 1:237878443-237878465 GAGAGAAGTTGGAAGTCTGCTGG - Intronic
1063803997 10:9616438-9616460 GAGAGAGGTGAGAAAGCTGCAGG - Intergenic
1063886630 10:10586580-10586602 CCGTGTAGTGGGAAAACTGCTGG + Intergenic
1069588469 10:69627108-69627130 AGTAGTAGTGGGAAAATTGCTGG - Intergenic
1071515691 10:86295303-86295325 GAGAGGAGGGAGAGAACTGCTGG + Intronic
1071578878 10:86752534-86752556 GAGAGTAGTGAGCAAACAACAGG + Intergenic
1073160895 10:101393698-101393720 GAGAGTAGTGGAAAAACACGAGG + Intronic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1074766761 10:116705516-116705538 GAGAGGAGTGGGCAAGCTGCAGG - Intronic
1075132421 10:119751447-119751469 GAGAGTAGTAGGAATAAAGCTGG + Intronic
1075399067 10:122148768-122148790 GAGGGGAGTGTGAAAACTCCTGG - Intronic
1078385802 11:10891467-10891489 GAGAGAAATGGGACAATTGCAGG + Intergenic
1078503344 11:11907118-11907140 GAGAGTGGTGGCAAATCAGCAGG - Intronic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1079941259 11:26683688-26683710 GAGAGGAGAGAGAAAACGGCTGG + Intronic
1079968612 11:27008341-27008363 GGGAGTAGTGGGACAAATGGAGG + Intergenic
1081840598 11:46198604-46198626 GAGGGTAGTGGGAAGACCACAGG + Intergenic
1081860532 11:46331132-46331154 GAGCGAAGAGGGCAAACTGCAGG + Intergenic
1082881712 11:58044471-58044493 GAGAGTGCTGGGGAGACTGCAGG + Intronic
1085571070 11:77558524-77558546 GTGAGTAATGGGGAAACTGCTGG - Intronic
1085803352 11:79611791-79611813 GAGTGTGGGAGGAAAACTGCAGG + Intergenic
1086169127 11:83815640-83815662 GAAAGTGGTGGGCAAGCTGCAGG + Intronic
1087204612 11:95380983-95381005 GAGAATATTGGGCAAACTACAGG + Intergenic
1088107279 11:106221598-106221620 AAGAGCAATGGGAAAACTGAGGG + Intergenic
1089379346 11:118016367-118016389 GAGAGAGGTTGGAAACCTGCAGG + Intergenic
1095373251 12:41495560-41495582 GAAATTAGTGGGAAAAATGATGG - Intronic
1096161719 12:49384113-49384135 GACATTAGTGGAAAAACTGGAGG - Intronic
1096906267 12:54939013-54939035 GAGAGAGGTGAGGAAACTGCAGG + Intergenic
1099982512 12:89622463-89622485 GAGACTACTGTGAAAACTGTTGG - Intronic
1100723482 12:97384086-97384108 GAGAGATGTGGGAAAACAGCTGG + Intergenic
1101538011 12:105638273-105638295 GAGAGTAGAGTGATAAATGCAGG + Intergenic
1105654354 13:22419860-22419882 GTGCTTAGTGGGAAAACAGCTGG + Intergenic
1106995375 13:35475178-35475200 GAAAGTAGTGGGGACACCGCCGG + Exonic
1107001262 13:35547975-35547997 GGAAGTACTGAGAAAACTGCTGG + Intronic
1107768379 13:43762261-43762283 GGGAGCAATGGGAAAACTGGAGG - Intronic
1109923816 13:69106870-69106892 CACAGTAGTGGGCAAGCTGCAGG + Intergenic
1110362661 13:74644770-74644792 GAAAGTAGAGAGAAAACTGAGGG - Intergenic
1113304399 13:109061096-109061118 GAGAGAGGTGAGGAAACTGCAGG - Intronic
1113366869 13:109684562-109684584 GAGATAAGTCGGAGAACTGCAGG - Intergenic
1113864702 13:113513262-113513284 AAGAGTAGGGGGTAAAATGCAGG + Intronic
1115534163 14:34357251-34357273 GAGTGCAGTGGTATAACTGCCGG + Intronic
1116592323 14:46793938-46793960 GAGAGAGGTGGGGAAATTGCAGG - Intergenic
1116640661 14:47458465-47458487 GAGAGCAGAGGGTAAACTGGTGG + Intronic
1117512162 14:56463461-56463483 GAGAGCAGTGGGAATTCTGTAGG + Intergenic
1117818469 14:59622820-59622842 GAGCCCAGAGGGAAAACTGCTGG + Intronic
1117932349 14:60856395-60856417 GAGAGAGGTGAGAAAGCTGCAGG + Intronic
1119135243 14:72212398-72212420 GAGAGTAATGGTCAAACTGGAGG + Intronic
1120249827 14:82049834-82049856 GAGAGGAATGGGAAGACTGGTGG + Intergenic
1120427042 14:84361554-84361576 GAGTATAGTAGGAAAATTGCAGG - Intergenic
1121182107 14:91937027-91937049 GAGAGTGGTGGGGCAGCTGCTGG + Exonic
1121923087 14:97901545-97901567 GATACTAGTAGGAAAACTGATGG - Intergenic
1124819093 15:33025869-33025891 GAAAGTAACGGGAAAACTTCAGG + Intronic
1125964571 15:43863531-43863553 GAGAGTAGTTAACAAACTGCTGG - Intronic
1126615626 15:50576758-50576780 AAGAGTACAGGGATAACTGCAGG + Intronic
1127590785 15:60420573-60420595 GAGATGAGAGAGAAAACTGCAGG - Exonic
1128271101 15:66310716-66310738 GAAATTAGTGGGAGAAATGCTGG + Intronic
1128373511 15:67058732-67058754 AAGAGTAGTTGGAAAATTGTTGG - Intergenic
1129136338 15:73555540-73555562 CAGAGAAGTGGGTAAACTGGAGG - Intronic
1132224274 15:100128356-100128378 GGGAGGAGTGGGAATGCTGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1135007276 16:18837329-18837351 GACAGATGTGGAAAAACTGCAGG - Exonic
1138821597 16:60266857-60266879 GACATTAGTGGAAAAACTGGTGG - Intergenic
1141384108 16:83603637-83603659 GAGAGCAGTGGGGCAACTGCAGG - Intronic
1144336646 17:14277485-14277507 TAAAGTAGTGGCAAAACTGGAGG - Intergenic
1144527710 17:16004574-16004596 AAGAGCAGTGTGAAAGCTGCTGG + Intronic
1144762473 17:17715164-17715186 GAGAGGATTGGGAAAAATGATGG - Intronic
1146008593 17:29177753-29177775 GAGTGTGGTGGGAAAACTGAGGG - Intronic
1148459694 17:47832025-47832047 TAGAGCAGTTGGAAAACAGCGGG + Intronic
1150324797 17:64248096-64248118 GACTGTAGTGGGAAAACGGCTGG + Intronic
1153690236 18:7585089-7585111 AAGATCCGTGGGAAAACTGCAGG + Intronic
1160318803 18:77871279-77871301 GAGAGTAGTCAAAAAACTTCCGG + Intergenic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1160804285 19:985019-985041 GGGAGTAGAGGGGAAACTGTGGG - Intronic
1162525985 19:11206800-11206822 GGGAGTGGTGGGAAAATAGCTGG + Intronic
1163127501 19:15252137-15252159 GAGAGGAGTGGGAATGCTCCTGG - Intronic
1163389299 19:17020659-17020681 GGGAGTAATGGGAAAACACCAGG + Intronic
1164272518 19:23685875-23685897 GAGAGAACTGTGAAAAATGCAGG + Intronic
1164527515 19:29022813-29022835 GAGGGTAATGGGAATACAGCAGG + Intergenic
1164895157 19:31870323-31870345 CAGTGAAGTGGGAAAACAGCAGG - Intergenic
1165343680 19:35229720-35229742 GGGAGTAGGGGGAAAGGTGCAGG - Intergenic
1167458295 19:49610283-49610305 GATATTAATGAGAAAACTGCAGG - Intronic
1167772813 19:51531416-51531438 AAGGGTAGTGGGCAATCTGCAGG + Exonic
1168645296 19:58055578-58055600 GAGAGTAATGGGCTGACTGCGGG - Intergenic
925210458 2:2041381-2041403 GAGAGAAGTTGGAACCCTGCTGG + Intronic
925658282 2:6173908-6173930 GAGAGAAGTGAGGAGACTGCAGG + Intergenic
925685405 2:6467303-6467325 AACAGTAGTGGGCAAATTGCTGG - Intergenic
929932302 2:46267888-46267910 GATATTAGTGGGAAAACTAGCGG + Intergenic
930363914 2:50414987-50415009 GAGAGTAATGGGAAAGATGAAGG - Intronic
930594807 2:53374100-53374122 AAGAGTAGAAGGAAAACTGAGGG - Intergenic
931869630 2:66444618-66444640 CACAGAAGTGGGAAAACTGCAGG + Intronic
932275406 2:70448259-70448281 TAGAGCAGTGGGAAAAATCCAGG + Exonic
933457609 2:82536483-82536505 GAAGGGAGTAGGAAAACTGCAGG - Intergenic
934579155 2:95424667-95424689 GATAGGGGTGGGAAAGCTGCTGG - Intergenic
935788192 2:106568010-106568032 CAGAATAATGGGAAAGCTGCTGG + Intergenic
936711570 2:115137406-115137428 CAGACTGGTGGGAAAAGTGCAGG + Intronic
937328792 2:121009049-121009071 GAGACTAGTGAGAAGGCTGCTGG - Intergenic
941832728 2:169980000-169980022 AAGAGTAGGGGGAAAGGTGCTGG + Intronic
943783391 2:191849471-191849493 GAGAGTAGAAGCAAAGCTGCAGG + Intergenic
944414981 2:199471333-199471355 GAGAATGGTGGGAAAGATGCTGG - Intergenic
946370883 2:219280532-219280554 GAGAGTCGGGGGACAAATGCAGG - Intronic
946409755 2:219510133-219510155 GAGATAAGTGGGAAAAGTGAGGG - Intergenic
948750762 2:240131501-240131523 GAGAGCAGAGGGAAACCAGCCGG + Intronic
948917720 2:241044926-241044948 GAAAGTACTGGGGAAACTGGAGG + Intronic
1169289255 20:4334687-4334709 GTGAGTAAGGGGAAAACTTCTGG + Intergenic
1169941321 20:10941025-10941047 GAGGGGAGTGGGACACCTGCAGG + Intergenic
1170153955 20:13252856-13252878 GAGAGAAGTGGGAAGACAGAAGG - Intronic
1172555198 20:35834616-35834638 GAGAGGAGTGGGAAATCTCATGG + Intronic
1173609310 20:44355357-44355379 GGAAGTAGTGGGAAAACCGAGGG - Intergenic
1173797560 20:45872933-45872955 TAGAGTATTTGGAAAAGTGCAGG + Intronic
1174563654 20:51448970-51448992 GAGAGCAGTGGAAAAACAGTAGG - Intronic
1177303124 21:19276709-19276731 GAGAGCAGAGGAAAAACAGCTGG - Intergenic
1178689779 21:34741331-34741353 GAGAATAGTGGGAGACCTGGAGG + Intergenic
1179908492 21:44436140-44436162 GAGAGCAGTGGGCCAGCTGCTGG - Intronic
1180059741 21:45378748-45378770 GAGGGCAGGGGGAGAACTGCGGG - Intergenic
950687161 3:14626897-14626919 GAGAGTGGTGAGGTAACTGCAGG + Intergenic
950915290 3:16638356-16638378 GAGAGTAGTGGGAAAACTGCAGG - Intronic
953174523 3:40537724-40537746 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
954680776 3:52344783-52344805 GGGAGAAGTGGGACAAGTGCTGG - Intronic
958268787 3:91472329-91472351 GAGAGTACTGGGAGAAGTTCAGG + Intergenic
962187337 3:133273599-133273621 GTGAGTGGTGGAAGAACTGCAGG + Intronic
962203208 3:133416394-133416416 GAGAGTAGAGGGGAAAGGGCAGG - Intronic
964076230 3:152695660-152695682 GAGAGAGGTGAGAAAACTGCAGG + Intergenic
966059798 3:175741023-175741045 GAGAGTAAAGGGAGAATTGCTGG + Intronic
967368840 3:188719752-188719774 GAAAGTGGTGGGGAAAGTGCAGG - Intronic
968456627 4:703824-703846 GAGAGTAGTGGGAAGCCTAGGGG + Intergenic
968938075 4:3624051-3624073 GAGGGGAGTGGGAAGGCTGCGGG - Intergenic
971261685 4:25062994-25063016 GAGGGCAGTTGGAAAACGGCTGG + Intergenic
971272635 4:25164881-25164903 GAGAGTTGTTGGGAAAATGCAGG - Intronic
971564796 4:28124277-28124299 GAGAGAAGTGAGGAAACTGCAGG - Intergenic
971569742 4:28196039-28196061 GAGTGAAGTGGGAGAACTGCTGG + Intergenic
972560868 4:40227451-40227473 GAGAGAAGTGGTTAAGCTGCTGG - Intronic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
978810822 4:112847767-112847789 GAGGGTAGTTTGAAAATTGCTGG + Intronic
979009240 4:115345682-115345704 TACAGTAGTTGGAAAACTGCAGG - Intergenic
979017588 4:115453768-115453790 AAGACAAGTGGGAACACTGCTGG - Intergenic
981140899 4:141267839-141267861 TAGGGTGGTGGGAAAACTGAGGG - Intergenic
981543945 4:145875000-145875022 GAAAGGAATGGGAAAGCTGCTGG + Intronic
981644191 4:146979943-146979965 GAGAGTATTAGGAACACTCCGGG - Intergenic
981823381 4:148912200-148912222 GACACTAGTGTGAATACTGCTGG - Intergenic
986631555 5:9778722-9778744 GAGAGAGGTGAGAAAACTACAGG - Intergenic
989124982 5:38044209-38044231 GAGAGTAGTGTGTAATCTTCTGG + Intergenic
990029717 5:51242487-51242509 GAGGGGAGAGGGAAAAATGCAGG + Intergenic
990210973 5:53481010-53481032 GAGAGGAGTGGGAAAATTGTAGG + Intronic
992934020 5:81682582-81682604 GACCTTAGTGGGAAAACTTCAGG - Intronic
993787313 5:92159254-92159276 GAGAGTGGTGGGGAAACGGCTGG - Intergenic
994707201 5:103221067-103221089 GAGAGTAGAGTGCAAACTGTAGG + Intergenic
995227283 5:109715090-109715112 GAGGGTACTGGGAGAGCTGCAGG + Intronic
995360465 5:111290741-111290763 GTGAGAAGTGGGAGAAGTGCTGG + Intronic
995838500 5:116421575-116421597 GAGTGTATTGGTAAAACTACAGG + Intergenic
996363247 5:122673699-122673721 TAGAGAAGTGTGAAAATTGCAGG + Intergenic
997150457 5:131488159-131488181 TTGAGTAGTGGGAAAACAGTTGG - Intronic
997462501 5:134063255-134063277 GACATTAGTGGGAAAACTAATGG - Intergenic
999148327 5:149410338-149410360 GAGTTTAGTTGGAAAATTGCAGG - Intergenic
999336962 5:150728670-150728692 GAGAGAAGTGGGAAAAATATTGG - Intronic
999727347 5:154447162-154447184 GAGAGAAGTTGGAAAAGAGCCGG - Intronic
1001694926 5:173662989-173663011 GTTAGTAGTGGGTAAACTGTAGG + Intergenic
1003275062 6:4643370-4643392 GACAGTGGTGGGAGAACAGCAGG + Intergenic
1003317556 6:5026038-5026060 GAGTGAAGAGGGAAACCTGCCGG + Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004039930 6:11965503-11965525 GAGAGAAGGGAGAGAACTGCAGG + Intergenic
1004108388 6:12688493-12688515 GACAGTAATAGGAAAACTGATGG + Intergenic
1005419053 6:25630346-25630368 GAGAGTAGCAGGAAAACTGAGGG - Intergenic
1006189473 6:32198793-32198815 GAGAGGGGTGGGAAGCCTGCTGG - Intronic
1006338677 6:33433812-33433834 GAGAGCAGTGGGAAAGCGGGAGG - Intronic
1007452104 6:41947936-41947958 GAGAGTAGTGGGAAATGGGGTGG - Intronic
1008488106 6:52056841-52056863 GAGGGGAGTGGGAGAACTGGGGG - Intronic
1012252759 6:96997114-96997136 GAGAGTGTTGGGAAAAGAGCAGG + Intronic
1012476351 6:99618677-99618699 GGGAGTAGTGATAACACTGCTGG + Intergenic
1012928678 6:105294372-105294394 AAGAATTGTGGGAAAACTTCTGG - Intronic
1014168695 6:118253995-118254017 GAGGGAAGTGGGATAGCTGCTGG + Intronic
1015411744 6:132901241-132901263 GAGATTAGTGGGAAATCTGATGG + Intergenic
1015648292 6:135421054-135421076 GAGAGAAATGGGAGAACGGCTGG + Intronic
1016070009 6:139727311-139727333 GAGAGAAGTGAGAAAATTGATGG - Intergenic
1017256602 6:152340498-152340520 GGGAGTGGTGGGGACACTGCTGG - Intronic
1018618458 6:165709167-165709189 GAGAGTGGTGGGGAGAGTGCAGG - Intronic
1019209410 6:170393187-170393209 GAGAGGAGAGGGAACCCTGCAGG - Intronic
1022028109 7:26467290-26467312 GATAGCAGTGGGAGATCTGCTGG + Intergenic
1022045429 7:26618763-26618785 GAGAGCAGAGGGAAAGCTGAAGG + Intergenic
1024976941 7:55122178-55122200 GAGAGTGCTGGGAAGACAGCAGG - Intronic
1027528187 7:79297548-79297570 AAGAGTACTGGGTAGACTGCAGG - Intronic
1027596093 7:80176280-80176302 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
1029049970 7:97675424-97675446 GAGAGAGGTCAGAAAACTGCAGG + Intergenic
1031020727 7:116625013-116625035 GAGAGTAGTAAGCAAACTGCAGG - Intergenic
1032374911 7:131403708-131403730 GAGAGAAATGGGGGAACTGCTGG + Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1034390683 7:150785232-150785254 AAGAGCAGTGGGAAAGCAGCAGG + Intergenic
1036928485 8:12930568-12930590 AAGAGTAGAGGCAAATCTGCAGG + Intergenic
1039652672 8:39359145-39359167 GAGAGAAGTGAGTAAGCTGCAGG + Intergenic
1040290468 8:46121536-46121558 GGGAGTAGTGGCGAGACTGCAGG - Intergenic
1040295933 8:46149090-46149112 GAGAGAAGCGGCAAGACTGCAGG - Intergenic
1040306941 8:46216951-46216973 GGGAGAAGTGGCAAGACTGCAGG + Intergenic
1040316389 8:46263141-46263163 GAGAGAAGTGGCAAGACCGCAGG + Intergenic
1040334538 8:46409375-46409397 GGGAGAAGTGGGGAGACTGCAGG + Intergenic
1040356176 8:46620658-46620680 GAGAGTCCTGGGTAAGCTGCTGG + Intergenic
1045831913 8:106471999-106472021 GACAGTAGTGGAAAAACTAATGG - Intronic
1046571712 8:115974518-115974540 GAGAGAGGTGAGGAAACTGCAGG - Intergenic
1050375918 9:4972751-4972773 GAGAGAAATGTGAAAAGTGCTGG - Intergenic
1050607661 9:7318071-7318093 AAGAGTACTGGGAAGTCTGCAGG - Intergenic
1050971783 9:11886547-11886569 GAGAGTAATTGTAGAACTGCTGG - Intergenic
1055807361 9:80111441-80111463 GAGAGAAGTGAGGAAGCTGCAGG - Intergenic
1057065279 9:92043933-92043955 GAAAGGAGTGGGAAATCTGGTGG - Intronic
1057530189 9:95838207-95838229 GAGACTAGTGGGAGTATTGCAGG - Intergenic
1058213529 9:102203296-102203318 AAGATTAATGTGAAAACTGCAGG - Intergenic
1058976934 9:110133640-110133662 GAGGGTAGTGGGAAATCAGTAGG - Intronic
1059758565 9:117317052-117317074 GAAAGTAGAGGGAAAACAGAAGG - Intronic
1060650688 9:125324292-125324314 GAAAGTATAGGGAAAGCTGCTGG + Intronic
1061133812 9:128722286-128722308 TACAGTAGTGAGGAAACTGCTGG - Intronic
1186950016 X:14614198-14614220 GAGAGTAATGGGAAAGATGGAGG + Intronic
1186977504 X:14923875-14923897 GATAAGCGTGGGAAAACTGCTGG - Intergenic
1187320283 X:18231680-18231702 AAGAGTAGAGGCAAAACTGAAGG + Intergenic
1187842583 X:23504481-23504503 GAGACAGATGGGAAAACTGCTGG - Intergenic
1187953014 X:24489359-24489381 AAGAGTAGTTGGAAAATTTCAGG - Intronic
1190905980 X:54728788-54728810 GACAGTGGTAGGGAAACTGCAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194375277 X:93124978-93125000 GAGAATAGAGAGAAAACTGGCGG + Intergenic
1197121386 X:122897555-122897577 GAGATTACTGGGCAACCTGCAGG + Intergenic
1197756857 X:130001712-130001734 GAGAGTGGTGGGGAAATGGCAGG + Intronic
1198826599 X:140704937-140704959 GAGAGAGATGGGAAAACAGCAGG + Intergenic
1199152977 X:144511067-144511089 AAGAGTAGTGGGAAAATAGTGGG + Intergenic