ID: 950917343

View in Genome Browser
Species Human (GRCh38)
Location 3:16659275-16659297
Sequence CTCACTGATCATAGGGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950917343 Original CRISPR CTCACTGATCATAGGGGTTA TGG Intronic
903465803 1:23552159-23552181 CTCAGGGCTCATAGGTGTTAGGG - Intergenic
906701799 1:47865003-47865025 CTCTCAGATCATGGGGGTTGGGG + Intronic
911954017 1:104213174-104213196 CTCATTGATCAGAAGGGTAAAGG - Intergenic
917217786 1:172696140-172696162 CTAACTGAACATAGGGGCAAAGG + Intergenic
917680842 1:177365843-177365865 CTCAATGAACTTAGGTGTTATGG - Intergenic
1064154568 10:12893429-12893451 CTCTCTGAACAATGGGGTTAAGG - Intergenic
1064442288 10:15364532-15364554 TTCACAGTTCTTAGGGGTTAGGG + Intronic
1070335730 10:75453828-75453850 CTCACCCATCATAGGGGCCATGG + Intronic
1071584107 10:86802289-86802311 CTCACTGTACACAGGGCTTAAGG - Intronic
1071981986 10:91012728-91012750 CTGCCTAGTCATAGGGGTTAAGG + Intergenic
1078303670 11:10160374-10160396 CTCACTGAAAATAGAGATTAGGG - Intronic
1081315712 11:41626639-41626661 CTCCCTTAACATAGGGATTATGG + Intergenic
1084312542 11:68325318-68325340 CTCACGGATCACAGGGGTCAGGG - Intronic
1086079432 11:82888130-82888152 CTCACCCATCATAAGGGTCATGG - Intronic
1088914431 11:114216692-114216714 CTCAGTGAGAATAGGGGGTAAGG - Intronic
1090464727 11:126924020-126924042 GTGACTGGTCATAGGGGCTAAGG - Intronic
1091050342 11:132362776-132362798 CTCACCCATCATAGGGTTCATGG + Intergenic
1091230207 11:133983410-133983432 ATCAGTGATTGTAGGGGTTATGG - Intergenic
1092485494 12:8899168-8899190 CTCACCCATCATAAGGGTTGTGG + Intergenic
1093464628 12:19437390-19437412 CTCACCCATCATAAGGGTCATGG - Intronic
1094575150 12:31678218-31678240 CTCACCCATCATAAGGGTCAAGG - Intronic
1094743191 12:33313413-33313435 CTCACCCATCATAAGGGTCAGGG + Intergenic
1097327581 12:58296095-58296117 CTCACTCATCACAAGGGTCATGG - Intergenic
1098636894 12:72795509-72795531 CTCACTCATAAGTGGGGTTAGGG - Intergenic
1099465061 12:82974589-82974611 CTCAGTCATCATAAGGGTCATGG + Intronic
1101135931 12:101742954-101742976 CTCACTGATAAGTGGGGATATGG + Intronic
1106309607 13:28542850-28542872 CTTAGTGAACATGGGGGTTAAGG - Intergenic
1108151925 13:47545087-47545109 CACACAGATCATAGGAGTTCAGG + Intergenic
1112045229 13:95589960-95589982 CTTACTGATCATAAAGGTAATGG - Intronic
1120312517 14:82848496-82848518 CTCACTCATCGTAAGGGTCATGG + Intergenic
1124039482 15:26087434-26087456 CTCACTGATAATAGGACCTAAGG - Intergenic
1124353558 15:28978260-28978282 CTCACGGATCATGCGGCTTATGG - Intronic
1125152257 15:36546367-36546389 CTCACCCATCATAAGGGTCATGG + Intergenic
1125726802 15:41872270-41872292 CCCACTGATGAGAGGGGTTATGG + Intronic
1128643506 15:69358100-69358122 CCCAGTGATGATAGGGGTAAAGG + Intronic
1134350745 16:13435782-13435804 CTCCCTGAACATAGGGCTTGGGG + Intergenic
1138160711 16:54750791-54750813 CTCACAGATCATATGGTTTGAGG - Intergenic
1139315164 16:66061468-66061490 CTCACTGATCACAGGCATGAGGG - Intergenic
1141761847 16:86033711-86033733 CTGACTGATCAATGGGTTTAAGG + Intergenic
1144370302 17:14584065-14584087 CTCACCCATCATAAGGGTCAAGG + Intergenic
1144580315 17:16455335-16455357 CTCACTCATTATAAGGGTCATGG - Intronic
1145927819 17:28660721-28660743 CTGACTGATCAGATGGGTTTTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1153933195 18:9896976-9896998 CTAAGTGATCATGGGTGTTATGG + Intergenic
1155171773 18:23271982-23272004 CCCATTGATTATAGGGGATACGG - Intronic
1155690480 18:28615918-28615940 CTCCCTGAAGATAGGGCTTAAGG - Intergenic
1155740047 18:29278311-29278333 GTCACTGATCATGGAGGTTAGGG + Intergenic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1159886319 18:73911166-73911188 CTCACTTATCACAAGGGTTATGG + Intergenic
936586998 2:113766855-113766877 TTCACTGGTCACAGGGGTTGGGG - Intergenic
939781219 2:146450436-146450458 CTCATCGATCAAAAGGGTTATGG - Intergenic
940734744 2:157437781-157437803 ATCACTCATCATTGGGGTAATGG + Intronic
942370681 2:175280907-175280929 CTCACTTATCATAAGGCTCATGG + Intergenic
944082649 2:195805875-195805897 ATCAGTGATAATATGGGTTAGGG - Intronic
947361384 2:229348936-229348958 CTCAGAGACCATTGGGGTTAGGG + Intergenic
1170932279 20:20779903-20779925 CTCACTCATCACAAGGGTTGTGG - Intergenic
1177403784 21:20639857-20639879 CTAAGTGAACTTAGGGGTTAGGG + Intergenic
1178421573 21:32447599-32447621 ATCACTGATCCTGGGGATTAAGG + Intronic
1179171469 21:38976241-38976263 CTCACTGCTCATTAGGGTCAAGG - Intergenic
950917343 3:16659275-16659297 CTCACTGATCATAGGGGTTATGG + Intronic
950920210 3:16686416-16686438 CTCACCCATTATAAGGGTTATGG - Intergenic
951989487 3:28660693-28660715 CTCACTGATCAAAAGGGTTAAGG + Intergenic
953339567 3:42122170-42122192 CTCACTGGTCATATGCTTTAAGG + Intronic
957328191 3:78723985-78724007 CTCACTGACAATAATGGTTAAGG + Intronic
962398341 3:135036682-135036704 CTGACTGATCACAGAGGTTAAGG - Intronic
965961627 3:174436056-174436078 CTCATTCATCATAAAGGTTATGG - Intergenic
966087431 3:176085528-176085550 CTCACTGATCAGAGTGGTGGTGG + Intergenic
967438430 3:189478030-189478052 CTCACATCCCATAGGGGTTATGG + Intergenic
967927376 3:194662158-194662180 CTCACTGTTCAGATGGATTACGG - Intronic
971998021 4:33992412-33992434 CTCACCCATCATAGGTGTCACGG - Intergenic
973858163 4:55034073-55034095 CTCACTGATGTCAGGGGCTAAGG + Intergenic
974270617 4:59646705-59646727 TTCACTGAGAAGAGGGGTTATGG - Intergenic
976093847 4:81486927-81486949 CACACTGATATTAGGGATTATGG + Intronic
976678957 4:87733967-87733989 CTCACTGCTCATTGGGTTGACGG + Intergenic
977866901 4:102039619-102039641 CTTACTGATAAGAGGGGATAGGG - Intronic
981568477 4:146126385-146126407 CTCACTGGTCAGAGTTGTTATGG - Intergenic
983646931 4:170001097-170001119 CACACTGATCTTAGAGGTAAAGG + Intronic
984519360 4:180783817-180783839 CTCACCCATCATAAAGGTTATGG + Intergenic
986486047 5:8238416-8238438 CACACTGGTCATGGGGTTTAGGG - Intergenic
990184730 5:53200974-53200996 CTCACTGATCATCTGGTTTTAGG + Intergenic
994866580 5:105280098-105280120 CTCACTCAGCACAGGTGTTAAGG + Intergenic
995898055 5:117037436-117037458 CTCACTCATCATCAGGGCTATGG - Intergenic
998684450 5:144508061-144508083 CTCAGTCATCATAAGGGTCATGG + Intergenic
1006081496 6:31570168-31570190 CTGACCCATCATAAGGGTTATGG - Intergenic
1016505425 6:144773478-144773500 CTCACCCATCATAAGGGTCATGG + Intronic
1020720480 7:11738638-11738660 ATCACAGATCATAGGGATTGCGG - Intronic
1023232865 7:38052101-38052123 CTCACGGCTCATGGTGGTTAAGG + Intergenic
1026405103 7:70056872-70056894 CTTGCTGAGAATAGGGGTTAGGG + Intronic
1027869394 7:83687580-83687602 TTCACTCATCATAAGGGTCATGG + Intergenic
1028484258 7:91340967-91340989 TTCACAGATTCTAGGGGTTAAGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034266286 7:149782638-149782660 CACACTGATCATGAGGGTGAGGG + Intergenic
1038438539 8:27555657-27555679 CTCACCCATCATAAGGGTCACGG + Intergenic
1038464658 8:27750241-27750263 CTCACAGAGCTCAGGGGTTACGG + Intronic
1045291085 8:100833517-100833539 CTCACCCATCATAAGGGTCATGG - Intergenic
1046714177 8:117549191-117549213 CACACTGGTCATACAGGTTAAGG - Intergenic
1050811167 9:9749471-9749493 ATCACTGCTCTTAGGGTTTAGGG - Intronic
1053390289 9:37729988-37730010 CTCACTCAGCCTGGGGGTTATGG + Intronic
1057738866 9:97693540-97693562 CTCACTGATTAAAGTAGTTATGG + Intronic
1059468838 9:114488197-114488219 CTCCATGAGCATAGGCGTTATGG - Intronic
1060255346 9:122023876-122023898 TTTCCTGATCTTAGGGGTTATGG - Intronic
1060338702 9:122752725-122752747 CTCACTGATCATTTGGTTTGTGG + Intergenic
1187564927 X:20440001-20440023 GTCACTGAACATGGGGGTTTGGG - Intergenic
1192699765 X:73456202-73456224 CTCACTAATCAGAAGGGTAAGGG - Intergenic
1192875039 X:75220890-75220912 CTCACTGATAATAGTGAGTATGG - Intergenic
1197101632 X:122662954-122662976 CTCACTCATCATAAGGGTCATGG + Intergenic
1198138768 X:133781772-133781794 CTCACTGAACACAGGAGTTGAGG - Intronic
1200083460 X:153591165-153591187 CTCACTCATCATGGGGGATCAGG + Intronic
1201125901 Y:10913930-10913952 ATCACTGATCACAAGGGTGATGG - Intergenic