ID: 950917937

View in Genome Browser
Species Human (GRCh38)
Location 3:16664619-16664641
Sequence TGCCATCTTAAGCTAGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950917937_950917940 7 Left 950917937 3:16664619-16664641 CCTTTATCTAGCTTAAGATGGCA 0: 1
1: 0
2: 1
3: 7
4: 117
Right 950917940 3:16664649-16664671 CCAAATCCTAACCACCCCTTTGG 0: 1
1: 0
2: 2
3: 17
4: 106
950917937_950917941 8 Left 950917937 3:16664619-16664641 CCTTTATCTAGCTTAAGATGGCA 0: 1
1: 0
2: 1
3: 7
4: 117
Right 950917941 3:16664650-16664672 CAAATCCTAACCACCCCTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 95
950917937_950917946 22 Left 950917937 3:16664619-16664641 CCTTTATCTAGCTTAAGATGGCA 0: 1
1: 0
2: 1
3: 7
4: 117
Right 950917946 3:16664664-16664686 CCCTTTGGGTTACTTATCACTGG 0: 1
1: 2
2: 2
3: 13
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950917937 Original CRISPR TGCCATCTTAAGCTAGATAA AGG (reversed) Intronic
901290467 1:8120169-8120191 TGCCATCTTAACAGAGAAAAGGG - Intergenic
904488724 1:30844841-30844863 TGCAGTCTTTAGCCAGATAATGG - Intergenic
911272911 1:95825387-95825409 TGCCATCTTATGCTGGACAAAGG - Intergenic
912285984 1:108369940-108369962 TGCAATTTTAAAGTAGATAAAGG - Intergenic
913164877 1:116175874-116175896 TGCCATCTTCAGGTATATAATGG - Intergenic
913302393 1:117386149-117386171 TGGCAGCTTAAGCAACATAAAGG + Intronic
914427754 1:147594055-147594077 TGAGATCTTAAGGTAGATAGAGG + Intronic
917516669 1:175714254-175714276 TGCCATCTGAGGCCAGATATGGG - Intronic
1066247624 10:33598638-33598660 TGCCATCTTCAACTACATAAAGG - Intergenic
1069764117 10:70839784-70839806 TGCCATCTCTATCTAGATCAGGG + Intronic
1070367155 10:75748605-75748627 TACCATCTCGAGCTAGATGATGG - Intronic
1073587991 10:104729371-104729393 AGCAATCTTAAGCCAGATACAGG + Intronic
1073601829 10:104853402-104853424 TGCTAACTTAAGCAAGATATAGG + Intronic
1087878149 11:103383136-103383158 TGCCAAATTAAGCTGGATACTGG + Intronic
1094376212 12:29790192-29790214 TATCATCTTAGGCTAGACAAAGG - Intergenic
1096726501 12:53567555-53567577 TGCCATCTAAGGAAAGATAATGG - Intronic
1096928725 12:55179313-55179335 TGCCATCTTATTCTTGATACTGG + Intergenic
1098011835 12:66061576-66061598 TGCCATCTTATGCTGGATTGGGG - Intergenic
1098852138 12:75609465-75609487 TTCTATCTTAGGATAGATAATGG + Intergenic
1099177468 12:79438366-79438388 TGCCACCTAGAGCTAGATATTGG + Intronic
1100773539 12:97950079-97950101 TGCAATCTTAATCTTGAGAAGGG + Intergenic
1102942193 12:116953278-116953300 TGCCACCTCAAGCAAGATGAGGG - Intronic
1104510319 12:129371975-129371997 TGTCAACTTAAGTTAGCTAAGGG + Intronic
1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG + Intergenic
1112568623 13:100572942-100572964 TGACATCTTTTGCTATATAATGG + Intronic
1115806637 14:37059519-37059541 TGATATCTTAAGTTATATAAAGG + Intronic
1120530497 14:85625129-85625151 TGCCATCCTTAGATAGAGAAGGG + Exonic
1126925581 15:53582364-53582386 TGCTTTCTTAAGCTATATCATGG + Intronic
1129245302 15:74275597-74275619 TACCATCTTCAGCTGGCTAACGG + Intronic
1131993824 15:98115325-98115347 TGCCATCCTAGGCCAGATCATGG - Intergenic
1132245631 15:100294060-100294082 TGCCCTCTTAAGGTAGATGTGGG + Intronic
1136029035 16:27489509-27489531 TGACATCCTAAGCCAGACAAGGG + Intronic
1138629370 16:58281294-58281316 TGGCATCATTAGCTAGATATGGG + Exonic
1145020531 17:19427037-19427059 AGCCATCTTAAACTATATCAAGG + Intergenic
1146294741 17:31640776-31640798 TGTCATCCTAAGCTACAGAAAGG - Intergenic
1147246173 17:39122464-39122486 AGCCATCTTGAGCTACAAAATGG + Intronic
1147940537 17:44044173-44044195 TGACAAATTAAGCTAGAGAAGGG + Intronic
1149308007 17:55367902-55367924 TGCGATCTAAGGCTAGAGAAAGG - Intergenic
1149546526 17:57507993-57508015 AGCCAGCTGATGCTAGATAAAGG + Intronic
1150197571 17:63316760-63316782 TGCCATCTTAACCAATAGAAGGG + Intronic
1153943245 18:9995094-9995116 TGCCATCTGAAGCCAGAGACAGG + Intergenic
1155943914 18:31826537-31826559 TCCAGTCTTAAGGTAGATAAAGG - Intergenic
1156139080 18:34083444-34083466 TGCTTTCTTAAACTAGAGAAAGG - Intronic
1156681363 18:39592727-39592749 GACCATCTTGAGGTAGATAAGGG + Intergenic
1157021756 18:43791472-43791494 TCCAGTCTTAAGGTAGATAAGGG + Intergenic
1159557402 18:69959799-69959821 TGCCATATTTAGCAAGATTACGG - Intronic
1160573293 18:79832881-79832903 TGGCACCTTAAGGTAGATCACGG + Intergenic
1167684093 19:50944641-50944663 GGGCATCTGAAGCTGGATAATGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927483758 2:23474572-23474594 TGCCACCTTCAGCTTGAAAATGG + Intronic
928068674 2:28192829-28192851 TGCCATCTTAAGCTATAAAAAGG - Intronic
928752921 2:34491909-34491931 TGGCATATTAAGCTTGCTAATGG - Intergenic
930590092 2:53316699-53316721 TGCTGGCTTAAGCAAGATAAAGG - Intergenic
932784300 2:74586549-74586571 TGGCAATTAAAGCTAGATAAGGG - Intronic
934046680 2:88178485-88178507 TGCTATCTTATTTTAGATAATGG + Intronic
941003810 2:160226978-160227000 TTCCATCTAAAGCCAGAAAAAGG - Intronic
943943148 2:194024511-194024533 TGACATCTCAATATAGATAATGG + Intergenic
944050700 2:195465830-195465852 TTCAATCATAAGCAAGATAAAGG - Intergenic
1171299430 20:24047170-24047192 TTCCATCTTGAGATAGATGAAGG - Intergenic
1174651345 20:52128438-52128460 TGCTATGGTAGGCTAGATAATGG - Intronic
1174980216 20:55385660-55385682 TGTCATCTTAACCTAGCCAATGG + Intergenic
1177474130 21:21596477-21596499 TGTTTTCTTAATCTAGATAATGG + Intergenic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
949093847 3:62382-62404 TGCCATTTTAAGGGAGACAATGG - Intergenic
949713922 3:6906012-6906034 TGCTATCTTAAGCCAAATAAAGG - Intronic
950917937 3:16664619-16664641 TGCCATCTTAAGCTAGATAAAGG - Intronic
952339891 3:32436720-32436742 TGCCATCTTTAGCCAGACACAGG + Intronic
952527344 3:34224384-34224406 TGCCATGACAAGCTAGATATGGG - Intergenic
956561090 3:70575525-70575547 TGACATCTTTAGCCATATAAAGG - Intergenic
957129088 3:76200198-76200220 TGCAATCTTAGGCTAAACAAAGG + Intronic
957294566 3:78320826-78320848 TACCACCTTAGGCTAGACAAAGG - Intergenic
957856374 3:85884262-85884284 TGCCCTCTTTAGATAGAAAAAGG + Intronic
962991920 3:140585525-140585547 TGCTGTCTTAAACTAGCTAAAGG - Intergenic
964154439 3:153567247-153567269 TGCTATCCTAAGCTATTTAAAGG - Intergenic
964731215 3:159867266-159867288 TACCATCTTAAGCTAGGCATTGG + Intronic
965871019 3:173265386-173265408 TGCAGTCTTAAGGTAGATAGGGG + Intergenic
973683614 4:53346864-53346886 TTCCTTCTTAAGCTAGCTTAAGG - Intronic
975614632 4:76234350-76234372 TGCCATCTTTAGCTTCACAAAGG - Intronic
976346308 4:84005897-84005919 TACAATCTTATGTTAGATAAAGG - Intergenic
976579618 4:86720766-86720788 TGCCATTTTATTCTAGCTAAAGG - Intronic
976747064 4:88414038-88414060 TCCAGTCTTAAGGTAGATAAGGG + Intronic
978488278 4:109281388-109281410 TGCCATTTTAAGGAAAATAACGG - Intronic
979088612 4:116449129-116449151 TGCCATCTTCAGGCAGATAATGG + Intergenic
979566703 4:122162332-122162354 TTCCAGCTTAAGCCTGATAAAGG + Intronic
980570618 4:134612298-134612320 GGCTTTCTTAAGCAAGATAATGG - Intergenic
983038786 4:162899591-162899613 TACCATCTTAAGCTAAACCAAGG + Intergenic
986766163 5:10930105-10930127 TGTCATCTTCAGTTGGATAAAGG - Intergenic
988227309 5:28428832-28428854 TGCCATAATAACCGAGATAAAGG + Intergenic
993306032 5:86276702-86276724 TGCAATTTTAAAGTAGATAAAGG - Intergenic
998094711 5:139390692-139390714 TGGCATCTCCAGCTAGAAAATGG + Exonic
998325525 5:141276554-141276576 TGCCATCTTTAGGTATCTAATGG + Intergenic
1002560176 5:180076154-180076176 CTCCATCTTCATCTAGATAATGG - Intergenic
1002796628 6:476411-476433 TGCCAGATTAAGCTTGCTAATGG + Intergenic
1009646031 6:66403040-66403062 TGACATCTTGGGCCAGATAATGG + Intergenic
1011989290 6:93492710-93492732 TGCATTTTTAAGGTAGATAATGG + Intergenic
1012669012 6:102016726-102016748 TGGCCTCTTGAGCTAGATCAGGG - Intronic
1014362870 6:120502360-120502382 TTCTTTCTTAATCTAGATAATGG - Intergenic
1016487365 6:144556153-144556175 TTCCATCTTAGGCTAGCTGAAGG - Intronic
1016813756 6:148285008-148285030 TGTTATCTTAAGCCAAATAATGG - Intronic
1021197291 7:17687836-17687858 TACCATCTTAGGCTAAACAAAGG + Intergenic
1024917387 7:54516438-54516460 AGCAATCTTAAGCCAGATCAAGG - Intergenic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1027720257 7:81732140-81732162 TGCCATCTTTGGCTAGATATGGG + Intronic
1028898371 7:96067359-96067381 TGCCATCTTATGTTAGGAAAGGG - Intronic
1029054159 7:97722844-97722866 TGCCATCTTAAGCATTTTAAGGG - Intergenic
1030915490 7:115307048-115307070 TGCCATCTTATGTAATATAAGGG + Intergenic
1035846287 8:2868483-2868505 TGCCTTCTTAAACTAGATTTAGG - Intergenic
1037383153 8:18309826-18309848 TGCCATCAAAAGCTACACAAGGG + Intergenic
1040988745 8:53326349-53326371 TGCTTTCTTAAGCCAGACAAGGG + Intergenic
1045056427 8:98372137-98372159 TGCCATCAGAAGCTAGGCAAAGG + Intergenic
1046311970 8:112449171-112449193 TGCCTTCTAAAGCTAGTGAATGG - Intronic
1049926599 9:414890-414912 TGCCAACTAAAGGTAGGTAAAGG - Exonic
1050119430 9:2293252-2293274 TGCAATCTTAAGCTAGGCATTGG + Intergenic
1050319990 9:4442341-4442363 TTCTTTCTTAATCTAGATAAAGG + Intergenic
1050407314 9:5323180-5323202 TACTATCTTAAGCTAGAGTAAGG - Intergenic
1050414313 9:5399129-5399151 TACTATCTTAAGCTAGAGTAAGG - Intronic
1054983374 9:71233059-71233081 TGCCATATGTAGCTAGAAAAAGG + Intronic
1055447978 9:76402047-76402069 TGCCATCTCCAGCCAGATGAGGG + Intergenic
1057690622 9:97280911-97280933 TGCCATCTTAAGAGAGAAAAAGG + Intergenic
1058057343 9:100462494-100462516 TGCAATCTTCAACAAGATAATGG - Intronic
1058167736 9:101639245-101639267 TCACATCTTAAGGTAAATAATGG - Intronic
1059303971 9:113339663-113339685 TGCCATCTGAAGCGACAGAAAGG - Intronic
1060319365 9:122541621-122541643 TGGCAGCTTAATGTAGATAAAGG - Intergenic
1186613506 X:11162264-11162286 TGCCATCTTCAGCTGCAAAATGG - Intronic
1189225789 X:39412177-39412199 TGCCAGCTTAAGCTGAATAGGGG - Intergenic
1198627087 X:138588288-138588310 TGCAATCATAAGTTTGATAAGGG - Intergenic