ID: 950919110

View in Genome Browser
Species Human (GRCh38)
Location 3:16676305-16676327
Sequence AGTCAAGTTTGATTCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 115, 1: 183, 2: 150, 3: 142, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950919110_950919114 11 Left 950919110 3:16676305-16676327 CCTTTAAGGAATCAAACTTGACT 0: 115
1: 183
2: 150
3: 142
4: 232
Right 950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG No data
950919110_950919112 2 Left 950919110 3:16676305-16676327 CCTTTAAGGAATCAAACTTGACT 0: 115
1: 183
2: 150
3: 142
4: 232
Right 950919112 3:16676330-16676352 TGGAGCCAATAAAACCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950919110 Original CRISPR AGTCAAGTTTGATTCCTTAA AGG (reversed) Intergenic
900915899 1:5638371-5638393 AGTCAGGTCTGTTTCCTTAATGG - Intergenic
902971114 1:20051718-20051740 ACTCAAGTTTGATTCCTTAAAGG - Intronic
904709706 1:32420570-32420592 AGTCAAGATTGACTCCTTAAAGG - Intergenic
905013842 1:34763867-34763889 ACTCAAGTTTGCTTACCTAAAGG - Intronic
905059600 1:35128355-35128377 AGTCACGTTCAATTCCTTAAAGG + Intergenic
905428770 1:37906136-37906158 AGTCAAATTTGATTCTTTAAAGG - Intronic
905579309 1:39071557-39071579 AGTCAAGTTTTATTCCTTAAAGG + Intergenic
905934086 1:41810028-41810050 AGTCAAGTTTTATACCTGACTGG + Intronic
906232320 1:44174542-44174564 AGTCAAGTTTAATTCTTTAAAGG + Intergenic
906377934 1:45311777-45311799 AGTCAGGTTTGATTTCTCAAAGG - Intergenic
906563123 1:46774709-46774731 AGTCAAGTTTGATTCCTTAAAGG - Intronic
908635770 1:66162925-66162947 AGTCAACTTTTATTACTTGAAGG + Intronic
908702500 1:66917863-66917885 AGTCACGTTTGATTCCTTAAAGG - Intronic
909099999 1:71338010-71338032 TGTCAAATTTGATTCCTTAAAGG + Intergenic
910023891 1:82625971-82625993 AGTCAAATTTGATTCCTTAAAGG - Intergenic
910048106 1:82941998-82942020 AGTAAAGGTTATTTCCTTAAGGG - Intergenic
910386985 1:86694471-86694493 TGTCAAGCTTGATTCCTTAAAGG + Intergenic
910794897 1:91088538-91088560 AGTCAACTTTGATTCTTTAAAGG - Intergenic
911278826 1:95897463-95897485 AGTCAAGTTTGACTTATTAGAGG + Intergenic
911368213 1:96965946-96965968 AGTCAAGTTTGAAGCCCAAATGG + Intergenic
911576862 1:99588276-99588298 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
912111376 1:106346730-106346752 AGTCAAGATTGACTCCTTAAAGG + Intergenic
912407720 1:109454478-109454500 AGTCAAGCTTGATTCCCTAAAGG + Intergenic
912444592 1:109725408-109725430 AATCAAGTTTGATTCCTTAAAGG + Intronic
912461739 1:109838231-109838253 AGTCAACTTTGATTCTTTAAAGG - Intergenic
912981147 1:114374452-114374474 AGTCAAGTTTGATTCCTTACAGG - Intergenic
913030652 1:114899045-114899067 AGTCAAGTTTGACTGCTTAAAGG + Intronic
913502663 1:119485529-119485551 AGTCCAGTTTGATTCCTTGAAGG + Intergenic
915211992 1:154317083-154317105 AGTCAAGTTTGATTCCTTAATGG - Intergenic
915652752 1:157330566-157330588 AATCAAGTTTGATTCCTTAAGGG - Intergenic
915655749 1:157358963-157358985 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
915672528 1:157502455-157502477 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
916012818 1:160721842-160721864 AGTCAAATTTGATTCTTTAAAGG - Intergenic
916367008 1:164040852-164040874 ATTCAAGGATCATTCCTTAAAGG - Intergenic
916954415 1:169816796-169816818 AGTCAAGTTTGATTCCTTAAAGG + Intronic
917293840 1:173498530-173498552 AGTTCATTTTAATTCCTTAAAGG - Intergenic
917556856 1:176099699-176099721 AGTCGAGCTTGACTCCTTAAAGG - Intronic
918175196 1:182037368-182037390 AGTCGAGCTTGACTCTTTAAAGG + Intergenic
918589667 1:186226745-186226767 AGTCAAGTTTGATTTCTTAAAGG - Intergenic
919280579 1:195483851-195483873 AGTCGAATTTGACTCCTTAAAGG + Intergenic
919328687 1:196140813-196140835 TGTCAAGCTTGATTACTTAAAGG + Intergenic
920640384 1:207746456-207746478 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
921535842 1:216348301-216348323 AGTCAAGATTGATTCCTTAAAGG - Intronic
921680160 1:218021928-218021950 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
922004087 1:221511338-221511360 AGTGAAGGTTGAGCCCTTAAGGG + Intergenic
922550745 1:226492349-226492371 TGTCAAGCTTTGTTCCTTAAAGG + Intergenic
923412922 1:233727479-233727501 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
923601934 1:235411312-235411334 AGTCAAGTTTGATTCCATAAAGG + Intronic
923914125 1:238483341-238483363 AGTCAAGATTGACTCCGTAAAGG + Intergenic
924054101 1:240108083-240108105 AGTGAATTTTGATTCCTCCAGGG + Intronic
924483561 1:244458861-244458883 AGTGAACTTTGATTCTTTAAAGG - Intronic
924522819 1:244820172-244820194 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
924929533 1:248716622-248716644 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1063318271 10:5027957-5027979 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1063332159 10:5170722-5170744 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1063333119 10:5182312-5182334 AGTTAAGTTTGATTATTCAAAGG - Intergenic
1064175339 10:13070444-13070466 AGTCAAGCTTGACTCCTTAAAGG - Intronic
1064637453 10:17384098-17384120 AGTCAAGTTTGATTCTTTAAAGG - Intronic
1065151604 10:22827984-22828006 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1065384648 10:25122821-25122843 AGTCAAGTTTGATTGCTTAAAGG - Intergenic
1066083313 10:31953717-31953739 AATCCAGTGTGATTTCTTAAAGG + Intergenic
1067326817 10:45276447-45276469 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1068341969 10:55715992-55716014 ATTCAACTTTGAGTCCGTAAAGG - Intergenic
1068496899 10:57794499-57794521 CATCCAGCTTGATTCCTTAAAGG - Intergenic
1068808949 10:61233986-61234008 AGTCAAGTTTGATTCCATAAAGG - Intergenic
1068994581 10:63188073-63188095 AGTCTAAATTGATTCCTTAGAGG - Intronic
1069936029 10:71916820-71916842 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1070251238 10:74775090-74775112 AGTCAAGTTTGGTTCCTTAAAGG + Intergenic
1071012552 10:80954983-80955005 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1071357004 10:84807248-84807270 AGTCAACTTTGATTCTTTAAAGG + Intergenic
1071392123 10:85185850-85185872 AGTTAAGTTTAATTCCTTAAAGG + Intergenic
1071689526 10:87802225-87802247 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1071898448 10:90091271-90091293 AGTCAAGCTGTATTCCTTAAAGG - Intergenic
1071926323 10:90414288-90414310 AGTCGAGATTGACTCCTTAAAGG - Intergenic
1072973040 10:100033854-100033876 AGTCAACTTTGATTCCTTAAAGG - Intergenic
1073531377 10:104235348-104235370 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1073574457 10:104610888-104610910 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1073738427 10:106378662-106378684 AATCAAGTTTGATTCCTTAAAGG - Intergenic
1073903414 10:108249450-108249472 AGTCAAGCTTGATTACTTAAAGG - Intergenic
1075265187 10:120994971-120994993 AGTCAAGCTCAATTCCTTAAAGG - Intergenic
1077534619 11:3117186-3117208 AGTCAAGTTTGAGTCCTTAAAGG - Intronic
1077942079 11:6853801-6853823 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
1078051712 11:7970763-7970785 AGTCAACTTTGAATCCTTAAAGG + Intronic
1078893452 11:15578012-15578034 AGCTAAGTTAGAATCCTTAAAGG + Intergenic
1079235802 11:18689294-18689316 AGTCAATTTTGATTCCTGAAAGG - Intergenic
1079412755 11:20205391-20205413 AGTTAAGTTTGATTCCTTAAAGG - Intergenic
1079717599 11:23767861-23767883 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1079947847 11:26765921-26765943 AGTCAAATTTGATTCCTTACAGG - Intergenic
1080058279 11:27930050-27930072 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1080074741 11:28135558-28135580 AGCCATGCTTGATTCCTTAAAGG + Intronic
1082656156 11:55859631-55859653 AGTCGAGATTGACTCTTTAAAGG - Intergenic
1082737304 11:56871148-56871170 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1082942197 11:58718103-58718125 AGTCAAGTTTGATTTCTTAAAGG + Intronic
1082949251 11:58792799-58792821 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1082951966 11:58826988-58827010 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1083001340 11:59293907-59293929 TTTCAAATTTGATTCCTTAAAGG + Intergenic
1083239402 11:61375753-61375775 AGTCAAATTTGATTGCTTAAAGG - Intergenic
1083358845 11:62090926-62090948 ATTCAAGTTTGATTCCTTAATGG - Intergenic
1084875190 11:72126121-72126143 AGTCAAGCTTGATTCCCTAAAGG + Intronic
1084878084 11:72148772-72148794 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1085566928 11:77522386-77522408 AGTTGAGCTTGACTCCTTAAAGG + Intronic
1085573673 11:77583391-77583413 AGTCAAGTTTGATTCCCTAAAGG - Intronic
1085974785 11:81639498-81639520 AGTCAAGTTTGATTCCTCAAAGG - Intergenic
1086469224 11:87088260-87088282 AGTCAAGCTTAATTCCTTAAGGG + Intronic
1087047427 11:93853815-93853837 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1087049720 11:93873333-93873355 AGTCAGGTTTAATTTCTTAAAGG + Intergenic
1087432067 11:98067235-98067257 AGTGGAGATTGACTCCTTAAAGG + Intergenic
1087883781 11:103452048-103452070 AGTAAAATTTTATTCCATAATGG - Intronic
1087971810 11:104493549-104493571 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1088007902 11:104964605-104964627 AGTCAACTTCGATTCTTTAAGGG - Intronic
1088019829 11:105106143-105106165 AGTCAACTTTGATTCTTTAAAGG - Intergenic
1088156166 11:106806313-106806335 AGTCAAGTTAAAGTGCTTAAAGG + Intronic
1088807750 11:113367545-113367567 TGGCCAGCTTGATTCCTTAAAGG - Intronic
1089104085 11:115987588-115987610 AGTCAAGTTTCCTTCATCAAGGG - Intergenic
1089488601 11:118866802-118866824 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1090523775 11:127506850-127506872 AGTAAATTTTGATTCCTGTAGGG - Intergenic
1090728508 11:129549717-129549739 AGTCAATCTAGATTCCTTAAAGG - Intergenic
1092509605 12:9140853-9140875 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1092585917 12:9900796-9900818 AGTCGAGATTGACTCCTTAAAGG + Intronic
1092653428 12:10659451-10659473 AGTCAAGTTTGATTCCTCAAAGG - Intronic
1092686632 12:11056317-11056339 ATTCATTTTTGATTACTTAATGG + Intronic
1093101194 12:15031163-15031185 AGTCAACTTTGATTCTTCAAAGG + Intergenic
1093708412 12:22301671-22301693 AGCCAACTTCGATTCCTTAAAGG - Intronic
1093735703 12:22618005-22618027 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1094100362 12:26755758-26755780 AGTCAAGTTTGAGTCCTTAAAGG - Intronic
1094316519 12:29141377-29141399 AGTCAAACTTGATTCCTTAAAGG + Intergenic
1094431108 12:30370014-30370036 AGTCAACTTTGATTCTTTAAAGG + Intergenic
1094468180 12:30777048-30777070 CTTTAAGTTTGATTCCTTAAAGG - Intergenic
1094594315 12:31850687-31850709 AGTTAAATTTAATTCCTTAAAGG - Intergenic
1095266291 12:40162039-40162061 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1095268592 12:40188933-40188955 AATCAAGTTTCATTCCTTAAAGG + Intergenic
1095270471 12:40212955-40212977 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1095451248 12:42332674-42332696 CGTTAAATTTGATTCCTAAAAGG + Intronic
1095572582 12:43700031-43700053 AGACAAAATTGATTCCTTAAAGG - Intergenic
1095572992 12:43703827-43703849 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
1095602676 12:44031893-44031915 AGTCAAATTTGATTCCTTAAAGG - Intronic
1095799230 12:46254661-46254683 AGTCAGGTTTGATTCCTTAAAGG + Intronic
1095855490 12:46855714-46855736 AGTCAAATTTAATTGCTTAAAGG + Intergenic
1096874803 12:54619633-54619655 AGTGAAATTTGGTTCCTTAAAGG + Intergenic
1097133550 12:56832258-56832280 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1097253481 12:57654418-57654440 AAACAAGTTTTATTCCTTAAAGG - Intergenic
1097338744 12:58413934-58413956 AGTCAAGTTTGACTCCTTAAAGG + Intergenic
1097499995 12:60389794-60389816 AGTCAAGCTTGACTCCTTACAGG + Intergenic
1097844234 12:64350499-64350521 AGTCAAGCTTGACTCCTTAAAGG - Intronic
1098315737 12:69191706-69191728 AGTCAAGTTTGTTTCTTTAAAGG - Intergenic
1098436252 12:70471081-70471103 AGTCAAGCTTGACCCCTTAAAGG - Intergenic
1098666484 12:73170066-73170088 AGTCAAGTTTGGTTCCTTAAAGG - Intergenic
1098805728 12:75017938-75017960 AGTCAAGCTTGACTCCTTAAAGG + Intergenic
1099001410 12:77182087-77182109 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1099402244 12:82214715-82214737 AGTCAAACTTAATTCCTTAAAGG - Intergenic
1099535148 12:83833916-83833938 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1099611750 12:84881282-84881304 TATCAAGTTTGATTCTTGAAAGG + Intronic
1100167118 12:91928664-91928686 AGTCAAGCTTGATTCATAGATGG + Intergenic
1100333973 12:93612281-93612303 AGTCTAGGTTGATTCCTCCATGG + Intergenic
1101775737 12:107791343-107791365 AATCAAGCTTGACTTCTTAAAGG + Intergenic
1103661423 12:122522126-122522148 AGTCAGGTATGAATTCTTAAAGG - Exonic
1104030390 12:125061243-125061265 AGTCAAGTTTGATCCCTTAAAGG + Intergenic
1104348571 12:128025035-128025057 AGCCAAGTGTGATTCTTCAATGG - Intergenic
1104541352 12:129668841-129668863 AGTCAACTTTGATTCTTGAAGGG - Intronic
1104764711 12:131320071-131320093 AGTCAATTTTGATATCTTTAAGG + Intergenic
1105757718 13:23484435-23484457 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1105778484 13:23685043-23685065 AGTCAGGTTTGATTCCTTAAAGG - Intergenic
1107068362 13:36242414-36242436 ACTCAAATTTGAGTCTTTAAAGG - Intronic
1107311688 13:39085385-39085407 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1108203980 13:48070099-48070121 AGTCGAGCTTGACTCCTTAAAGG - Intronic
1108508094 13:51131364-51131386 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1108509611 13:51144583-51144605 AATCAAGTTTGATTCCTTAAAGG - Intergenic
1109293526 13:60502797-60502819 AGTTGAGATTGACTCCTTAAAGG + Intronic
1109388985 13:61668725-61668747 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1109422920 13:62137346-62137368 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1109617739 13:64858682-64858704 AGACATGTTTGACTCCTGAAGGG - Intergenic
1109784666 13:67157829-67157851 AGTTGAGTTTGAAACCTTAATGG + Intronic
1109865562 13:68259455-68259477 AGTCAAGATCGACTCTTTAAAGG - Intergenic
1110256891 13:73443048-73443070 AGTTCAGCTTGACTCCTTAAAGG - Intergenic
1110931819 13:81228480-81228502 AGTCAAGTCTTAGTCCTTTAAGG - Intergenic
1110952920 13:81517996-81518018 GGTGAAGCTTGATTCCTTAAAGG + Intergenic
1110990850 13:82040399-82040421 AGTCAAGATTGACTCCTTAAAGG + Intergenic
1111028757 13:82568983-82569005 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1111079100 13:83278817-83278839 AATCAAATTTGATTCCTTAAAGG - Intergenic
1111132755 13:83998310-83998332 AGTCCAGATTGATTCCTTAAAGG - Intergenic
1111147408 13:84202258-84202280 ACTAAAGTTTGATCCCTAAAAGG - Intergenic
1111149342 13:84228430-84228452 AGTCAATATTTATTACTTAAGGG + Intergenic
1111508197 13:89222996-89223018 AATCTAGTTTGATTCCATAGTGG - Intergenic
1112308174 13:98294093-98294115 AGTCATTTTTCATTCCTGAAAGG + Intronic
1112534608 13:100239700-100239722 AGTCAAAATTGATTCTTGAAAGG + Intronic
1112731064 13:102363032-102363054 AGTCAGTTTTTATGCCTTAATGG - Intronic
1113524282 13:110962322-110962344 AATTAAGCTTGATTCCTTAAAGG - Intergenic
1113845679 13:113389442-113389464 AGTCACGTTTAATTTCTTAAAGG - Intergenic
1113898332 13:113780242-113780264 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1114053113 14:18940311-18940333 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1114109445 14:19461615-19461637 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1114256658 14:21008748-21008770 AGTCAGGTTTGATTCCTTAAAGG - Intergenic
1114504716 14:23200783-23200805 AGTCAAGTTTGATTCCTTATAGG + Intronic
1114565187 14:23626459-23626481 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1114789959 14:25646513-25646535 AGTCAAGTTTTATTCCTTAAAGG + Intergenic
1116329843 14:43581990-43582012 AGTCAAGTTTGATTCCTTATAGG - Intergenic
1116390203 14:44382074-44382096 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1117187522 14:53255750-53255772 AGTCAAGTCTGATTCCTTAAAGG + Intergenic
1117263070 14:54056794-54056816 ATTCAAGTTTCCTTTCTTAATGG + Intergenic
1117817890 14:59617146-59617168 AGTCAACTTTGATTCTTTAAAGG - Intronic
1118118529 14:62809361-62809383 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1118510761 14:66470621-66470643 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118535554 14:66759355-66759377 AGTCAAACTTGACTCCTTAAAGG + Intronic
1118550225 14:66941631-66941653 AGTCAAGCTTGACTCCTGAAAGG + Intronic
1118870981 14:69741350-69741372 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1118938751 14:70313126-70313148 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118961987 14:70542366-70542388 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118999312 14:70866855-70866877 AGTTGAGCTTGATTCCTTAAAGG + Intergenic
1119822709 14:77631784-77631806 AGTCAATTTTGATTCCTTAAAGG + Intergenic
1120912981 14:89684492-89684514 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1121003983 14:90475718-90475740 AGTCAACTTTGATTCCCTAAAGG - Intergenic
1121462326 14:94090722-94090744 AGTCAAGTTTGATTCCTTAAGGG + Intronic
1122174014 14:99902914-99902936 AATTCAATTTGATTCCTTAAAGG + Intronic
1122186521 14:100001822-100001844 AGTTAAGTTTGATTCCTTAAAGG + Intronic
1122433708 14:101677078-101677100 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1122591775 14:102857728-102857750 AGTCAAGTTTGAGTCCTTAAAGG + Intronic
1123766072 15:23479644-23479666 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1124118682 15:26869721-26869743 AGGCAACTTTGATTGCATAATGG - Intronic
1124175532 15:27420635-27420657 CGTCAAGTTTTACACCTTAAAGG + Intronic
1124876027 15:33594196-33594218 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1126624039 15:50668917-50668939 AGTCAAGTTTGATTCCTTTAAGG - Intronic
1126707916 15:51423542-51423564 AGTCAAGTTTGATTCCTTCAAGG + Intergenic
1126946302 15:53824266-53824288 GGTCAAGTTTAATTTCTTAAAGG + Intergenic
1128149246 15:65352427-65352449 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1128289479 15:66466150-66466172 AATCAAGTTGGATTCCTTAAAGG + Intronic
1128351076 15:66889295-66889317 AGTCAACTTTGATTCTTTAAAGG + Intergenic
1129378259 15:75148652-75148674 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1130237711 15:82152248-82152270 AGTCAACTTGGATTCCTTCAGGG + Exonic
1131695971 15:94877811-94877833 AGTCAAGCTTGATTTCTTAAAGG + Intergenic
1131914400 15:97248366-97248388 AGTCAACTTTGATTCTTTAAAGG + Intergenic
1134997646 16:18752229-18752251 AGTCACATTTGATTCCCTCAAGG + Intergenic
1135036382 16:19081361-19081383 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1135077370 16:19405055-19405077 AGTCGAGATTGACTCCTTAAAGG + Intergenic
1136352051 16:29716985-29717007 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
1137453094 16:48595725-48595747 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1138248738 16:55486147-55486169 AGTCAAGATTGATACTTCAAGGG + Intronic
1138262326 16:55633807-55633829 AGTCAAATTTGATTCCTTAATGG - Intergenic
1140015704 16:71181591-71181613 AGTTAAGACTGATTGCTTAATGG - Intronic
1140419872 16:74810264-74810286 AGACAACTTTGATTCCTTAAAGG - Intergenic
1140459504 16:75128083-75128105 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
1140536019 16:75710747-75710769 AGTCAAGCTTGATTCCTTAAAGG - Intronic
1143534326 17:7527067-7527089 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1144073036 17:11691758-11691780 AGTAAATTATGATTCCTCAATGG - Intronic
1144228147 17:13172262-13172284 AGTCAAGTTTAACTCCTTAAAGG - Intergenic
1144555348 17:16277195-16277217 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1144776273 17:17786455-17786477 AGTCAAGTTTGATTACAACAAGG + Intronic
1145114317 17:20194403-20194425 AATCAAGTTTAATTCCTTAAAGG + Intronic
1145226649 17:21134562-21134584 TGTCACGTTTGATTCCTTAAAGG + Intronic
1146441507 17:32899511-32899533 AGTCAAGTGTGATTCTTTAAAGG + Intergenic
1147515448 17:41113650-41113672 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1148613180 17:48978773-48978795 AGTCAAGTTTTATTCCTTAAAGG - Intergenic
1148632683 17:49123856-49123878 AGTCAGGTTTGATTCCTTAAAGG + Intergenic
1149034526 17:52119366-52119388 AGTCAAGCTTGATTCCTTAACGG - Intronic
1149094653 17:52825871-52825893 AGTCAAGCTTGACTCCTTAAAGG + Intergenic
1149106507 17:52973679-52973701 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1149173320 17:53839913-53839935 AGTCACGTTTGATTCCTTAAAGG + Intergenic
1149477041 17:56971336-56971358 AGTCAAGTTTGATTTCTTAAAGG - Intergenic
1149483865 17:57025763-57025785 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1150356537 17:64490894-64490916 AGTAAAGTTTGTTTCCTTTCCGG + Exonic
1153349433 18:4062312-4062334 AGTCAAATTTGATTGCTTAAAGG - Intronic
1153365966 18:4256515-4256537 ACTCAACTTAGATTCCTTAGGGG + Intronic
1153745877 18:8179081-8179103 AGTCAGATTTGATTCCTTAAAGG + Intronic
1155612715 18:27684822-27684844 AGTCAAGTTTCCTACCTTTATGG - Intergenic
1155784722 18:29881808-29881830 AGTCAAGATTGACTCCTTAAAGG + Intergenic
1155850869 18:30772608-30772630 AATCAAATTTGATTCATTAAAGG - Intergenic
1156781952 18:40860960-40860982 ATTCAAGTTTGCTTCTTCAATGG + Intergenic
1156971759 18:43165553-43165575 AGTCAAGATTGACTCCTTAAAGG - Intergenic
1156972070 18:43169035-43169057 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1157661731 18:49451361-49451383 AGTGGAGGTTGACTCCTTAAAGG - Intronic
1157912835 18:51635326-51635348 AGTAAAGTTTGATTCCTTAAAGG - Intergenic
1158016183 18:52786839-52786861 AGTCGAGATTGACTCCTTAAAGG + Intronic
1158152056 18:54384333-54384355 AGTCAAGATTGACTTCTTAAAGG + Intronic
1158641135 18:59205076-59205098 AGCCAAGACTGACTCCTTAAAGG - Intergenic
1158767312 18:60469255-60469277 AGTTCAGTTTGATTCATTAATGG + Intergenic
1158864290 18:61623025-61623047 AGGCAAGTTTGATTCCTTAAAGG - Intergenic
1159309710 18:66691354-66691376 AGTCGAGACTGATTCCTGAAAGG - Intergenic
1159431723 18:68361492-68361514 AGTGAAGCTTGGTTCCTGAAAGG - Intergenic
1159784245 18:72695241-72695263 AGTCTAGATTGACTCCTTAAAGG - Intergenic
1160607395 18:80062002-80062024 AGTCAAGTTGGATTCCTTAAAGG + Intronic
1162667484 19:12226448-12226470 AGTCAAATTTGATTCCTTAAAGG + Intronic
1164106529 19:22111317-22111339 AGTTGAGCCTGATTCCTTAAAGG + Intergenic
1164137986 19:22431277-22431299 AGCCAACTATGATACCTTAAAGG + Intronic
1164211799 19:23104730-23104752 AGTCAAGCTTGACTCTTTAAAGG - Intronic
1164470574 19:28527636-28527658 AGTTAAGTTTAATTTCTTAAGGG - Intergenic
1166249113 19:41553779-41553801 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1166418915 19:42619146-42619168 AGTCAAGTTTGATTACTTAAAGG - Intronic
1166900757 19:46060032-46060054 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1167844588 19:52151245-52151267 AATCAAGTTTGATTCCTTAAAGG - Intergenic
924972761 2:144234-144256 AGTTAAGTTTGATTCCTAAAAGG + Intergenic
925471797 2:4170288-4170310 CATCAAGCTTGATTCCTTAAAGG + Intergenic
925594348 2:5540187-5540209 AGTCCAGTTTGATTTTTTAAAGG + Intergenic
926114128 2:10200760-10200782 AGTCAAGTTTGATTCCTTAAAGG + Intronic
926509174 2:13752041-13752063 AGCCAAGTTTGATTCCTTAAAGG - Intergenic
926927319 2:18000881-18000903 GGTCAAGCTTGATTCCTTAAAGG - Intronic
928672500 2:33616805-33616827 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
928677644 2:33665401-33665423 AGTAAAGCTTGGTTCCTTAAAGG - Intergenic
930150315 2:48052577-48052599 AGTCAAATTTGAGTTCTTAAAGG + Intergenic
930495021 2:52130541-52130563 AGTCAAGTTTGATTCTTTAAAGG - Intergenic
930506575 2:52288908-52288930 AGTCAGGTTTGATTCCTAAAAGG + Intergenic
930983952 2:57562069-57562091 AGTCAAGTTTGAGTACTATAGGG - Intergenic
931485749 2:62689818-62689840 AGTGACGTTTTAGTCCTTAATGG + Intronic
932196839 2:69791293-69791315 AGTTAAGCTTGATTCCTTAAAGG + Intronic
933131137 2:78675052-78675074 AGTCAAGATTAACTCCTTAAAGG + Intergenic
933444799 2:82366027-82366049 ATGTAAGTTTGATTCCTTAAAGG + Intergenic
933614145 2:84466255-84466277 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
933887414 2:86731726-86731748 AGTTAGGTTTGTTTCCTAAATGG + Intronic
933922761 2:87064987-87065009 AGTTAGGTTTGTTTCCTAAATGG - Intergenic
934104636 2:88684572-88684594 AGTCAAATTTGATTCCCTGAAGG - Intergenic
935024825 2:99266811-99266833 AGTCAAGTTTGATTCCTTAAAGG - Intronic
935153255 2:100459143-100459165 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
935885978 2:107620037-107620059 AGCCAAGTTTGATTCCTTAAAGG - Intergenic
935941208 2:108241185-108241207 TGTCACGCTTGATTCCTCAAAGG + Intergenic
937579902 2:123472631-123472653 AATCAAGTTTGATTCCTTAAAGG - Intergenic
937712361 2:124992928-124992950 AGTCAAATTTAATTCCTTAAAGG - Intergenic
938471101 2:131562858-131562880 AGTCAGTTTTGATTCCTTAAAGG - Intergenic
939339529 2:140876499-140876521 AGTCAAGTCTGATTCCTTAGAGG - Intronic
939538893 2:143468273-143468295 AGTCAACTTTTTTTCCTTTAGGG + Intronic
939843628 2:147218093-147218115 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
940987969 2:160067413-160067435 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
941199867 2:162495212-162495234 GGTCATGCTTGATTCCTTAAAGG - Intronic
941853723 2:170209096-170209118 AGTCGAGCTTGACTCCTTAAAGG + Intronic
941960628 2:171249972-171249994 AGTCATATTTGAATCCTTAAAGG - Intergenic
942097271 2:172545885-172545907 AGTCAAGCTTGATTCCCTAGAGG - Intergenic
942171387 2:173292784-173292806 CGCCAAGCTTGATTCCTCAAAGG + Intergenic
942194203 2:173501382-173501404 AGTCAAATTTGATCCTTTAAAGG - Intergenic
942240254 2:173956732-173956754 AGTAGAGTTTGATAGCTTAATGG - Intronic
942785984 2:179703324-179703346 GGGCAAGTCTGTTTCCTTAAGGG - Intronic
942839178 2:180339156-180339178 AGGCTAGATTGACTCCTTAAAGG - Intergenic
943419888 2:187657227-187657249 AGTCAAGATTGACTCTTTAAAGG - Intergenic
943466805 2:188238711-188238733 AGTGAAGTCTGATTCCTTAAAGG - Intergenic
943666151 2:190610535-190610557 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
943779955 2:191812590-191812612 GATCAAGAATGATTCCTTAAAGG + Intergenic
943985153 2:194609342-194609364 AGTCAAGCTTTATTCTTTAAAGG - Intergenic
944110447 2:196125848-196125870 AGTCAAGCCTGACTTCTTAAAGG + Intergenic
944519832 2:200553969-200553991 AGTCTAATTTGATTGCTTAAAGG + Intronic
944820833 2:203429292-203429314 AGTCTAGTTTGGGTCCATAATGG - Exonic
945370053 2:209005492-209005514 AGTCAAGCTGGATTCCATAAAGG - Intergenic
945869556 2:215212341-215212363 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
946297413 2:218796160-218796182 AGTCGAGCTTGACTCCTTAAAGG + Intronic
946701121 2:222415207-222415229 AGTCAAGTTTGACTCCTCAAAGG - Intergenic
946979182 2:225188273-225188295 CTTAAAGTTTGATTCCCTAAGGG + Intergenic
947023043 2:225704938-225704960 ACTCAAATTTGATTCCATATTGG - Intergenic
947287829 2:228537302-228537324 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
948574651 2:238941904-238941926 AGTAAAGTTTGTATTCTTAACGG - Intergenic
949029111 2:241780942-241780964 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1168821967 20:780089-780111 AATCAAGTTTGATTCCTTAAAGG + Intergenic
1168825306 20:808859-808881 AGTCAACTTTGATTCCTTAAAGG - Intergenic
1169429029 20:5520050-5520072 AGTCAACTTTGATTCCTTAAAGG - Intergenic
1170825880 20:19794920-19794942 AGACAATTTAGAATCCTTAAAGG + Intergenic
1171441254 20:25165007-25165029 AGTCAATTTTGATTCTTAAAAGG + Intergenic
1171506296 20:25637162-25637184 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1172998406 20:39088236-39088258 AGTCTAGGGTGATTCCTTTATGG + Intergenic
1176054425 20:63136331-63136353 GGGCAAGTTTGGTTCCTTAGTGG + Intergenic
1176693438 21:9945332-9945354 AGTCCAGCTTAATTACTTAAAGG + Intergenic
1176902110 21:14454776-14454798 AGTCAAGAATGATTACCTAAAGG + Intergenic
1177549844 21:22606346-22606368 AGTCAGGTTTGATTCCTTAAAGG + Intergenic
1177567647 21:22845151-22845173 AGTAGAGCTTGACTCCTTAAAGG + Intergenic
1177707075 21:24720268-24720290 AGTCAATTCAGATTCATTAATGG - Intergenic
1178201973 21:30417695-30417717 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1178466729 21:32855102-32855124 AGTCAAGCTTGATTCCCTAAAGG + Intergenic
1178619753 21:34163250-34163272 AATCGAGATTGACTCCTTAAAGG + Intergenic
1178836573 21:36103497-36103519 TGTCAAGCTTCATTCCTTAAAGG - Intergenic
1178879574 21:36438104-36438126 AGTCAAGTGTGCATCATTAAGGG - Intergenic
1179543085 21:42096650-42096672 CGTCAAGTTTGATATCTGAATGG + Intronic
1179956608 21:44743917-44743939 AATCGAGCTTGACTCCTTAAAGG - Intergenic
1180471586 22:15662686-15662708 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1181446596 22:22981024-22981046 GGTCAAGATTGACTCCTTAAAGG - Intergenic
1181837370 22:25621937-25621959 TGTTAAGCTTGATTCCTTAAAGG + Intronic
1182227472 22:28810247-28810269 ACTCAACTTTGATTCCATCAAGG - Intergenic
1183113631 22:35672439-35672461 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1185405905 22:50650572-50650594 AGTCGAGTTGGATTCCTTAAAGG - Intergenic
949751942 3:7362521-7362543 AGTTAAGTATGATTCCTACATGG + Intronic
950511630 3:13432190-13432212 AGTCAACTTTGATTCTTTAAAGG - Intergenic
950600003 3:14025720-14025742 AGTCAAGTTTGATTCCTTAAAGG + Intronic
950919110 3:16676305-16676327 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
951542812 3:23798374-23798396 AGTCAACTTTGGTTCCCTCAAGG + Intergenic
951821970 3:26824103-26824125 AGTCAAATTTGATTTCTTAAAGG - Intergenic
952193170 3:31045465-31045487 AGTTGAGATTGACTCCTTAAAGG - Intergenic
952295181 3:32055706-32055728 AGTCAGGTTTGATTCCTTAAAGG - Intronic
952454383 3:33458797-33458819 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
953153848 3:40350890-40350912 AGTCAAGTTTGATCCCTTAAAGG - Intergenic
953416365 3:42721781-42721803 AGTCAAATTTGATTCCTTAAAGG - Intronic
953441268 3:42919648-42919670 AGTCAAGCTTGATTCCTAAAAGG + Intronic
953613373 3:44467381-44467403 AGTCAACTTTGATTCTTTAAAGG - Intronic
954484412 3:50833710-50833732 CGTCAAGTTTGATTCCTTAAAGG + Intronic
954597968 3:51843115-51843137 AATCAAGCTTAACTCCTTAAAGG + Intergenic
954651331 3:52165322-52165344 AGTCAACTTTGATTCCTTAAAGG - Intergenic
955007105 3:54979291-54979313 AGTCAAGTTTGATTCCTTAAAGG + Intronic
955613117 3:60778808-60778830 AGTTGAGCTTGACTCCTTAAAGG - Intronic
956994441 3:74808148-74808170 AGTCCAGTTTGTTTCCATCATGG - Intergenic
957383302 3:79462678-79462700 AGTTATGTCTGATTCCCTAATGG - Intronic
957502008 3:81069384-81069406 AGTTAAATTTAATTCCTTAAAGG - Intergenic
957539476 3:81549451-81549473 AGTCAAGCTCAATTCCTTAAAGG - Intronic
957726037 3:84068450-84068472 AGTAAACTTTGATTCTTTAAAGG + Intergenic
957737553 3:84222419-84222441 AGTCACATTTGATTCTTTAAAGG + Intergenic
957952434 3:87143835-87143857 AGTCAAGCTTTACTCCTTAAAGG - Intergenic
958523112 3:95217066-95217088 AGTCAATTTTGATTCCTTAAAGG - Intergenic
958536442 3:95410615-95410637 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
958592322 3:96174079-96174101 AGTCAAATTTGATTCCTTAAAGG - Intergenic
958953690 3:100443688-100443710 AGTCAACTTTGATTCCTTAAAGG + Intronic
958968271 3:100582800-100582822 AGTCAGATTTGATTCCTTAAAGG + Intergenic
959431443 3:106259628-106259650 AGTCGGGATTGACTCCTTAAAGG - Intergenic
959872773 3:111347467-111347489 AGTCAAGTGTAATGCATTAAAGG + Intronic
959970356 3:112402039-112402061 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
960159951 3:114339538-114339560 AATAAAATTTGATTGCTTAATGG + Intronic
960165196 3:114393580-114393602 TGTCATGTTTTATTGCTTAAAGG + Intronic
960386950 3:117032389-117032411 AGTCAAGTTTAATTCCTTAAAGG - Intronic
960514946 3:118593395-118593417 GGTCAGGTTTGATTCCTTACAGG - Intergenic
960709143 3:120510194-120510216 AGTCAAATTTGATTCCTTAAAGG - Intergenic
961334936 3:126169468-126169490 TCTTAAGTTTGATTCCTTAGAGG - Intronic
961510557 3:127399466-127399488 AGTCAAGTTTAATTCCTTAAAGG + Intergenic
962404898 3:135092390-135092412 AGCCAAGATGGACTCCTTAAAGG - Intronic
963174810 3:142287094-142287116 TGTCAAGCTCGATTCCTTAAAGG - Intergenic
963251544 3:143108737-143108759 AGTCAAGCTTGATTTTTTTAAGG - Intergenic
964022929 3:152036002-152036024 AGTCAAGTTTGATTCCTCAAAGG + Intergenic
964651293 3:159014610-159014632 AGTAAATTTTAAATCCTTAAAGG + Intronic
964859184 3:161181654-161181676 AAGTCAGTTTGATTCCTTAAAGG + Intronic
964980133 3:162668411-162668433 ATTCAAGATTGACTCCTTAAAGG - Intergenic
965114324 3:164468529-164468551 AGTTAAGTCTGATCCTTTAAAGG - Intergenic
966523475 3:180897579-180897601 AGTTGAGATTGACTCCTTAAAGG - Intronic
966688084 3:182717444-182717466 AGTCAAGCCTGACTCCTTAAAGG + Intergenic
966721483 3:183067107-183067129 AGTCAAGTTTGATTCCTTAAAGG - Intronic
966934998 3:184700774-184700796 AGTCAACTTTGATTCTTTAAAGG + Intergenic
967244819 3:187475976-187475998 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
967531301 3:190551242-190551264 AGTTGAGCTTGACTCCTTAAAGG + Intronic
967542419 3:190683162-190683184 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
968043624 3:195610615-195610637 AAACAAGTTTAATTCCTTAAAGG - Intergenic
968294651 3:197566268-197566290 AGTCAATTTTGAATCCTTAAAGG - Intronic
968301073 3:197615411-197615433 AAACAAGTTTAATTCCTTAAAGG + Intergenic
968381236 4:98583-98605 AGTCAAGCTTAACTCCTTAAAGG - Intergenic
968931599 4:3582271-3582293 AGTCAAATTAGATACCTTCAGGG + Intronic
969727720 4:8933343-8933365 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
970711884 4:18873343-18873365 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
970853400 4:20628133-20628155 AGTCAAGTTTCATTCCTTAAAGG + Intergenic
971006578 4:22381181-22381203 AGTCAGGTTTGATTCCTTAAAGG - Intronic
971110010 4:23574213-23574235 AGGCAAGCTTGAGTCCTTAAAGG + Intergenic
971693096 4:29863661-29863683 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
971813995 4:31463396-31463418 AGTCAACTTTGATTCTTTAAAGG + Intergenic
971886402 4:32455295-32455317 AGTCAAGTTTGATTTCTTAAAGG - Intergenic
971913301 4:32824654-32824676 AGTCAAGTTTTATTACTTAAAGG + Intergenic
971955639 4:33414908-33414930 AGTCAAGTTTGGTTCCTTAAAGG - Intergenic
971969023 4:33598195-33598217 AATCAAGCTTGATTCCTTAAAGG - Intergenic
972024388 4:34358994-34359016 AGTCAACTTTGATTCCTTAAAGG + Intergenic
972216130 4:36899008-36899030 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
972254964 4:37343757-37343779 AGTCAAATTTGAATTCATAATGG - Intronic
972853461 4:43077210-43077232 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
972986941 4:44776624-44776646 AGTCAAATATGATTCCTTAAAGG - Intergenic
974203887 4:58674537-58674559 AGTCAACCTTGATTCCTTAAAGG - Intergenic
974295703 4:59995899-59995921 AATCAAGTTTGATTCTGTAAAGG + Intergenic
974665508 4:64956245-64956267 AGTCGAGATTGACTCCTTAAAGG - Intergenic
974673704 4:65063625-65063647 ACTCAAGTTTCATTCCCAAATGG - Intergenic
974922865 4:68264009-68264031 AGTTAAATTTGATTCTTTAAAGG - Intergenic
974948446 4:68557796-68557818 AGTTAAGTTTGATTCCCTAAAGG - Intronic
974957470 4:68660196-68660218 AGTTAAGTTTGATTCCCTAAAGG - Intronic
975043369 4:69772204-69772226 ACTCAAGTTTGATTCCTTAAAGG - Intronic
975205097 4:71636736-71636758 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
975411986 4:74063993-74064015 AATAAACTTTGATTCCTTAAAGG - Intergenic
975528215 4:75374211-75374233 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
975614391 4:76231903-76231925 AGTCAAGATTGACTCCTTAAAGG + Intronic
975730335 4:77331631-77331653 TGTCAAGCTTGATTCCTTAAAGG + Intronic
975774856 4:77775009-77775031 AGGCAATTTTGTTTCCTCAAAGG + Intronic
976643858 4:87367225-87367247 AGTCAAGTTTGATTCTTTAAAGG - Intronic
977316748 4:95459422-95459444 AGTCTAGTCTGATACCTTAATGG - Intronic
977354784 4:95932039-95932061 AGTCAAGTTTGATGCCTAAGAGG - Intergenic
977500123 4:97827765-97827787 AGTCAAGTTTGATTCCGTAAAGG - Intronic
977590102 4:98816875-98816897 AGTTGAGTTTGATTCCTTAAAGG - Intergenic
977592875 4:98845946-98845968 AGTCAAATTTGATTCCTTAAAGG + Intergenic
977673980 4:99727654-99727676 AGTCAAGTTAAATTCCCTAAAGG + Intergenic
977720345 4:100232361-100232383 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
977752196 4:100622572-100622594 TGTCCAACTTGATTCCTTAAAGG + Intronic
978032482 4:103952328-103952350 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
978328786 4:107588518-107588540 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
978357005 4:107886747-107886769 AGTCAAGTTTGATTCTTTAAAGG + Intronic
978719579 4:111892079-111892101 AGTCAAGTTTGTGTCATTATTGG - Intergenic
979015215 4:115423895-115423917 AGTTAAGCTTGATTCCTTAAAGG - Intergenic
979024091 4:115545526-115545548 AGTCAAGTTTGAGTCCTTAAAGG + Intergenic
979061263 4:116064476-116064498 ACACATGTTTCATTCCTTAAAGG + Intergenic
979104502 4:116667218-116667240 AGTCAAGCTCAATTCCTTAAAGG - Intergenic
979745024 4:124202136-124202158 AGATAAGTTTGATTACTTACTGG - Intergenic
979773741 4:124561778-124561800 AGTCAAATTTGATTCCTTAAAGG - Intergenic
980071569 4:128247898-128247920 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
980269746 4:130568670-130568692 AGTCAAGATTGATACCATAAAGG + Intergenic
980366056 4:131805568-131805590 AGTCCAGCTTAATTACTTAAAGG + Intergenic
980642779 4:135601418-135601440 AGTCAAGATTGATTCCTTAAAGG - Intergenic
980722745 4:136719301-136719323 AGTCAAACTTGACTCCTTAAAGG - Intergenic
980987821 4:139712794-139712816 AGTCAAGTTTGATTCCTTAAAGG + Intronic
981292733 4:143095477-143095499 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
981324468 4:143429685-143429707 AGTAGAGCTTGACTCCTTAAAGG + Intronic
981770463 4:148302605-148302627 AGTTGAGCTTGATTCCTTAAAGG - Intronic
982475804 4:155849125-155849147 AGCCAAGTTTGATTCCTTAAAGG - Intronic
982602893 4:157474111-157474133 AGTCAAGACTGATTCTTTAAAGG - Intergenic
982606677 4:157524592-157524614 AGTCAAGCTTGATTCCCTAAAGG + Intergenic
982864406 4:160492240-160492262 AGTCAGGCTTCATTACTTAAAGG - Intergenic
983011989 4:162558594-162558616 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
983128902 4:163989537-163989559 AGTAAAGTCTGTTTCCTTTATGG - Intronic
983262477 4:165471831-165471853 AGTCAAATTTGATTCCTTAAAGG + Intronic
983773653 4:171579459-171579481 AGTCAAGCTTGATTTCTTAAAGG + Intergenic
984031663 4:174612141-174612163 AGTCCAGTTTGATTCCTTAAAGG - Intergenic
984170490 4:176352615-176352637 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
984400578 4:179258504-179258526 AGTCAAGCTTGATTCCTTACAGG + Intergenic
984441532 4:179777094-179777116 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
984650673 4:182267429-182267451 AATTAAGTTTAATTCCTTAAAGG - Intronic
984985577 4:185325904-185325926 AGTCAAGTTTGATTCCTTAAAGG + Intronic
985226972 4:187771768-187771790 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
986213574 5:5697407-5697429 AGTCGAGCTTGACTCCTTTAAGG - Intergenic
987007668 5:13726840-13726862 AGCCCAGGTTGACTCCTTAAGGG - Intronic
987165956 5:15198120-15198142 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
987678502 5:21106344-21106366 AGTCAAGTTTGATTCCTTAAGGG + Intergenic
988361152 5:30238445-30238467 AGTCTAGCTTGATACCTTGAAGG - Intergenic
988769716 5:34420284-34420306 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
988773874 5:34457996-34458018 AGTCAATTTCAATTCCTTAAAGG + Intergenic
989316901 5:40091779-40091801 TGTCAAGTTTGAATCCTTAAAGG - Intergenic
989715372 5:44456052-44456074 AGTCAAGCTTGACTACTTAAAGG + Intergenic
989742225 5:44786673-44786695 TGTCAAGTTTAATTCCTTAAAGG + Intergenic
990070650 5:51778387-51778409 AGTCAAGTTTGATGCCTTAAAGG + Intergenic
990155191 5:52868977-52868999 AGACAAGGGTGATGCCTTAATGG + Intronic
991014153 5:61913920-61913942 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
991239760 5:64444389-64444411 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
991265020 5:64707476-64707498 GGTTAAGCTTGATTCCTTAAAGG + Intronic
991377449 5:65980538-65980560 TGTCAAATTTGATTTCTAAAAGG + Intronic
991423672 5:66467460-66467482 AATCAAGTTTGATTCCTTAAAGG + Intergenic
992281977 5:75187928-75187950 AGAGAAGAGTGATTCCTTAAAGG - Intronic
992413113 5:76526814-76526836 AGTCTAGTTTTATTACTTAAGGG + Intronic
993012149 5:82495137-82495159 AGTCAAGTTTGCCTCCTGTAGGG - Intergenic
993029862 5:82693838-82693860 ACTGAAGTTTAATTCATTAATGG + Intergenic
993600608 5:89919140-89919162 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
993939655 5:94043559-94043581 AGTCAAATTTGATTCCTTAAAGG - Intronic
993942404 5:94075643-94075665 AGTCAAATTTGATTCCTCAGAGG - Intronic
993980915 5:94542918-94542940 AGTCAAGTTTGATTCCTTAAAGG - Intronic
994360175 5:98841054-98841076 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
994489394 5:100422516-100422538 AATCAAGCTTGATTCCTTAAAGG - Intergenic
994505621 5:100640202-100640224 AGTCAAAATTGACTCCTTAAAGG - Intergenic
995681426 5:114725261-114725283 AGTCATGTTTGATTCCTTAAAGG - Intergenic
995830161 5:116346103-116346125 GGTCAAAATTGACTCCTTAAAGG + Intronic
996476336 5:123926240-123926262 TGTCAAGCTTGATTCCTCAAAGG + Intergenic
996574349 5:124965551-124965573 AGTCGCGCTTGACTCCTTAAAGG - Intergenic
997759371 5:136430257-136430279 TGTGAAGTTAGATTCCTTCAGGG + Intergenic
998345436 5:141457946-141457968 TGTCAAGCTTGATTCCTTAAAGG + Intronic
999008043 5:148004374-148004396 AGTTGAGATTGACTCCTTAAAGG - Intergenic
999620199 5:153465183-153465205 CTCTAAGTTTGATTCCTTAAAGG + Intergenic
1000061227 5:157657908-157657930 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1000066637 5:157699056-157699078 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1000069682 5:157728275-157728297 TGTCAAGCTTGATTCCTTAAAGG + Intergenic
1000612106 5:163385773-163385795 AGTAAAGTTAGATTCCTTCCTGG + Intergenic
1000766393 5:165296131-165296153 ACTAAAATTTTATTCCTTAAAGG + Intergenic
1001328762 5:170747592-170747614 TGTCAACTTTCATTCCTGAAAGG - Intergenic
1002030511 5:176425384-176425406 AGTCAAGTTTGTTTCCTTGAAGG + Intergenic
1002682486 5:180978154-180978176 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1002703642 5:181145663-181145685 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1003374686 6:5564946-5564968 TGTCACGCTTGATTCCTTAAAGG + Intronic
1003925033 6:10869707-10869729 AGTCAAACTCGATTCCTTAAAGG + Intronic
1004113437 6:12744207-12744229 AGTCAAATTTGCTTCCTTAAAGG + Intronic
1004646130 6:17562531-17562553 AGTCAAGTTTGATTTCTTAAAGG + Intergenic
1005119566 6:22375055-22375077 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
1005322701 6:24670496-24670518 AGTCAGGTTTGATTACTTAAAGG + Intronic
1005338774 6:24823346-24823368 AGTCAAGTTTAACTCCTTGGAGG + Intronic
1005371151 6:25135105-25135127 AGTCAAGTTTAATTCTTTAAAGG - Intergenic
1005776844 6:29142647-29142669 AGTCAAGTTTCATTCCTTAAAGG + Intergenic
1005782770 6:29210329-29210351 TGTCAAGCTTGGTTCATTAATGG + Intergenic
1006954133 6:37851904-37851926 ATTAAAGATTGATTCTTTAAAGG + Intronic
1007065020 6:38981401-38981423 AGTCCAGTTTGATTATTTATTGG + Intronic
1007862913 6:44932916-44932938 AGTCATCTTTGATTTGTTAATGG - Intronic
1008291264 6:49718600-49718622 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1008559309 6:52708317-52708339 AGTCAAGTTTAATTCATTAAAGG - Intergenic
1008650946 6:53562008-53562030 AATCAAGTTTAATACCTTAAAGG - Intronic
1009726906 6:67546843-67546865 AGTCAAATTGTATTTCTTAAAGG - Intergenic
1009908056 6:69892803-69892825 AGTTGAGATTGACTCCTTAAAGG + Intronic
1010103947 6:72145731-72145753 AGTCAAGCTTGATTCCTTAAAGG + Intronic
1010453466 6:76029049-76029071 AGTTGAGATTGACTCCTTAAAGG - Intronic
1010541514 6:77098013-77098035 AGTCGAAATTGACTCCTTAAAGG - Intergenic
1010691153 6:78912023-78912045 AGGCAAGTATGATTCCTGTATGG - Intronic
1010810251 6:80292191-80292213 AGTTAAGTTTGATTCCTCAAAGG + Intronic
1010872631 6:81060912-81060934 AGCCAAGTTTGACTCCTTAAAGG + Intergenic
1010991891 6:82488999-82489021 AGTCAAGCTCAATTCCTTAAAGG - Intergenic
1011731054 6:90264084-90264106 ACTCCTGTTTGGTTCCTTAAAGG - Intronic
1011940042 6:92831905-92831927 AGCCAAGTTTGATTCTTTAAAGG - Intergenic
1011983012 6:93408549-93408571 AGACAGGTTTGACTCCTTCAGGG + Intronic
1012594803 6:101027050-101027072 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1012694018 6:102354847-102354869 AGTCGAGATTGACTCCTTAAAGG + Intergenic
1013247717 6:108302677-108302699 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1013546469 6:111162509-111162531 AGTCAAACTTGATTTCTTAAAGG + Intronic
1014097383 6:117475069-117475091 AGTCAAGTTACACTCCTTAAAGG + Intronic
1014132507 6:117850421-117850443 AGTCAAGTTTGAATCTTCAAAGG + Intergenic
1014200464 6:118603346-118603368 AGTCAAGTTTAATTTCTTAAAGG + Intronic
1014455790 6:121633212-121633234 AGTCAAATTTAATTTCTTAAAGG + Intergenic
1014954795 6:127601227-127601249 AGTTAAGCTTGACTCTTTAAAGG + Intergenic
1015000899 6:128213935-128213957 AGTCAAGTTTGCTGGCATAAAGG - Intronic
1015306796 6:131717492-131717514 AGTCAAATTTGATCTCTGAAGGG - Intronic
1015813264 6:137181959-137181981 AGTTGAGCTTGATTCCTTAAAGG + Intergenic
1016162200 6:140895654-140895676 GGTAGAGTTTGACTCCTTAAAGG + Intergenic
1016181261 6:141150724-141150746 TGTCAAGCTTGATTCCTTAAAGG + Intergenic
1016205933 6:141468175-141468197 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1016297012 6:142584255-142584277 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1016741763 6:147535924-147535946 AGTCAACTTTGATTCTTTAAAGG + Intronic
1017348511 6:153412551-153412573 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1017351183 6:153443817-153443839 ACTCAAGTTTGATTCCTTAAAGG + Intergenic
1017386175 6:153886340-153886362 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1017404613 6:154105034-154105056 AGTCAAGTTTAATTCCTTAAAGG + Intronic
1017887812 6:158613635-158613657 AGTCAAGTTCGATTCCTTAAAGG + Intronic
1017963296 6:159240916-159240938 ATTCCAGCTTGATTCCTGAAAGG - Intronic
1018078341 6:160236636-160236658 AGTTAAGTTTGATTTCTTAAAGG - Intronic
1018138169 6:160799014-160799036 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1018145888 6:160888314-160888336 ACTCAAGTTTGATTCCTTAAAGG - Intergenic
1018179811 6:161212960-161212982 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1018189512 6:161297901-161297923 AGTCAAGTTTGATTCTTTAAAGG - Intergenic
1019069738 6:169333794-169333816 AGTCAAGTTTGATTCCTAAAAGG + Intergenic
1019076385 6:169391456-169391478 TATCAAGCTTGATTCTTTAAAGG + Intergenic
1019123082 6:169820646-169820668 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1020350357 7:7212327-7212349 TGTCAAGCTTGATTCCTTAAAGG + Intronic
1021331359 7:19342486-19342508 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1022458672 7:30583277-30583299 AGTCAACTTTCATTCTTTAAAGG - Intergenic
1022579908 7:31540909-31540931 AGTGAAGTTTGATTCCTTAAAGG + Intronic
1023588407 7:41755094-41755116 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1023718181 7:43065335-43065357 AGTCAAATTTGCTTGCTAAATGG + Intergenic
1023719133 7:43074791-43074813 AGTCAAAATTGACTCCTTAAAGG + Intergenic
1023782270 7:43668093-43668115 TGTCAAGCTTGATTCCTTAAAGG - Intronic
1023800638 7:43831287-43831309 AGTCCACTTTGATTCTTTAAAGG - Intergenic
1024013324 7:45289314-45289336 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1024491330 7:49989180-49989202 AGTCGAGCTTGATTCCTTAAAGG - Intronic
1024821951 7:53342277-53342299 AGCCAAGTTTGATTCCTTAAAGG - Intergenic
1024906568 7:54388956-54388978 AGTCTAGTTTGATTCTTTAAAGG + Intergenic
1024927320 7:54631089-54631111 AGTCAAGTTCGATTCCTTAAAGG - Intergenic
1024935551 7:54708265-54708287 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025039157 7:55624578-55624600 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025157643 7:56623741-56623763 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1025274132 7:57559948-57559970 AGACAAGTATAATTCCTGAAGGG + Intergenic
1025634638 7:63311822-63311844 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1025648058 7:63436348-63436370 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025741363 7:64199220-64199242 AGTCATGTTTGATTCCTTAAAGG + Intronic
1025769078 7:64487204-64487226 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1025797048 7:64747763-64747785 AATCAAGTTTGATTCCTTAAAGG + Intergenic
1026861088 7:73789879-73789901 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1028146402 7:87324394-87324416 AGTCAAGCTCGATTCCTTAAAGG + Intergenic
1028648818 7:93127802-93127824 GGGCAAGTTTGATTCTTTAAAGG - Intergenic
1030155713 7:106452326-106452348 AGTCAAGTTTGATTTCTTAAAGG + Intergenic
1030156073 7:106457043-106457065 AGTCAAGTTTGATATCTTAAAGG + Intergenic
1030189684 7:106797926-106797948 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1030782557 7:113619171-113619193 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1031095264 7:117410130-117410152 ACTAAAGTGTGATTCTTTAATGG + Intronic
1031227309 7:119055896-119055918 AGTCAAGTTTGATTGTTTAAAGG + Intergenic
1031325564 7:120392664-120392686 ATTCAAATTTGTTTCCTTACTGG + Intronic
1031621816 7:123942809-123942831 ATTCAACTTTGATTCCTTAAAGG + Intronic
1031834917 7:126671070-126671092 AGTCAAGATTGACTCCTTAAAGG - Intronic
1031995102 7:128225470-128225492 AGTCAAGTTAGACTCCTTGGAGG + Intergenic
1032251266 7:130259917-130259939 AGTTGAGCGTGATTCCTTAAAGG - Intergenic
1032671622 7:134088191-134088213 AGTCAAGTTTAATTCCTTAAAGG + Intergenic
1032886864 7:136150023-136150045 AGATAAGTTTGATCCTTTAAAGG + Intergenic
1032928079 7:136632059-136632081 ATTCAGGTTTGATTTCTTCATGG + Intergenic
1033078318 7:138270177-138270199 GTTCTAGTTTGATTCCTTCATGG - Intergenic
1034231640 7:149534082-149534104 AGTGAAGCTTGATTCCTTAAAGG - Intergenic
1034731939 7:153395515-153395537 AGTTAACATTGATTTCTTAAAGG - Intergenic
1037111317 8:15167283-15167305 AGTCTAGATTGACACCTTAAAGG - Intronic
1037955492 8:23054581-23054603 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1039621991 8:39006148-39006170 AATCAAGTTTGATTCCTTAAAGG + Intronic
1039865780 8:41500225-41500247 AGGCCAGTTTGTTTCCTTCAAGG - Intronic
1040061638 8:43108277-43108299 AGTCAAGGTTGATTCCATAAAGG + Intronic
1040526653 8:48231630-48231652 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1040991012 8:53349348-53349370 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1041055143 8:53977629-53977651 ACTCAAGATTGTCTCCTTAAGGG - Intronic
1041378864 8:57230855-57230877 AGGCAAGTTTGATTTCTTTCTGG + Intergenic
1041393715 8:57371188-57371210 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1041810177 8:61899848-61899870 AGTCAAATTGGATTCCATAAAGG + Intergenic
1042357455 8:67844656-67844678 AGTCAGGTTTGATTCCTTAAAGG - Intergenic
1042415269 8:68511012-68511034 AGTTGAGATTGACTCCTTAAAGG + Intronic
1043070278 8:75627930-75627952 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1043196168 8:77294843-77294865 AGTCATGTTTTATTACTTTAGGG + Intergenic
1043676974 8:82968918-82968940 AGTCAAGTTTGATTCTTTAAAGG + Intergenic
1043738153 8:83773677-83773699 AGTCAAGATTGGTTCCAAAAAGG + Intergenic
1044378295 8:91502051-91502073 AGTCAAATTTGATTCCTTAGGGG + Intergenic
1044430164 8:92099121-92099143 AGTCAAATTTGATTTTTAAAAGG + Intronic
1044439359 8:92205283-92205305 AGTCAAGTTCCATTCCTTAAAGG + Intergenic
1045428476 8:102090891-102090913 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1045599726 8:103699007-103699029 AGTAAGGTTTGTTTTCTTAATGG + Intronic
1046068230 8:109221193-109221215 AGTCAAGATTGACTCCCTAAAGG - Intergenic
1046385453 8:113502843-113502865 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1046387771 8:113525694-113525716 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1047344658 8:124015317-124015339 AGTCCAAGTTGTTTCCTTAAAGG - Intronic
1047581418 8:126219845-126219867 TGTCAAGCTTGATTCCTTAAAGG + Intergenic
1048242634 8:132758306-132758328 AGTGAAATTTGATTCCATTATGG + Intronic
1049448527 8:142643712-142643734 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1049500736 8:142963523-142963545 AGTCAAGTTTAATTCCCTAAAGG - Intergenic
1049945802 9:594160-594182 AGGCAGGTTTCATTGCTTAAGGG + Intronic
1050741464 9:8825274-8825296 AGTTAAGTTTGATAACTTAAAGG + Intronic
1050923153 9:11231121-11231143 AGTCAGGTTTGATTCCTTAAAGG + Intergenic
1050929582 9:11306759-11306781 AGTCAAGCTTGTCTTCTTAAAGG - Intergenic
1050990370 9:12143584-12143606 AATTAAGTTTGATTCCTTAAAGG - Intergenic
1051219709 9:14835458-14835480 TGTCGAGCTTGATTCCTTAAAGG - Intronic
1051225506 9:14894916-14894938 AGTCAAGTTTAATTCCTTAAAGG - Intronic
1052059562 9:23943504-23943526 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1052521436 9:29553025-29553047 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1052663488 9:31465775-31465797 AGTTAAGTTTGATTTCTTAAAGG + Intergenic
1052891737 9:33707328-33707350 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1053075728 9:35132808-35132830 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1054458528 9:65449656-65449678 AGTCAAATTAGATGCCTTCAGGG - Intergenic
1054933262 9:70659204-70659226 AGTCAAGTTCAGTTCCTTAAAGG - Intronic
1055411069 9:76029843-76029865 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1056075442 9:83033907-83033929 AGACAAGTGTGATTCGTTCAGGG - Intronic
1056677709 9:88690011-88690033 AGTTAAGTCTGATTCCTTAAAGG - Intergenic
1056727609 9:89135183-89135205 AGTCAAGTTTGATTTCGTAGAGG - Intronic
1056728056 9:89139718-89139740 AATCAAGTTTGATTCCTTAAAGG + Intronic
1056745868 9:89302032-89302054 AGTCAAGTTTGATTCCTTTAAGG - Intergenic
1057347843 9:94267347-94267369 AGTGAACTTTGATTCCTTAAAGG + Intronic
1057467204 9:95325101-95325123 AGTCAAGTCTGATTCCTTAAAGG + Intergenic
1057580590 9:96284561-96284583 AGTCAAGTATGATTCCTTAAAGG - Intronic
1057909680 9:99008380-99008402 AATCAACTTTGGTTCCTTAAAGG + Intronic
1058016026 9:100033249-100033271 AGTCAACGTTGATTCCTTAAAGG - Intronic
1058282167 9:103129047-103129069 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1058997265 9:110312374-110312396 AGTCATATTTGATTCCTTAAGGG - Intronic
1060306557 9:122418134-122418156 AGTCAAGTTAGATTCCTTAAAGG + Intergenic
1186353393 X:8763627-8763649 AGTCAATTTTTATCACTTAATGG + Intergenic
1187139727 X:16582014-16582036 AGTCAAGTTTGGTTTTTTAAAGG - Intergenic
1187150378 X:16676212-16676234 ATTCAAGTTCGATTCTTTACAGG - Intronic
1187156831 X:16727859-16727881 AGTCAAGTTTGATTCATTAAAGG + Intronic
1187616431 X:20999609-20999631 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1187887621 X:23904443-23904465 AGTCAGGTTGGTTTCCTTTAGGG - Intronic
1188133839 X:26470230-26470252 AGTCAAGTTTAATTCCTTAAAGG + Intergenic
1188159226 X:26779833-26779855 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1188167671 X:26881588-26881610 AGTCAAGTTTGATTTCTTAAAGG + Intergenic
1188686716 X:33078269-33078291 AGTCAACTTTGATTCTTTAAAGG + Intronic
1188752425 X:33920774-33920796 AGTCAAATTTGATTCCTTAAAGG + Intergenic
1188763071 X:34056314-34056336 AGTCAAGACTGACCCCTTAAAGG - Intergenic
1189086313 X:38028279-38028301 AATCAAGTTTGATTCCTTAAAGG + Intronic
1189153197 X:38728833-38728855 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1189632603 X:42970712-42970734 AGTTAAGCTTGATTCTTTAAAGG + Intergenic
1190149723 X:47935137-47935159 AGTTAAGTTTGATTCCTTAAAGG - Intronic
1190490847 X:50981715-50981737 AGCCAAGCTTGACTCCTTAAAGG - Intergenic
1190549080 X:51560077-51560099 AATCAAGCTTGACTCCTTAAAGG + Intergenic
1190784592 X:53632829-53632851 AGTCAAAATTGATCTCTTAAAGG - Intronic
1190920691 X:54849002-54849024 AGTCAAGTTTGATTCCTAAAAGG + Intergenic
1190955995 X:55194117-55194139 AGTCAAGTTTGACTCCTTAAAGG + Intronic
1190963458 X:55275474-55275496 AGTCAAGTTTAATTCTCCAAAGG - Intronic
1191004948 X:55701541-55701563 AGTCAAAATTGATTTCTTAAAGG + Intergenic
1191069682 X:56386672-56386694 AGTCAAGCTTGATTCCTTAAGGG + Intergenic
1191189735 X:57654147-57654169 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1191218930 X:57964864-57964886 AATCAAGTTTGATTCCTTAAAGG + Intergenic
1191594764 X:62930724-62930746 AATCAAGCTTGATTCCTTAAAGG + Intergenic
1191613243 X:63139375-63139397 AGCCAAATTCGATTCCTTAAAGG - Intergenic
1191623054 X:63239552-63239574 AGCCAAATTCGATTCCTTAAAGG + Intergenic
1191644835 X:63468720-63468742 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1192542413 X:71985371-71985393 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1192623192 X:72701191-72701213 AGTCAAGTTTGATTCTTTAAAGG - Intronic
1192681295 X:73256259-73256281 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1192777286 X:74258504-74258526 TGTCAAGCTTGATTCCTTAAAGG - Intergenic
1192864903 X:75120709-75120731 AGTCAAGTTACATTCCTTAAAGG - Intronic
1193228909 X:79019875-79019897 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1193269576 X:79513888-79513910 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
1193338296 X:80316558-80316580 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1193347887 X:80425057-80425079 AGTTAAGCTTGACTTCTTAAAGG + Intronic
1193355385 X:80513886-80513908 AATCAAGCTTGATTCCTTAAAGG + Intergenic
1193523404 X:82558874-82558896 AGTCAAATTTGATTCCTTAAAGG - Intergenic
1193531895 X:82664569-82664591 AGTAAAGTTTGATTCCTTAAAGG + Intergenic
1193641709 X:84016656-84016678 AATCAAATTTGATTCCTTAAAGG + Intergenic
1193791282 X:85818309-85818331 TGTCAAGATTGATTCCTTAAAGG - Intergenic
1193833775 X:86317947-86317969 AGTCAAGCTTGACTCCTTAAAGG + Intronic
1194044783 X:88988965-88988987 AGTTAACTTTAATTCCTTAAAGG - Intergenic
1194147981 X:90287070-90287092 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1194158336 X:90420386-90420408 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1194159572 X:90434016-90434038 AGTAAAGTTTGATTTCTTAAAGG + Intergenic
1194166949 X:90528909-90528931 AAACAAGTTCAATTCCTTAAAGG - Intergenic
1194169863 X:90567495-90567517 AGTAAAATTTGATTCCTTAAGGG + Intergenic
1194233710 X:91356450-91356472 AGTCAACTTTGATTCCTTAAAGG + Intergenic
1194436114 X:93870017-93870039 AGTCGAGGTTAATTGCTTAAAGG + Intergenic
1194482309 X:94441546-94441568 CATCAAGCTTGATTCCTTAAAGG + Intergenic
1194486108 X:94489175-94489197 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1194492738 X:94571258-94571280 AGCCATCTTTCATTCCTTAAAGG + Intergenic
1195036647 X:100976024-100976046 AGTTAAGTTTGTTTCCTACAAGG - Intronic
1195048331 X:101075095-101075117 AGTCAACTTTGATTATTTAAAGG - Intergenic
1195150603 X:102065725-102065747 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1195225653 X:102789840-102789862 AATTAGGTTTGATACCTTAAAGG + Intergenic
1195337207 X:103867198-103867220 AATCCAGTTTGATTTTTTAAAGG + Intergenic
1195487160 X:105422401-105422423 ATTCAAGTTTGATTCCTTAAAGG + Intronic
1195877195 X:109554393-109554415 AGTCAAGTGTGATTCCTTAATGG - Intergenic
1196074220 X:111556985-111557007 AGTCAAGTTTGATTCTTTAAAGG + Intergenic
1196102339 X:111859738-111859760 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1196162076 X:112496308-112496330 AATCAAGTTTGATTCTTTAAAGG + Intergenic
1196563272 X:117176223-117176245 AGTCAAGCTTAATTCCTTAAAGG - Intergenic
1196641402 X:118066796-118066818 AATCTAGTTTTTTTCCTTAATGG + Intronic
1196773040 X:119314895-119314917 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1196884817 X:120234201-120234223 AGTCAACTTTGATTTCTTAAAGG - Intergenic
1197038509 X:121906920-121906942 AGTCAAGCTTGACCGCTTAAAGG - Intergenic
1197043069 X:121963723-121963745 AGTTAAGTTTGATTTCTTAAAGG - Intergenic
1197065637 X:122230888-122230910 AGCCAAGCTTGATTCCTTAAAGG - Intergenic
1197365942 X:125564504-125564526 TGTCAAGATTGTCTCCTTAAAGG + Intergenic
1197384204 X:125783311-125783333 AGTCAATTTTGATTCTTCAAAGG + Intergenic
1197396486 X:125933504-125933526 AGGCAAGCTTGGCTCCTTAAGGG + Intergenic
1197481340 X:126990435-126990457 AGTCAAGTTTAATTCCTTAAAGG - Intergenic
1197568277 X:128115765-128115787 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1197853112 X:130885538-130885560 ATACATGTTTAATTCCTTAATGG - Intronic
1197921469 X:131599007-131599029 AGTGAGGTCTGATTCCTTGAGGG - Intergenic
1198777883 X:140200087-140200109 AGTCCAGTTTCCTTCCTAAAAGG + Intergenic
1198844598 X:140896890-140896912 AGTTAAATTTGATTCCTTAAAGG + Intergenic
1198939519 X:141938122-141938144 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1199166735 X:144685156-144685178 AGTCAACTTTGATTCTTTAAAGG - Intergenic
1199169599 X:144720632-144720654 TGTCAAGCTTGACTCCTTAAAGG - Intergenic
1199234013 X:145470455-145470477 AGTCGAGATTGACTCTTTAAAGG - Intergenic
1199251486 X:145667664-145667686 AGTCAACTTTAATTCCATAAAGG - Intergenic
1199321368 X:146442884-146442906 AGTAAACTTTGATTCCTTAAAGG + Intergenic
1199355683 X:146860796-146860818 AGTCAATTTTGATTCCTTAAAGG + Intergenic
1199869539 X:151885797-151885819 AATCAAGTTAGATTTCTTAAAGG - Intergenic
1199887272 X:152032660-152032682 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1199948294 X:152684717-152684739 AGTCAAGTTTGATCCCTTAAAGG - Intergenic
1199961385 X:152783737-152783759 AGTCAAGTTTGATCCCTTAAAGG + Intergenic
1199994477 X:153011964-153011986 AGTCAAGTTTTTTTCCTTAAAGG + Intergenic
1200285146 X:154814035-154814057 ATTCAACTTTGATTACTTGAAGG + Intronic
1200323250 X:155212106-155212128 AGTCAAGCTTGATTATTTATTGG - Intronic
1200494360 Y:3863829-3863851 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1200504658 Y:3997350-3997372 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1200505874 Y:4010982-4011004 AGTAAAGTTTGATTTCTTAAAGG + Intergenic
1200513216 Y:4106685-4106707 AATCAAGTTCAATTCCTTAAAGG - Intergenic
1200516105 Y:4145269-4145291 AGTAAAATTTGATTCCTTAAGGG + Intergenic
1200822675 Y:7603399-7603421 AGTTAAGTTTTATTCACTAAAGG + Intergenic
1200877630 Y:8175100-8175122 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1200898472 Y:8402784-8402806 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1201319841 Y:12686505-12686527 CGTCAAGTTTGATTCCTTAAAGG - Intergenic
1201364185 Y:13185707-13185729 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1201376030 Y:13320836-13320858 AGTCACATTTGACTCCTTTAAGG - Intronic
1201397640 Y:13565893-13565915 AGCCAAGCTTGATTCCTTAAAGG - Intergenic
1201636751 Y:16131695-16131717 AGCCAAGTTTGATGCCTTTAAGG - Intergenic
1201675292 Y:16575376-16575398 AAATAAGTTTGATTCCTCAAAGG + Intergenic
1202086652 Y:21144772-21144794 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1202104637 Y:21350157-21350179 ACATAAGTTTGATTCCTTAAAGG + Intergenic
1202237628 Y:22730620-22730642 AGTTAAGTTTTATTCACTAAAGG - Intergenic