ID: 950919114

View in Genome Browser
Species Human (GRCh38)
Location 3:16676339-16676361
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950919110_950919114 11 Left 950919110 3:16676305-16676327 CCTTTAAGGAATCAAACTTGACT 0: 115
1: 183
2: 150
3: 142
4: 232
Right 950919114 3:16676339-16676361 TAAAACCCCTTTGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr