ID: 950923703

View in Genome Browser
Species Human (GRCh38)
Location 3:16719299-16719321
Sequence CACAATAACCTCTATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950923703_950923705 0 Left 950923703 3:16719299-16719321 CCAACCTCATAGAGGTTATTGTG No data
Right 950923705 3:16719322-16719344 AGACATAAATGAGTTAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950923703 Original CRISPR CACAATAACCTCTATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr