ID: 950924253

View in Genome Browser
Species Human (GRCh38)
Location 3:16724365-16724387
Sequence ATAAGCGGGGACCACCGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924253_950924259 9 Left 950924253 3:16724365-16724387 CCATTGCGGTGGTCCCCGCTTAT No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data
950924253_950924263 26 Left 950924253 3:16724365-16724387 CCATTGCGGTGGTCCCCGCTTAT No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924253 Original CRISPR ATAAGCGGGGACCACCGCAA TGG (reversed) Intergenic
No off target data available for this crispr