ID: 950924256

View in Genome Browser
Species Human (GRCh38)
Location 3:16724378-16724400
Sequence GTATTCCCTGTGAATAAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924256_950924259 -4 Left 950924256 3:16724378-16724400 CCCCGCTTATTCACAGGGAATAC No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data
950924256_950924263 13 Left 950924256 3:16724378-16724400 CCCCGCTTATTCACAGGGAATAC No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924256 Original CRISPR GTATTCCCTGTGAATAAGCG GGG (reversed) Intergenic
No off target data available for this crispr