ID: 950924257

View in Genome Browser
Species Human (GRCh38)
Location 3:16724379-16724401
Sequence TGTATTCCCTGTGAATAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924257_950924263 12 Left 950924257 3:16724379-16724401 CCCGCTTATTCACAGGGAATACA No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data
950924257_950924259 -5 Left 950924257 3:16724379-16724401 CCCGCTTATTCACAGGGAATACA No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924257 Original CRISPR TGTATTCCCTGTGAATAAGC GGG (reversed) Intergenic
No off target data available for this crispr