ID: 950924258

View in Genome Browser
Species Human (GRCh38)
Location 3:16724380-16724402
Sequence ATGTATTCCCTGTGAATAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924258_950924263 11 Left 950924258 3:16724380-16724402 CCGCTTATTCACAGGGAATACAT No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data
950924258_950924259 -6 Left 950924258 3:16724380-16724402 CCGCTTATTCACAGGGAATACAT No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924258 Original CRISPR ATGTATTCCCTGTGAATAAG CGG (reversed) Intergenic
No off target data available for this crispr