ID: 950924259

View in Genome Browser
Species Human (GRCh38)
Location 3:16724397-16724419
Sequence ATACATTCCAAGACTCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924258_950924259 -6 Left 950924258 3:16724380-16724402 CCGCTTATTCACAGGGAATACAT No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data
950924256_950924259 -4 Left 950924256 3:16724378-16724400 CCCCGCTTATTCACAGGGAATAC No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data
950924253_950924259 9 Left 950924253 3:16724365-16724387 CCATTGCGGTGGTCCCCGCTTAT No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data
950924257_950924259 -5 Left 950924257 3:16724379-16724401 CCCGCTTATTCACAGGGAATACA No data
Right 950924259 3:16724397-16724419 ATACATTCCAAGACTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924259 Original CRISPR ATACATTCCAAGACTCCCAA TGG Intergenic
No off target data available for this crispr