ID: 950924263

View in Genome Browser
Species Human (GRCh38)
Location 3:16724414-16724436
Sequence CAATGGATGCATGTAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950924257_950924263 12 Left 950924257 3:16724379-16724401 CCCGCTTATTCACAGGGAATACA No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data
950924253_950924263 26 Left 950924253 3:16724365-16724387 CCATTGCGGTGGTCCCCGCTTAT No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data
950924256_950924263 13 Left 950924256 3:16724378-16724400 CCCCGCTTATTCACAGGGAATAC No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data
950924258_950924263 11 Left 950924258 3:16724380-16724402 CCGCTTATTCACAGGGAATACAT No data
Right 950924263 3:16724414-16724436 CAATGGATGCATGTAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950924263 Original CRISPR CAATGGATGCATGTAACTGA AGG Intergenic
No off target data available for this crispr