ID: 950926026

View in Genome Browser
Species Human (GRCh38)
Location 3:16742964-16742986
Sequence TTCTATTTAGATTTCCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950926025_950926026 3 Left 950926025 3:16742938-16742960 CCTAGGCAATCACTAATCAATTT No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926015_950926026 24 Left 950926015 3:16742917-16742939 CCCCTTTCCCCTAACTCCCACCC No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926022_950926026 8 Left 950926022 3:16742933-16742955 CCCACCCTAGGCAATCACTAATC No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926016_950926026 23 Left 950926016 3:16742918-16742940 CCCTTTCCCCTAACTCCCACCCT No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926024_950926026 4 Left 950926024 3:16742937-16742959 CCCTAGGCAATCACTAATCAATT No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926017_950926026 22 Left 950926017 3:16742919-16742941 CCTTTCCCCTAACTCCCACCCTA No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926021_950926026 15 Left 950926021 3:16742926-16742948 CCTAACTCCCACCCTAGGCAATC No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926020_950926026 16 Left 950926020 3:16742925-16742947 CCCTAACTCCCACCCTAGGCAAT No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926023_950926026 7 Left 950926023 3:16742934-16742956 CCACCCTAGGCAATCACTAATCA No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data
950926019_950926026 17 Left 950926019 3:16742924-16742946 CCCCTAACTCCCACCCTAGGCAA No data
Right 950926026 3:16742964-16742986 TTCTATTTAGATTTCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950926026 Original CRISPR TTCTATTTAGATTTCCTATT TGG Intergenic
No off target data available for this crispr