ID: 950927947

View in Genome Browser
Species Human (GRCh38)
Location 3:16761332-16761354
Sequence TGAACACCCAGGACAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950927947_950927952 12 Left 950927947 3:16761332-16761354 CCACCTCCTGTCCTGGGTGTTCA No data
Right 950927952 3:16761367-16761389 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
950927947_950927954 13 Left 950927947 3:16761332-16761354 CCACCTCCTGTCCTGGGTGTTCA No data
Right 950927954 3:16761368-16761390 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
950927947_950927956 21 Left 950927947 3:16761332-16761354 CCACCTCCTGTCCTGGGTGTTCA No data
Right 950927956 3:16761376-16761398 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950927947 Original CRISPR TGAACACCCAGGACAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr