ID: 950932406

View in Genome Browser
Species Human (GRCh38)
Location 3:16803606-16803628
Sequence CAGAGGAAGCTTGAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950932399_950932406 5 Left 950932399 3:16803578-16803600 CCCTTAGGTCGACCTCCAGATTT 0: 1
1: 0
2: 0
3: 2
4: 46
Right 950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG 0: 1
1: 0
2: 3
3: 45
4: 371
950932402_950932406 -7 Left 950932402 3:16803590-16803612 CCTCCAGATTTCACAGCAGAGGA 0: 1
1: 0
2: 1
3: 23
4: 264
Right 950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG 0: 1
1: 0
2: 3
3: 45
4: 371
950932403_950932406 -10 Left 950932403 3:16803593-16803615 CCAGATTTCACAGCAGAGGAAGC 0: 1
1: 0
2: 7
3: 89
4: 865
Right 950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG 0: 1
1: 0
2: 3
3: 45
4: 371
950932400_950932406 4 Left 950932400 3:16803579-16803601 CCTTAGGTCGACCTCCAGATTTC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG 0: 1
1: 0
2: 3
3: 45
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950932406 Original CRISPR CAGAGGAAGCTTGAGGATGA GGG Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
901024777 1:6273393-6273415 CAGGGGCAGCTTCAGGATGCAGG + Intronic
902983329 1:20140706-20140728 CAGAGCATGCTTATGGATGAAGG + Intronic
903302060 1:22386184-22386206 CAGAGGAGCCCAGAGGATGAGGG - Intergenic
903804189 1:25992509-25992531 CAGAGTAAGTATGATGATGATGG - Intronic
905117147 1:35652117-35652139 AAATGGAAGCTTGAGGAGGAAGG - Intergenic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
907279115 1:53333943-53333965 CAGAGGAAAGGAGAGGATGAAGG + Intergenic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
908505302 1:64791417-64791439 CATAGATAGCTTCAGGATGAGGG - Intronic
911440809 1:97922910-97922932 GAGAGGAAGCTCCAGGAAGAGGG + Intergenic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
913124432 1:115772162-115772184 CAGAGGATGCTGGAGGCTCATGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915119149 1:153617670-153617692 CAGAGGAACCTTTAGGCTGAGGG - Intergenic
915467175 1:156104549-156104571 CAGAGGATGAGTGGGGATGAAGG - Intronic
915627657 1:157125455-157125477 CAGAACAAGCTTGAGAATGAAGG + Exonic
917072848 1:171171084-171171106 CAGTGGAAGCTTGGTGGTGATGG - Intergenic
917495551 1:175537271-175537293 AAGAGAAAGCTTCAGAATGAAGG + Intronic
917729284 1:177858164-177858186 CCGAGGAAGATGGAGGGTGAAGG + Intergenic
918002958 1:180514680-180514702 CAGAGGCTGTTTGATGATGATGG + Intergenic
918246539 1:182665198-182665220 CAGAGCAGGGTTGAGGAAGAGGG - Intronic
918797404 1:188919237-188919259 AGGAGGAATCCTGAGGATGATGG + Intergenic
919531894 1:198731679-198731701 AAGAGGAAGATTGCTGATGAAGG + Exonic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
921062328 1:211596084-211596106 CATAGTAAGCTTCAGGGTGAAGG - Intergenic
921308602 1:213821135-213821157 CAGAGTAAGATAGAAGATGAAGG - Intergenic
922985045 1:229859981-229860003 CAGGGGAAGATTGAGGTTGAGGG - Intergenic
923925750 1:238625459-238625481 CAGAGGAAGTAATAGGATGATGG + Intergenic
923942328 1:238842102-238842124 CAGAGATACCTAGAGGATGAAGG - Intergenic
924157944 1:241200668-241200690 GAGAGGGAGCTTTAGGAAGACGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063192032 10:3704550-3704572 CAGAGGTACCTTGAGGAAGAAGG + Intergenic
1066253316 10:33654865-33654887 CAAAGAATGCTTGAAGATGAGGG - Intergenic
1066546652 10:36507463-36507485 CAGAGGAAGAATGAGGTTGGGGG - Intergenic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067204842 10:44203808-44203830 CACATGAAACTTGAGAATGAAGG - Intergenic
1067375796 10:45727074-45727096 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1067883506 10:50067762-50067784 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070170246 10:73927393-73927415 CAGAGAAAGTTTGAGGCTGGGGG - Intergenic
1070285860 10:75083261-75083283 AAGAGGATGCTTGAAGAAGAGGG - Intergenic
1070389416 10:75956302-75956324 GAGAACAAGCTGGAGGATGAGGG + Intronic
1070448697 10:76535316-76535338 AAGAGGAAGGCAGAGGATGAAGG + Intronic
1070746527 10:78937100-78937122 CACTGGCAGCTTGAGGGTGATGG - Intergenic
1071156528 10:82695894-82695916 CAGAGGAAGCTTGCAGGTAAAGG - Intronic
1071301891 10:84262116-84262138 CTGAGGAAGTCTGATGATGAAGG + Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071846732 10:89528254-89528276 CAGAGAAAGTTTGAGTATTAAGG + Intronic
1073046863 10:100644556-100644578 CAGTGGCAGATTAAGGATGAGGG + Intergenic
1075646832 10:124102398-124102420 CAGAGCAAGCTTGGGGCAGAGGG - Intergenic
1076192745 10:128494379-128494401 AAGAGGAAACTTGAGGCTCAGGG - Intergenic
1076575262 10:131461616-131461638 CAGAGGCAGCCTCAGGAAGATGG - Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1078102402 11:8337618-8337640 CAGAGGGAGCTTGACGACGGCGG + Intergenic
1078536327 11:12178022-12178044 CATAGGCAGCTTCAGGATGAAGG + Intronic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1080519734 11:33057542-33057564 CAGAGAAAGCTTTAGGTGGAGGG + Intronic
1081606451 11:44530095-44530117 TAGAGGAAGGATGAGGATGATGG - Intergenic
1081788714 11:45767485-45767507 CCTAGGTAGCTTGAGGATGGGGG - Intergenic
1082803292 11:57430067-57430089 CAGAGGAAGTTTGAGGAGAGAGG - Intergenic
1083727289 11:64635227-64635249 AGCAGGAAGCTTGAGGTTGAAGG + Intronic
1084090235 11:66874943-66874965 CAGAGAAAGCTCCAGGAAGAAGG + Intronic
1084768010 11:71324978-71325000 GAGAGGAGGGTTGAGGAAGATGG + Intergenic
1085108165 11:73863859-73863881 CAGAAGAAGCTTGACAAGGATGG - Intronic
1086119989 11:83295604-83295626 CTGAGGGAGCTTGAGGCTCAGGG + Intergenic
1086729908 11:90236154-90236176 CCTAGGTAGCTTCAGGATGAAGG + Intergenic
1088921849 11:114265119-114265141 CATAGGCAGCTTCAGGATGGGGG - Intronic
1088994459 11:114984640-114984662 CACAGGAAGATGGAGGAGGAGGG - Intergenic
1090277884 11:125432385-125432407 GAAAGGAAGCTGGAGGCTGATGG - Exonic
1090359042 11:126160197-126160219 CAGAGAAAGGTTGAGGATAAGGG - Intergenic
1090359738 11:126163958-126163980 CAGAGGAAGCTAGAGTTTGAGGG - Intergenic
1091111616 11:132974232-132974254 GAGAGGTAGCTGGAAGATGAAGG - Intronic
1092242956 12:6846779-6846801 GAGAGGATGCCTGAGGAAGAGGG - Exonic
1092301592 12:7255703-7255725 CATTGGTAGCTTGAGGAGGATGG - Intergenic
1093195396 12:16124429-16124451 CAAAGGCAGCTTCAGGATCAAGG - Intergenic
1093769866 12:23005890-23005912 CAGTGGTTGCCTGAGGATGATGG + Intergenic
1094053306 12:26243774-26243796 CAGAGGTAGAGTGTGGATGAGGG - Intronic
1094273699 12:28645491-28645513 AAGAGGATGCTTCAGGAGGAAGG - Intergenic
1095430266 12:42126390-42126412 CAAAAGAAGCTTGCTGATGAAGG + Intronic
1095993059 12:48051648-48051670 CAGAGGAGGGCTGAAGATGAAGG + Intronic
1096190997 12:49619191-49619213 CTCAGGAAGCTTCTGGATGATGG + Intronic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097181289 12:57173491-57173513 CAGAGGAAGCTTGTGTGTCATGG + Intronic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1097683520 12:62671118-62671140 CAGGGGAACTTTGAGGATGTGGG - Intronic
1098331096 12:69354580-69354602 CAGAGGAGGGTGGAGGATAAGGG - Intergenic
1102224296 12:111217024-111217046 CACAGGAAACTGGAGGATTAGGG + Intronic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102954191 12:117048814-117048836 CTGAGGAATGTTTAGGATGAAGG + Intronic
1103013647 12:117477181-117477203 CAGAGAAGCCTTGAGGATGGAGG - Intronic
1103546189 12:121703253-121703275 CAGAGGCAACTTGAGGCTGAAGG + Intergenic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1104218709 12:126760946-126760968 CAGAGGAAGATTGAGGACTAAGG - Intergenic
1104581275 12:130012511-130012533 AAGAGGAAGCCTGAGGCTGGAGG - Intergenic
1104993372 12:132639471-132639493 CAGATGAGGCATGAGGGTGAAGG - Intronic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1106218172 13:27721621-27721643 CAGAGGAAGCCTTTGCATGAAGG + Intergenic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1107435280 13:40376184-40376206 CACAGGGAGTTTGAGGGTGAAGG + Intergenic
1107999667 13:45894706-45894728 CAGAGGAAGATGGCGGAAGATGG - Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1111566290 13:90021095-90021117 CACAGGTAGCATTAGGATGATGG - Intergenic
1112634199 13:101197024-101197046 CTGAGGAGGCTTGAGAGTGAAGG - Intronic
1113163453 13:107410308-107410330 CACAGGAAGCCTGAGGAACAAGG - Intronic
1113363742 13:109656371-109656393 AAGAGGAATTTTGAGGATGTGGG - Intergenic
1113629963 13:111875420-111875442 CAGAGAGAGGCTGAGGATGATGG - Intergenic
1114364307 14:22010737-22010759 TACAGGAAGCTTCTGGATGAGGG + Intergenic
1114647010 14:24261477-24261499 CCCAGGAGGCTTGAGGAGGATGG + Intronic
1114757520 14:25276575-25276597 CAGAGGAAGCTTAGGCAGGAAGG + Intergenic
1114782264 14:25550875-25550897 AAGAGGGAGGATGAGGATGAGGG + Intergenic
1115495753 14:34002932-34002954 AAGAGGGAGCTTTAGGATGATGG + Intronic
1116006363 14:39296122-39296144 AAGAGGAACCTTTAGGATGGGGG - Intronic
1116477043 14:45352109-45352131 CAGAGAAAGCTTGAGGGAAAAGG - Intergenic
1116572701 14:46537967-46537989 GAGAGAAAGCATGAGGTTGATGG - Intergenic
1116698446 14:48204954-48204976 AAGAGTAAGCTTTAGAATGACGG + Intergenic
1117229419 14:53700478-53700500 CCTAGGTAGCTTTAGGATGAGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1118134150 14:63003007-63003029 CACAGTAAGCTTGAGGCAGAAGG + Intronic
1118251929 14:64170295-64170317 CAGAGGAAGGGTGACGTTGATGG + Exonic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119551141 14:75514979-75515001 CAGAGGGGGCTTGAGGCTGGGGG - Intergenic
1121455536 14:94036591-94036613 AAAAGGAAGCTTCAGGGTGAAGG - Intronic
1122290308 14:100677356-100677378 CAGAGCAGGCTTGAGGAGGGAGG - Intergenic
1122717778 14:103705829-103705851 CGGAGGACGCTGGAGAATGAGGG + Intronic
1122793824 14:104195715-104195737 CAGAGGCAGCTTGAGTTTGGCGG + Intergenic
1123045729 14:105512942-105512964 AATAGGGAGATTGAGGATGAGGG + Intergenic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1124709757 15:31998035-31998057 AAGGGGAAATTTGAGGATGATGG + Intergenic
1125090217 15:35781953-35781975 TAGAGGCTGCTTGAGGAAGAGGG - Intergenic
1125606739 15:40943767-40943789 CAGAGAAACTTTGGGGATGAAGG - Intergenic
1125719623 15:41839077-41839099 AGGAGGAGGCTTGGGGATGAGGG + Intronic
1126807558 15:52367164-52367186 CAGAGGAAGCCTGATGACCAAGG + Intronic
1128249104 15:66152376-66152398 GAGAGGAAGGGTGAGGAGGAGGG - Intronic
1129606892 15:77029372-77029394 CGGAGGTTGCTTGTGGATGATGG + Intronic
1130266057 15:82404660-82404682 GAGAAGAAGTTGGAGGATGAAGG + Intergenic
1130505958 15:84542214-84542236 GAGAAGAAGTTGGAGGATGAAGG - Intergenic
1130981364 15:88813918-88813940 CAGAGGGAGCTGGAGGGTCAGGG - Intronic
1131225740 15:90623299-90623321 CAGTGGAACCTTGAGAATGTCGG + Intronic
1131727113 15:95238862-95238884 CAGAGGAAACTAGAGGAGAAAGG + Intergenic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1132989894 16:2787152-2787174 TAGAGGAGGGGTGAGGATGAGGG - Intronic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1137324494 16:47420525-47420547 AAGAGGAAGCGTGAGGATCATGG + Intronic
1138045291 16:53716483-53716505 CAGATGAAGATTGAGGCTCAAGG - Intronic
1139230887 16:65281348-65281370 CACAGGAAGCTTCAGGCTAAAGG + Intergenic
1139490440 16:67283166-67283188 CAGAAGAGGGTTGAGGATGGGGG + Intronic
1140276867 16:73517195-73517217 CACAGGAAGCTTCTGGTTGAAGG - Intergenic
1141362728 16:83411356-83411378 CATTGGATGCTTGTGGATGATGG - Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1143394185 17:6579019-6579041 CAGAGGAAGTTTGAGGAATCAGG - Exonic
1143502222 17:7346195-7346217 CATAGGCAGCTTTAGGATGAGGG - Intronic
1144187543 17:12810470-12810492 GATAGAAAGCTTGAGGATGAGGG + Intronic
1144615810 17:16770788-16770810 CAGAGGATGCTGAAGGATTAAGG - Intronic
1144751410 17:17651139-17651161 CACTGGAAGCTAGAGAATGATGG + Intergenic
1144896893 17:18544883-18544905 CAGAGGATGCTGAAGGATTAAGG + Intergenic
1145135320 17:20399331-20399353 CAGAGGATGCTGAAGGATTAAGG - Intergenic
1146435215 17:32839594-32839616 CAGAGAAAGGCAGAGGATGAAGG + Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1148049130 17:44760495-44760517 CAGAGGAAGGTTAGGCATGAAGG + Intronic
1148121640 17:45216116-45216138 CTCAGGCAGCTTGGGGATGATGG + Intergenic
1148172328 17:45532810-45532832 CAGAGGAAGATATAGAATGAAGG - Intergenic
1148276939 17:46312642-46312664 CAGAGGAAGATATAGAATGAAGG + Intronic
1148299055 17:46530226-46530248 CAGAGGAAGATATAGAATGAAGG + Intronic
1150403534 17:64879726-64879748 CAGAGGAAGATATAGAATGAGGG - Intronic
1151290186 17:73144228-73144250 CACAGGTACCTTGAGGAAGATGG + Intergenic
1151360168 17:73584001-73584023 CAGAGGAAACTTGGGGTTGTGGG + Intronic
1151754524 17:76065696-76065718 CAGAGGAGGCTTGACCTTGAAGG - Intronic
1152022511 17:77787997-77788019 CTGAGGAAGCTGGTGGCTGAAGG + Intergenic
1153672009 18:7420459-7420481 CAATGGAAGGGTGAGGATGAAGG - Intergenic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1157127670 18:44972418-44972440 CATTGGTAGCTTGAGGAGGATGG + Intronic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157856222 18:51108049-51108071 AGGAGGAAGCTGGAGGATCAGGG + Intergenic
1158398173 18:57095953-57095975 CAGAGGAAACTAGAGTCTGAAGG + Intergenic
1158859486 18:61578514-61578536 CAGAAGCAGCATGCGGATGATGG + Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1160084909 18:75767662-75767684 CAGAAGATTCTTGAGGATGTTGG - Intergenic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1161161283 19:2763029-2763051 CAGGGGCTGCTTGTGGATGACGG - Intronic
1161739513 19:6012007-6012029 CACAGACAGCATGAGGATGATGG - Intronic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164883015 19:31751947-31751969 CCTAGGAAGCTTCAGGATGGGGG + Intergenic
1165985961 19:39769088-39769110 CCTAGGTAGCTTCAGGATGAGGG - Intergenic
1166360962 19:42252886-42252908 CGGAGGAAGCTTGGGGGTGCGGG + Intronic
925031444 2:653090-653112 CACAGGAAGCTTGAAGAGCATGG - Intergenic
926104531 2:10142041-10142063 CAGAGGGAGCCAGAGGATGTGGG + Intronic
927099750 2:19778999-19779021 GAGCTGAAGGTTGAGGATGATGG - Intergenic
928675377 2:33645988-33646010 CACAGGAAGCTTGAAGTTGGGGG + Intergenic
929920721 2:46169409-46169431 CAGAGGAACATGGAGGGTGAAGG - Intronic
932094656 2:68837014-68837036 CAGTGTTAGCGTGAGGATGAGGG + Intergenic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
934047631 2:88185790-88185812 CAGAGGAAGTTTAGGGATGGGGG - Intronic
935128985 2:100247375-100247397 CTCAGGCAGCTTGAGGAGGATGG - Intergenic
935823855 2:106921933-106921955 TGGATGAACCTTGAGGATGAAGG - Intergenic
935889018 2:107655426-107655448 CAGGGGAAGCTTGAGAGTAATGG + Intergenic
936226267 2:110656215-110656237 TAGAGGAAGCTTGGTGAGGAGGG - Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
936876316 2:117193960-117193982 CAGAGGAAGCTAGAGTTTGCTGG + Intergenic
937476315 2:122218465-122218487 CCCAGGAAGCCTGAGGATGACGG + Intergenic
938673500 2:133607000-133607022 CTGTGGGAGCTTGAGAATGAAGG + Intergenic
939114735 2:138047526-138047548 TAGACTAAGATTGAGGATGAAGG + Intergenic
941662940 2:168214151-168214173 CAGATGAGGCTTGAGGCTCAGGG - Intronic
942236799 2:173917921-173917943 CACAGGAATATTGAAGATGAGGG - Intronic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942514410 2:176737098-176737120 CAAGGGAAGCTTGAGGCTGGTGG + Intergenic
942783665 2:179675551-179675573 CACTGGCAGCTTGAGGCTGAAGG + Intronic
942927984 2:181456821-181456843 CAGAGGAAGTGTGGGGAGGAAGG + Intergenic
943332585 2:186577235-186577257 CAGAGGAGGCTTGAGGTAGGTGG + Intergenic
944219998 2:197293606-197293628 GAGAGGAATTTTGGGGATGAGGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
947469773 2:230390326-230390348 AATATGAAGCTTGAGGTTGAGGG - Intronic
947744055 2:232498483-232498505 CATAGGAAGCTTGGTGATGCAGG - Intergenic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
1168881461 20:1209642-1209664 CAGAGGGAGCATGTGGATCATGG + Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1171457543 20:25280528-25280550 CAGAGGATGCTTGGGGCTGGGGG + Intronic
1172475271 20:35232553-35232575 CAGAGAATGCTTCAGGAAGAAGG + Intronic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173596936 20:44264538-44264560 AAGAGGAAGCTGGAGAACGAGGG + Exonic
1176112865 20:63418458-63418480 CCCAGGAAGCGTGAGGATGAAGG + Intronic
1177748452 21:25250770-25250792 CAGAGAAAACCTCAGGATGAAGG - Intergenic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180044981 21:45301159-45301181 CGGAGGAGGATGGAGGATGAGGG - Intergenic
1182037797 22:27213173-27213195 TAAAGGAACCTTGAGGAAGAAGG + Intergenic
1182291762 22:29285521-29285543 TAGAGGAAACTTCAGAATGAAGG - Intronic
1182555454 22:31126312-31126334 GAAAGGAAGCTTGAGGGTGAGGG + Intronic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1184278329 22:43423154-43423176 AAGAGGAAGCTGGAGGCTCAGGG + Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1185334825 22:50266780-50266802 CAGAGGCCGCTAGAGCATGATGG - Intronic
949194807 3:1291960-1291982 CAAAGGAATGTTGAGGCTGAAGG + Intronic
950477108 3:13221425-13221447 CTGAGGATGCTTGAGGTTGAAGG - Intergenic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
952876836 3:37952409-37952431 AATAGCAAGCATGAGGATGAAGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955763603 3:62316760-62316782 CACAAAAAGCTGGAGGATGATGG - Intergenic
956144259 3:66176381-66176403 CAGAGGAAGTGTGTGGATGGTGG + Intronic
956931261 3:74045947-74045969 CTGAGGAGGCTTCAGGAAGAAGG + Intergenic
958194609 3:90227954-90227976 AAGAGGAAGGGAGAGGATGATGG + Intergenic
958736664 3:98017003-98017025 AACAGGAAGCTTGAAGATAAGGG + Intronic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
958966325 3:100562859-100562881 CAGAGGAAGCTTCCAGAAGAAGG + Intronic
960508494 3:118521351-118521373 CATTGGAAGCTTGATGAGGATGG - Intergenic
960779192 3:121299310-121299332 CATAGAAACCTTGAGGATAAAGG + Intronic
961001252 3:123375526-123375548 CAGAGCAATCTGGAGAATGAGGG + Intronic
962838864 3:139215410-139215432 CAGAGGAAGCTGGAGTTAGAGGG + Intronic
963280832 3:143383623-143383645 CAGAGGAAGTTTGAGTTTCAGGG - Intronic
963488487 3:145967824-145967846 CAGAGGAAGCTTTAGGAGTTAGG - Intergenic
963517462 3:146326421-146326443 CAGAGGAGGAATGAGGATGAAGG + Intergenic
964116290 3:153139556-153139578 CAGGAGAAGCTTCAGGCTGAAGG - Intergenic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
964551392 3:157888724-157888746 CAGAGCAAACTTGATAATGAGGG - Intergenic
964876490 3:161373107-161373129 CAGAGGAAGCTAAAGGTAGATGG + Intergenic
965681883 3:171260183-171260205 AAGAGGAAACTTCAGGATTAAGG - Intronic
965855268 3:173080513-173080535 GAGAGGAAGGATGAGGATGACGG + Intronic
966002343 3:174965750-174965772 CAGAGGAAGTTAGAGAATGGTGG + Intronic
966555185 3:181251167-181251189 CAGAGGAATGGTGAGAATGAGGG - Intergenic
967989677 3:195121600-195121622 CAGAGGAGGTTTGGGGATGAGGG - Intronic
968968950 4:3783629-3783651 CGGAGGAAGCTGGAGGCTGAGGG - Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
970037965 4:11761215-11761237 AGGAGAAAGCTTGGGGATGATGG - Intergenic
970277157 4:14413489-14413511 CAGAGGATGATGGAGAATGAAGG + Intergenic
970652668 4:18195807-18195829 GAGAGGAAGCTACAGGAGGATGG - Intergenic
971041298 4:22755046-22755068 CAGAGGAAGAATGAGGTTGAAGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971718084 4:30206949-30206971 CAAAGGATGCTTGAGGATTCAGG - Intergenic
971885856 4:32446695-32446717 TAGAGGAAGCTGTAGGATGTGGG + Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
972945113 4:44244420-44244442 CAGAGGAGGCTTCAGAATCAAGG + Intronic
973112087 4:46409249-46409271 CAGTGGTAGCTTGATGAGGATGG - Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973541906 4:51943216-51943238 CAGAGCATGCTTGATCATGACGG + Intergenic
973606097 4:52589050-52589072 CAGAAGAACTTTGAGGATGGAGG + Intergenic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974047329 4:56908556-56908578 CAGAGGAAGTTTCAGGACTACGG - Intronic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
981646983 4:147009998-147010020 GAGAGGATGGTTGAGAATGATGG - Intergenic
982422182 4:155210427-155210449 GAGAGGAAGCATGAGATTGAAGG - Intronic
983367765 4:166816553-166816575 CAGAGGAAGCTTGTCCTTGAAGG - Intronic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986796215 5:11214877-11214899 AAGGGGAAGATTGAGGATGAAGG - Intronic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
988449419 5:31325945-31325967 GAGACGAAGCTGGAGAATGATGG - Exonic
988793424 5:34630303-34630325 CAAAGCAGGCTTTAGGATGAAGG + Intergenic
990138023 5:52670662-52670684 CAGAGGAAGTATGGGCATGAGGG + Intergenic
990156554 5:52884539-52884561 AAGAGGAACCTTTATGATGAAGG + Intronic
991037718 5:62144721-62144743 CATGGGGAGCTTCAGGATGAGGG + Intergenic
991947185 5:71910630-71910652 CTTAGGTAGCTTCAGGATGAGGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993705803 5:91168651-91168673 CAGATGAACCTTCAGGATAAAGG - Intergenic
995710426 5:115029901-115029923 CAGAGGTAGCTGGAAGCTGAAGG - Intergenic
997262342 5:132474862-132474884 CTGAGGATGCCTGAGGATGGGGG - Intronic
1001144519 5:169172029-169172051 CAGAGGAAGCTTTGGGAAGGAGG + Intronic
1001263678 5:170256104-170256126 CACAGGAAGATTGGGGATGAGGG + Intronic
1002033370 5:176447366-176447388 CAGAGGAAGATAGAGATTGAGGG + Intergenic
1002131245 5:177083013-177083035 AAGAGGAAGCTGGAGCATGACGG + Intergenic
1002449880 5:179312674-179312696 CAGAGGGAGATGGAGGATGTCGG + Intronic
1003094581 6:3132283-3132305 CAGAGAAAGCTTCAAGAAGAGGG - Intronic
1003385344 6:5662368-5662390 CAGAGGTGCCTTGAGAATGATGG - Intronic
1003785536 6:9482009-9482031 GAGAGGAAGCCCGAGGAAGATGG - Intergenic
1005849919 6:29813554-29813576 TAGAGGCAGCCTCAGGATGAGGG - Intergenic
1005854936 6:29853364-29853386 CAGAGGCAGCCTCAGGCTGAGGG - Intergenic
1006289250 6:33121921-33121943 AAAAGGGAGCTTGAGGTTGAAGG + Intergenic
1006723860 6:36181576-36181598 CATAGGTAGCTTCAGGATGGGGG - Intergenic
1008309235 6:49945029-49945051 CACAGGGAGCTTGAGGAAAAGGG - Intergenic
1010149985 6:72719948-72719970 CATAGAAAGGATGAGGATGAAGG - Intronic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1011773789 6:90705869-90705891 TGGAGGATGTTTGAGGATGAAGG - Intergenic
1011938452 6:92812313-92812335 CAGAGGAAACTTGTTGCTGAAGG + Intergenic
1012269171 6:97186945-97186967 AAGAGGCAGCTTCAGAATGAAGG + Intronic
1012648155 6:101715997-101716019 TGGAGGAAGCTATAGGATGAAGG - Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013276096 6:108586162-108586184 GAGATGAAGCCTGAGGGTGAAGG + Intronic
1013842329 6:114412279-114412301 CAGAGGAAATTTTAGGATAAAGG + Intergenic
1014679922 6:124415680-124415702 CCTAGGTAGCTTCAGGATGAAGG - Intronic
1015753967 6:136589428-136589450 CACAAGAAGCTTGGGGCTGAGGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017791670 6:157805211-157805233 CAGAGGGAGGGTCAGGATGAAGG - Intronic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019604104 7:1899892-1899914 CAGAGGAAGATGGAGGACGCGGG + Intronic
1020602896 7:10298175-10298197 CAGAAGAGGCTTGAGGCTCAGGG - Intergenic
1021061578 7:16118984-16119006 CAGAGGTTGTCTGAGGATGAGGG - Intronic
1021118105 7:16766576-16766598 AAGAGGAGGCTTGGGAATGAAGG - Intronic
1021470981 7:21002375-21002397 CAGAGGAAGCTTCAAAATGGCGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023996510 7:45162023-45162045 CAGGGGCAGCTTTAGGGTGAAGG + Intronic
1024200756 7:47103687-47103709 CATGGGGAGCATGAGGATGAGGG - Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1027823752 7:83084013-83084035 CAGAGGAAAGATGAAGATGAAGG + Intronic
1029054284 7:97724188-97724210 CTGAGGTCCCTTGAGGATGAAGG - Intergenic
1029213267 7:98926623-98926645 CCATGGAAGATTGAGGATGAGGG + Intronic
1029973041 7:104808115-104808137 CAGAGGAAGAGTGTGGCTGATGG - Intronic
1033446936 7:141431451-141431473 CAGAGGGAGGTTGATAATGAGGG - Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034926980 7:155130333-155130355 CTGAGGCAGCTGGAGCATGATGG - Intergenic
1035304876 7:157925525-157925547 CAAAGGAAGCTGGAGGGAGAGGG - Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036790617 8:11716436-11716458 TTGAGGAAGCTTGAGCATAAAGG - Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037342746 8:17863879-17863901 CAGAAGAAGCTATAGGATGGTGG + Intergenic
1037651271 8:20840844-20840866 CTGAGGAATGTTGAGCATGAAGG + Intergenic
1037832690 8:22198694-22198716 CAGAGGGGGCTTGAGGATGCAGG - Intronic
1039880920 8:41625188-41625210 CAGAGTAAGCCTCAGGCTGACGG - Intergenic
1039923012 8:41906430-41906452 GAGAGGAAGCTTGTTGCTGAAGG - Intergenic
1040625493 8:49144723-49144745 CACAGGAACTTTGGGGATGAAGG + Intergenic
1040693509 8:49968632-49968654 CAGATGTAGCTTCAGGATGCAGG + Intronic
1040694789 8:49983062-49983084 CAAAGGATGCTTCAGGAAGAGGG + Intronic
1041417115 8:57623093-57623115 CAGAGAAGGCTTTAGGATGTGGG - Intergenic
1041559033 8:59193444-59193466 CAGTGCAAGCTTGAGGGTGATGG - Intergenic
1041568989 8:59314412-59314434 GAGAGGAAGCCTGGGGAAGAGGG - Intergenic
1042661759 8:71162195-71162217 AACAGGGAGCTTGAGGCTGATGG - Intergenic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1043323651 8:79022601-79022623 TAGAGGAGCATTGAGGATGAAGG - Intergenic
1043609211 8:82041463-82041485 CAGAAGAAGCTTGAAGCTGGAGG + Intergenic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1047719257 8:127623883-127623905 CAGAGGAAGCCACAGGATGACGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048787312 8:138063791-138063813 AGGAGGAAGCCTGAGGATGGTGG + Intergenic
1049467923 8:142761619-142761641 CCCAGGGAGCTTCAGGATGAGGG + Intergenic
1049563936 8:143327687-143327709 CAGAGGGAGAATGAGGATGCCGG + Intronic
1050877490 9:10656903-10656925 CAGAGGAAGGGTGGGGATGAGGG + Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1052270039 9:26618203-26618225 CAGAGGAAGAATGTAGATGAAGG - Intergenic
1053606179 9:39662073-39662095 GAGGGAAAGCTTGAGTATGATGG - Intergenic
1053864101 9:42418698-42418720 GAGGGAAAGCTTGAGTATGATGG - Intergenic
1057063870 9:92029954-92029976 AGTAGGAAGCTTAAGGATGATGG - Intergenic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1057717109 9:97503352-97503374 AAAAGGAAACTTCAGGATGAGGG - Intronic
1058085575 9:100744698-100744720 CATCGGTAGCTTGATGATGATGG + Intergenic
1058265456 9:102893231-102893253 CCTAGGATGCTTGAGGCTGAAGG + Intergenic
1058383305 9:104403904-104403926 AAGAGGAAGATTGAGGAGAATGG - Intergenic
1058383455 9:104405826-104405848 AAGAGGAAGATTGAGGAGAATGG - Intergenic
1058700002 9:107592040-107592062 ATGAGGAAGGGTGAGGATGAGGG + Intergenic
1059163036 9:112053090-112053112 CAGAGGAAGCTGCACGGTGAGGG + Intronic
1059246624 9:112855049-112855071 CAGGGGAAGCTTGAGGACATAGG - Intronic
1059328880 9:113522716-113522738 TATAGGAAGCTGGAGGGTGATGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060752639 9:126183642-126183664 CAGAGAAAGCTTGCGAATGCTGG + Intergenic
1060781611 9:126417138-126417160 CAGAGAAAGCTTTAGGGAGAAGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061338476 9:129959818-129959840 CTGAGGAAGATGGAGGGTGACGG - Intronic
1185843818 X:3418386-3418408 GATAGGAAGCTTGAGCATGTTGG - Intergenic
1186493956 X:9997185-9997207 CAGAGAAGGCTTTAGGATGTGGG - Intergenic
1186536507 X:10355607-10355629 CAGAGGAGGCCTCAGTATGAAGG + Intergenic
1187960032 X:24559597-24559619 GAAAGGAAGCTTCAGAATGAGGG - Intronic
1188323480 X:28770355-28770377 CTGATGAAGCTTGAGCTTGAGGG - Intronic
1189007181 X:37008876-37008898 GAGAGGAAGCTGGAGGACGCAGG + Exonic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1190591523 X:52007493-52007515 CATAGGAACCTTCAGAATGAAGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191887489 X:65903715-65903737 CTGAGGAAACTTGGGAATGATGG - Intergenic
1192216750 X:69164661-69164683 CACTGGAACCTTGAGGATGGAGG + Intronic
1192835607 X:74795565-74795587 CAGAGGAATTTTGAGAGTGATGG + Intronic
1193166826 X:78290505-78290527 CATTGGTAGCTTGATGATGATGG + Intronic
1193254954 X:79337267-79337289 CAGGGGAAGCTTGAAGCAGAGGG - Intergenic
1197626424 X:128807419-128807441 CAGGGGAAGTTTGAGGACAAGGG + Intergenic
1197730257 X:129803790-129803812 CATAGGAAGCTTGAGGAAGAAGG + Exonic