ID: 950933765

View in Genome Browser
Species Human (GRCh38)
Location 3:16817835-16817857
Sequence TTGGAAATCAATAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950933765_950933768 19 Left 950933765 3:16817835-16817857 CCTTCTTCCTTATTGATTTCCAA 0: 1
1: 0
2: 7
3: 72
4: 445
Right 950933768 3:16817877-16817899 TTTAACTACATGAGATTTGTAGG 0: 1
1: 0
2: 1
3: 26
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950933765 Original CRISPR TTGGAAATCAATAAGGAAGA AGG (reversed) Intronic
900012260 1:125302-125324 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
900042319 1:481291-481313 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
900063760 1:716280-716302 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
901713013 1:11130497-11130519 TTGGTTGTTAATAAGGAAGAAGG + Intronic
902181035 1:14688520-14688542 TTAGAAATCTATCAGGAAGTGGG + Intronic
904402628 1:30266861-30266883 TTAGAAATAAATAAGGAGGCTGG - Intergenic
906308073 1:44733740-44733762 GTGGAAATGATTTAGGAAGAAGG + Intergenic
906597934 1:47096480-47096502 TTGGAAATCAAAAAGAAAAAAGG - Intronic
906959955 1:50414208-50414230 TTGGGAGTAAGTAAGGAAGAGGG - Intergenic
907931252 1:59002935-59002957 AAGGAAATCAATAAGCAAAAAGG - Intergenic
908884884 1:68777664-68777686 TTAGAACTTAATAAGTAAGAAGG + Intergenic
909027797 1:70503263-70503285 TTGGAAAACAAGAAGGATTAAGG + Intergenic
909990284 1:82215304-82215326 TAGCAAATGAATAAGGAAAATGG - Intergenic
910038761 1:82821809-82821831 GTGAAAATCTTTAAGGAAGAAGG + Intergenic
910260119 1:85285871-85285893 TTGGAAAGCAATAGAGACGATGG - Intergenic
910302819 1:85726673-85726695 TTGGAGATAGATAATGAAGATGG - Intergenic
910359729 1:86403742-86403764 TTGAAATACAATTAGGAAGAAGG - Intergenic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
911261951 1:95697072-95697094 TTGGAAATCAATAAAGTTGAGGG + Intergenic
912047711 1:105480827-105480849 TTGGCAAGAAAGAAGGAAGAAGG - Intergenic
912074701 1:105858777-105858799 TTGAAAGTCACAAAGGAAGAGGG - Intergenic
912300343 1:108509622-108509644 TTGAAATACAATTAGGAAGACGG + Intergenic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
913145562 1:115986467-115986489 TTGGAAATTAAGAAGGGAGACGG + Intronic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913446090 1:118952096-118952118 TGTGAAAACAATAAGGATGAAGG + Intronic
913583476 1:120250011-120250033 TTGTGAATCAAAAAGAAAGACGG - Intergenic
913624699 1:120648308-120648330 TTGTGAATCAAAAAGAAAGACGG + Intergenic
914214665 1:145614300-145614322 TTGTAAAACAATATGAAAGAGGG - Intronic
914466605 1:147934690-147934712 TTGTAAAACAATATGAAAGAGGG - Intronic
914565463 1:148861848-148861870 TTGTGAATCAAAAAGAAAGACGG - Intronic
914607362 1:149268401-149268423 TTGTGAATCAAAAAGAAAGACGG + Intergenic
915073349 1:153290169-153290191 TGGGCATTCAATAAGGAAAATGG + Intergenic
915105827 1:153534677-153534699 CTGAAAATAAATAGGGAAGATGG - Exonic
915147544 1:153803979-153804001 TTGGAAATAAATAACCAAAACGG + Intergenic
915256949 1:154640262-154640284 TTAGAAATCAATAATAAAAAAGG + Intergenic
916251279 1:162740803-162740825 TTGGAAAGCAATAAGCAAATGGG + Intronic
917793674 1:178516223-178516245 GGGGAAGTGAATAAGGAAGATGG - Intronic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918874176 1:190018064-190018086 TTGCAAATCAATGAGAAAAATGG + Intergenic
919084363 1:192903584-192903606 TTGTAAATCAATAAGGACAGAGG - Intergenic
919204305 1:194401087-194401109 TTAGAAACCTATAAGGAATATGG - Intergenic
920261504 1:204691168-204691190 TTGAAAACCAATAAAGCAGAAGG - Intergenic
921453103 1:215333558-215333580 TTAGAAAACAATACGGAAGTTGG + Intergenic
921628705 1:217407312-217407334 TTGAAAATCCACAAGGCAGAAGG - Intergenic
921659260 1:217779627-217779649 TTGGGAAAAAAAAAGGAAGAAGG - Intronic
922029961 1:221788331-221788353 TAGGAGATTAATAAAGAAGACGG + Intergenic
922074780 1:222232748-222232770 TGTGAAATAAATAATGAAGATGG + Intergenic
922254555 1:223882303-223882325 ATAGAAATGAATAAGGAAGCTGG + Intergenic
922260689 1:223941775-223941797 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
922716754 1:227879950-227879972 TTTGAAATCTCTAAAGAAGATGG + Intergenic
922736382 1:227983959-227983981 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
922956598 1:229607113-229607135 TTGAAAATAAATAAGTCAGAAGG - Intronic
923328473 1:232900910-232900932 TTGGAAAGCAAGAAGGAAGCAGG + Intergenic
923927795 1:238654348-238654370 TAGAAAATCAATATGGAATATGG + Intergenic
924341865 1:243043964-243043986 TTGGAAGTCAATCAGGAAGAGGG + Intergenic
924742627 1:246804477-246804499 TTGGTAATCTATAAGGAAAAAGG + Intergenic
1064013653 10:11756346-11756368 TTGGAAATCTATAAAAAAGGGGG + Intronic
1064090722 10:12381087-12381109 TTGGAAATAAAAAAGGAAGTAGG + Intronic
1064652284 10:17521677-17521699 TTGGATATGAATGAGGGAGAAGG - Intergenic
1064953186 10:20877629-20877651 TTGGAAAGGAAAAGGGAAGATGG - Intronic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1066284125 10:33947623-33947645 GTGGGAGTCACTAAGGAAGATGG - Intergenic
1066671062 10:37840006-37840028 ATAGAAACCAATAAGCAAGACGG + Intronic
1066734616 10:38461574-38461596 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
1066800752 10:39186664-39186686 TTGGAACTCAATGAGGAAAATGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068499873 10:57831114-57831136 AAGGAAATCAACAAGAAAGAGGG - Intergenic
1068503706 10:57871922-57871944 TTATGAATCAATAAGGAAGAAGG - Intergenic
1069091880 10:64209360-64209382 TTGGGAAACAGTAAGGAAAAAGG - Intergenic
1069104346 10:64364516-64364538 TTGGAAACCTAAAAGGAACAAGG - Intergenic
1069143156 10:64854018-64854040 TTGGAAAAAAATAAGGAATATGG - Intergenic
1070215462 10:74374876-74374898 TTGGAAAGCACCAAGGAATATGG - Intronic
1070391519 10:75974945-75974967 TTAAAAACCAATGAGGAAGATGG + Intronic
1070424424 10:76271573-76271595 TAGGAAAACAATAAACAAGATGG - Intronic
1070539673 10:77407038-77407060 TTGTAAAACAATAGGTAAGAGGG - Intronic
1072167585 10:92829116-92829138 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1074297950 10:112208575-112208597 TGGGAAATCAAAAACTAAGAAGG + Intronic
1074589270 10:114797316-114797338 TTTGAAATCAATCAGAAATAAGG - Intergenic
1074802714 10:117017595-117017617 TAGAAAATTAATGAGGAAGAAGG + Intronic
1075471789 10:122696547-122696569 TTGGCCATCAACAAGGAGGATGG - Intergenic
1076968592 11:117506-117528 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
1078184201 11:9037842-9037864 TGGGAACCCAATAAGGAAGAAGG - Intronic
1078611981 11:12828771-12828793 ATGCAAATCAATAAGAAACAAGG - Intronic
1078989358 11:16630905-16630927 ATGGAAAACAATAAAGAATAGGG - Intronic
1079350643 11:19689071-19689093 TTGGGAATCTAAAAGGAAGGAGG + Intronic
1079611380 11:22436537-22436559 TAGGAAAGCAATAAAGAAGCCGG - Intergenic
1079797615 11:24825824-24825846 TTTCTAATCAATAAGGAAAATGG - Intronic
1080573004 11:33574029-33574051 TTGTAAACTAATAAGGAAAAGGG + Intronic
1081010598 11:37806633-37806655 TAGGAAATCAATAGGGCAGAAGG - Intergenic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1084583985 11:70044544-70044566 ATGGAAATAAATAATGAAGAAGG + Intergenic
1085975226 11:81644902-81644924 ATGGAAAAAAATAAGGAAAAGGG + Intergenic
1086391336 11:86367193-86367215 TTGAACCTCAAAAAGGAAGAAGG - Intergenic
1086500074 11:87443803-87443825 TTTGCAATCAATCAGGGAGATGG - Intergenic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1086993742 11:93333315-93333337 ATAGAAATCATTAATGAAGATGG - Intronic
1087322198 11:96676754-96676776 TTGGAAAGGAAAAGGGAAGATGG + Intergenic
1087374917 11:97327702-97327724 CTGGCTTTCAATAAGGAAGAAGG - Intergenic
1087434960 11:98103257-98103279 TTAGAAATTAATAAAGGAGAAGG + Intergenic
1088099692 11:106142195-106142217 TTGGAAAACAGAAAGGGAGAAGG - Intergenic
1088482136 11:110304254-110304276 TTGGAAACTGATTAGGAAGATGG + Intergenic
1089084606 11:115806392-115806414 TTGGAAATAAATAAAGATGAAGG + Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1089935440 11:122359480-122359502 TGGGAAATCAATAGAGAAGATGG + Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1091422151 12:351042-351064 TAGGAAATCAAGGAGGAACAAGG + Intronic
1091471500 12:731984-732006 TTGGAAATCAATAATTCACAGGG + Intergenic
1091965882 12:4741248-4741270 TTGGAAATAAAAAAAGAGGAAGG - Intronic
1093089205 12:14902851-14902873 TAAGAAATGAATAAGGAATAGGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1093649932 12:21631487-21631509 TTGGAAGGCAATGAGGAAGGAGG + Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095106134 12:38235093-38235115 TCGAAAATGAGTAAGGAAGATGG - Intergenic
1095189544 12:39240790-39240812 TTGGAAAACAATAGAGATGATGG - Intergenic
1095244458 12:39902892-39902914 ATGCAACTCAATAAGGAATAAGG - Intronic
1097330229 12:58324982-58325004 GTGGGAATCAATTTGGAAGAGGG - Intergenic
1097681765 12:62656011-62656033 ATGGAAAACAAAAAGGAAGAGGG + Intronic
1097945540 12:65364045-65364067 TAGTAAATCAATAAGATAGAAGG - Intronic
1098885055 12:75952507-75952529 TTGGAAATAAAGAAAAAAGAGGG - Intergenic
1099086217 12:78249094-78249116 TTGGAAATCAAAAATGAATTTGG + Intergenic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1100347549 12:93747403-93747425 AGGGAAATGAATAAGGGAGAAGG - Intronic
1101204646 12:102474468-102474490 CTGGAGATCAGTAAGGGAGATGG - Intronic
1101531487 12:105577225-105577247 TCAGAAATCATTAAGGAAGAGGG - Intergenic
1101868916 12:108546161-108546183 TGGGAAATCAACAAGGAAGAGGG + Intronic
1101925955 12:108971544-108971566 TTTGCAAACAAGAAGGAAGAGGG - Intronic
1104296409 12:127518801-127518823 TGGGAAATCAACAAGGAAGAGGG - Intergenic
1105207052 13:18233751-18233773 CAGGACATCAATAACGAAGATGG + Intergenic
1106190223 13:27445907-27445929 TTGGGAATGAAAAGGGAAGAGGG + Intronic
1106350586 13:28926067-28926089 TTGGGATTAAATAAGGAAGAGGG - Intronic
1106486369 13:30176401-30176423 TTGGAGAGCATCAAGGAAGATGG - Intergenic
1107527364 13:41246387-41246409 TTAGAAATGCATTAGGAAGATGG - Intronic
1107714413 13:43185448-43185470 TTGGAAATCACTAAGAAGAAGGG - Intergenic
1107889848 13:44904595-44904617 TTGGTAATGAGTATGGAAGATGG - Intergenic
1107944592 13:45406623-45406645 TTGCAATTCAAGAAGGAAGTGGG - Intronic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109792354 13:67266778-67266800 ATGGAAATAAATAAGGTTGATGG - Intergenic
1109985896 13:69984399-69984421 TTGGCAATGAAAATGGAAGATGG - Intronic
1110382628 13:74871714-74871736 ATGTAAGTCAACAAGGAAGATGG - Intergenic
1110530515 13:76592128-76592150 TAGAAAATCAATAAGGCATAAGG + Intergenic
1110616414 13:77547047-77547069 TTAGATATCAGTAAGAAAGAAGG + Intronic
1110957997 13:81581004-81581026 TTGGGAACAAATAAGGGAGATGG + Intergenic
1111253067 13:85630237-85630259 TTGGAAATCAGAATAGAAGATGG - Intergenic
1111938727 13:94585858-94585880 TTGGAAATTAAATAGGAAGAGGG + Intronic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1112829787 13:103435117-103435139 TTTGAAATCAGTAGGGAAAAGGG - Intergenic
1113306977 13:109089616-109089638 TTCTAAATCAATATGGGAGATGG - Intronic
1113320764 13:109229954-109229976 TGGGTAATCTATAAAGAAGAGGG + Intergenic
1113391016 13:109897151-109897173 TTGCAAATAAATCAGAAAGAAGG + Intergenic
1114477347 14:23006145-23006167 TAAGAAATAAATAAGGAAAACGG + Intronic
1114537496 14:23432292-23432314 ATGGAAAGCAGAAAGGAAGAGGG + Intronic
1114576974 14:23724527-23724549 TTGAAAAACATTAAGGAAGCAGG + Intergenic
1115078694 14:29423098-29423120 TTGGGAATAAAAAAAGAAGATGG - Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1115652312 14:35411486-35411508 TTGGGAATCATTTAGGAAAAAGG + Intergenic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1116328048 14:43559059-43559081 TTCTAAATTAATAATGAAGATGG - Intergenic
1116342436 14:43741479-43741501 GTGGAAATCAGTAAGGCAGAAGG - Intergenic
1117203423 14:53415727-53415749 TTGGAAATCAAAAACAAAGCAGG - Intergenic
1117205314 14:53436614-53436636 TTGGAAATGAACAAGGAAGCTGG + Intergenic
1118042706 14:61934963-61934985 TTTGAAAATAAAAAGGAAGAAGG - Intergenic
1118800938 14:69188818-69188840 TTAGAAATCAATCATGAAGCTGG - Intergenic
1119121677 14:72085174-72085196 TAAGAAATCAATAAAGCAGAAGG + Intronic
1121293610 14:92797849-92797871 GTGGAAATCAGAAAGGAAAAAGG + Exonic
1121601327 14:95205928-95205950 ATGGAAAACAATAACCAAGATGG + Intronic
1121879974 14:97491231-97491253 TTGGAATTCAAAAAAGAAGAAGG - Intergenic
1122049761 14:99048301-99048323 CTGGAAATCAACAATGAACAAGG + Intergenic
1122736410 14:103846287-103846309 AAGGAAATCAAAGAGGAAGAAGG + Intronic
1123767908 15:23500208-23500230 TTGGAAAAAAATAAGAAAGCTGG + Intergenic
1123785964 15:23673806-23673828 TAGGGAATGAATAATGAAGATGG - Intergenic
1124138298 15:27054420-27054442 ATAGAAATAAACAAGGAAGAAGG + Intronic
1125345738 15:38716817-38716839 TTGGAAAACAATTAGAAAAATGG - Intergenic
1126042538 15:44606405-44606427 TTTGGAATCAAAAAGCAAGAGGG + Intronic
1126216098 15:46156812-46156834 TTGGAAAGAAAAAGGGAAGATGG + Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1126927954 15:53612113-53612135 TTGGAGATAAATAAGATAGATGG - Intronic
1127352861 15:58170282-58170304 TTGCAAAGCAATGAGGAAAAGGG - Intronic
1127366582 15:58296841-58296863 TTAGAAAGAAATAATGAAGATGG - Intronic
1128294868 15:66509874-66509896 TTAAAAATCAATGAGGAAGATGG + Intronic
1129113741 15:73353409-73353431 TTGGAGATCAATGATGAAGGTGG + Intronic
1130175720 15:81568270-81568292 GTGGAAATTAATTAGGAAAAGGG - Intergenic
1130415797 15:83693527-83693549 TTTGAAATCTCCAAGGAAGATGG + Intronic
1130865136 15:87927022-87927044 TTGGAAATGAATAAAAAATATGG + Intronic
1131390467 15:92043931-92043953 TTGGAAAGCAGAAAGGAAGCAGG - Intronic
1131598887 15:93827230-93827252 TGGGAAATCTTTAAAGAAGAGGG - Intergenic
1131621330 15:94071161-94071183 ATGGAAATAAATGAGGATGAAGG + Intergenic
1131772673 15:95756942-95756964 CTAGAAATCAATAAGAAAAAAGG + Intergenic
1132148264 15:99441385-99441407 TTGCAAATCAAAAAAGAAGCTGG - Intergenic
1133253495 16:4501160-4501182 TTGGAAAGAAAAAGGGAAGAGGG - Intronic
1133447417 16:5874035-5874057 ATGGAAATCAAAGAGTAAGATGG + Intergenic
1134771837 16:16815867-16815889 TTGGAAATCAATTAAGGGGAAGG - Intergenic
1137443312 16:48514306-48514328 TTAGAAACCACTTAGGAAGATGG + Intergenic
1138240110 16:55420739-55420761 TTGGAAAACAATATGCAACATGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142452086 16:90181614-90181636 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
1142771339 17:2099296-2099318 TTTGGACTCAATAAGGAATAGGG + Intronic
1142900722 17:3009787-3009809 TGGGAGATCAAGACGGAAGAGGG + Intronic
1144325937 17:14179931-14179953 TTTGAAATGAATGATGAAGATGG + Intronic
1144474810 17:15576819-15576841 TTTGAAATGAATGATGAAGATGG + Intronic
1146394186 17:32449666-32449688 TTAGAAAACAATAAGTAACATGG - Intronic
1146982790 17:37181597-37181619 GTTGAAATCAACAAGAAAGAAGG + Intronic
1148508818 17:48150576-48150598 TAGGAAATAAATAATGAAAATGG - Intronic
1149078390 17:52624547-52624569 ATGGAAATTAATAAAGTAGAAGG + Intergenic
1150696986 17:67414025-67414047 TTGGTATTCAATAAAGAAAAAGG - Intronic
1151080507 17:71324002-71324024 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1152047541 17:77947482-77947504 AGGAAAATCAAGAAGGAAGAGGG + Intergenic
1153061433 18:999103-999125 TTTGAAATAATTAAGGAAAAGGG - Intergenic
1153215029 18:2811543-2811565 ATGGAAAACAAAAAGTAAGATGG + Intergenic
1155237582 18:23836496-23836518 GTAGAAATGAAGAAGGAAGAAGG + Intronic
1156102022 18:33607639-33607661 TTGGAAGTCATTCAGAAAGAAGG + Exonic
1156567271 18:38206627-38206649 TTGTAAATCAATAATAAAAAAGG + Intergenic
1156672107 18:39482868-39482890 TTGGAACTCCAAAAGGAAAAAGG - Intergenic
1157145033 18:45153602-45153624 TTGGAAATGAATAACAAATAAGG - Intergenic
1157555044 18:48607979-48608001 TTGGAAATAAATCAGGACGAAGG - Intronic
1158066525 18:53416712-53416734 TAGTAAATAAATAAGGAAAAGGG - Intronic
1158129446 18:54136523-54136545 TGTGAAAACAATGAGGAAGAAGG + Intergenic
1159107959 18:64025600-64025622 TTGGGAAGGGATAAGGAAGAGGG + Intergenic
1159705747 18:71684490-71684512 TTAGAAATCAACCAGAAAGAAGG + Intergenic
1159888136 18:73928972-73928994 TTAGAAATAAATAAGATAGATGG + Intergenic
1160128008 18:76196497-76196519 TTTGAAATCATTTAGAAAGAAGG + Intergenic
1160486208 18:79295330-79295352 GAGGAAATCAATGAGTAAGATGG - Intronic
1160645400 19:187432-187454 TTAGAAGTCAATCAGGAAGAGGG + Intergenic
1163346915 19:16749199-16749221 TTGGATCTCTCTAAGGAAGACGG - Exonic
1164230870 19:23287096-23287118 TAGGAAAAAAAAAAGGAAGAAGG + Intergenic
1165587835 19:36935991-36936013 ATGGAAAACAAAAAGGAAAATGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166917479 19:46205359-46205381 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
927646730 2:24881993-24882015 TCAGGAATCAAAAAGGAAGAAGG - Intronic
928863349 2:35887228-35887250 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
928864292 2:35898894-35898916 TTAGAAATCAAAAAGCAAAAGGG - Intergenic
929200193 2:39227198-39227220 TGGGAAAACAACAGGGAAGATGG - Intronic
929246780 2:39710914-39710936 TGTGCAATCAATAAGGCAGAAGG - Intronic
930326107 2:49920603-49920625 TTGAAAAGCAGGAAGGAAGAGGG - Exonic
930353155 2:50283082-50283104 TTGACAATCAACAATGAAGAAGG - Intronic
931004844 2:57837309-57837331 TTAAAAATAAATAGGGAAGAAGG + Intergenic
931803171 2:65778431-65778453 TTGGAAAGCACTATGGGAGAAGG + Intergenic
931831277 2:66054049-66054071 TAGGAAATCAATGAGGCAGAAGG - Intergenic
931968263 2:67557458-67557480 TTTTAATTCAATAAGTAAGACGG + Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
932940952 2:76164557-76164579 TTGGAAAAAAAAAAGGAAAAAGG - Intergenic
936819890 2:116508020-116508042 ATGGAAATCAAAAAAGAACAGGG - Intergenic
936974651 2:118207048-118207070 GTAGACATCAGTAAGGAAGATGG + Intergenic
938471915 2:131572285-131572307 TTGGCAATAAAAAAGGAAAAAGG + Intergenic
939006261 2:136791111-136791133 TTGGAAAGAAAGAAGAAAGAGGG + Intronic
939141827 2:138363085-138363107 TTTGAAAGCAATTAGGAAGCAGG - Intergenic
939789483 2:146553753-146553775 TTCAAATTCAATAAGCAAGATGG - Intergenic
941036549 2:160575138-160575160 TTGACAAATAATAAGGAAGAGGG - Intergenic
941586962 2:167371678-167371700 TTGGAAACTGAAAAGGAAGATGG + Intergenic
943216306 2:185040861-185040883 TTGAAAGTCAATGAGGAAGAGGG + Intergenic
943812077 2:192199543-192199565 ATGGGAATCAATAAGGCATAGGG - Intergenic
944797488 2:203202967-203202989 TTGGAAAGCAATAGGGAATAAGG - Intronic
945254916 2:207795431-207795453 TTAGATGTCAAGAAGGAAGAGGG - Intergenic
945329999 2:208528640-208528662 CTGGAAATGATTAAGGAAGCAGG + Intronic
946085382 2:217165313-217165335 GTTGAAATCATTAAGAAAGATGG - Intergenic
946823464 2:223653507-223653529 TTGGAAATAAAGAAGAAAAATGG - Intergenic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
948963662 2:241359349-241359371 TTGGGAAGCAATCAGGAGGATGG - Intronic
949083514 2:242126166-242126188 TTAGAAGTCAATCGGGAAGAGGG - Intergenic
949083526 2:242126250-242126272 TTAGAAGTCAATCGGGAAGAGGG - Intergenic
1169541329 20:6603183-6603205 TTGGAAAATAAAAAGAAAGAAGG - Intergenic
1171102370 20:22397216-22397238 TTGGAAATCAGAAAGTAATAAGG + Intergenic
1172517947 20:35548660-35548682 TTGGAAGTCAATAAGGTATCAGG + Exonic
1173286204 20:41673498-41673520 TTGGCAAGCAAAAGGGAAGATGG - Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173544737 20:43886711-43886733 TTGAAAATCAATACAGAAAACGG - Intergenic
1175373347 20:58507784-58507806 TTACAAATCAATAAGAAAAATGG + Intronic
1176280108 20:64298791-64298813 TTGGAAGTCAATCAGGAAGAGGG - Intergenic
1178129809 21:29559498-29559520 TTGGAAATAAAGAAGCAAGAAGG + Intronic
1178693419 21:34769910-34769932 TTGGAAATCAATAACTAAAAGGG - Intergenic
1178937604 21:36876568-36876590 TTAGAAATCAATAACAAAAATGG - Intronic
1178982336 21:37275393-37275415 TTGCAAATCTATAAAGAACAGGG + Intergenic
1180003377 21:45005385-45005407 ATGGAAGTCAATACAGAAGACGG - Intergenic
1180209189 21:46284229-46284251 TTCAAAAGCAATAAGGAAGTAGG - Exonic
1181410702 22:22716521-22716543 CTGGATGTCAATGAGGAAGAAGG - Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1181780407 22:25188779-25188801 TGGGAAAACAATAAGGATGAAGG - Intronic
1181872006 22:25906990-25907012 TTGGAACTCAATAGCGTAGATGG - Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182411740 22:30192917-30192939 TTGGCAAACAATAATGAAGATGG - Intergenic
1183877279 22:40794517-40794539 CTGGAGATCATTAAAGAAGAAGG - Exonic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951365132 3:21771782-21771804 TTGAAAATAAATAACAAAGATGG + Intronic
952176280 3:30866741-30866763 GTGGAAAGCAACAAGGCAGAAGG - Intronic
952249506 3:31637680-31637702 GTGAAAGTCAACAAGGAAGAAGG - Intergenic
952764162 3:36940815-36940837 TTGAAAAACAAAAAGCAAGAAGG + Intronic
954336130 3:49918842-49918864 TTGGTAATGGATAAGGGAGAAGG - Intronic
955821700 3:62902665-62902687 ATGAAGATCAATAATGAAGAAGG - Intergenic
956044365 3:65179491-65179513 TAAGGAAACAATAAGGAAGAAGG - Intergenic
956601224 3:71024871-71024893 TTGCAAATCAAGAAAGAAGGGGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957563778 3:81859065-81859087 TTGAAAATTAAAAAGGAAAAGGG + Intergenic
957826028 3:85445534-85445556 TTGAAAAACAATAAGAAATATGG + Intronic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
959356930 3:105343761-105343783 AATGAAATCTATAAGGAAGATGG + Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
959869838 3:111313681-111313703 GTGGAAAACAGCAAGGAAGAGGG - Intronic
960429622 3:117552861-117552883 TTGGAGAACACTAAGAAAGAAGG - Intergenic
962117846 3:132530902-132530924 TTCCAAAGCAACAAGGAAGAAGG - Intronic
962658523 3:137575196-137575218 TTGGATATCAATATGCAAAAAGG - Intergenic
962899746 3:139750526-139750548 TTTGAAAGCAGTAAGAAAGAAGG - Intergenic
962931098 3:140037131-140037153 TTTGAAAACAATAATTAAGAAGG - Intronic
963764198 3:149316818-149316840 TTGGAAAGCTATAAGGAATAGGG - Intergenic
963839175 3:150087712-150087734 TTACAAATCAATAAGAAAAAGGG + Intergenic
964335180 3:155647083-155647105 TTGGAAATCAAAAAGGAAGGTGG - Intronic
965172191 3:165279955-165279977 TGGGCAAAAAATAAGGAAGAAGG - Intergenic
965319277 3:167231840-167231862 TTGGAATTCCATAAAGAAAATGG + Intergenic
965550341 3:169958595-169958617 TTGAAAATAAAAAAAGAAGATGG - Intergenic
965839187 3:172883700-172883722 TGAGAGATCAACAAGGAAGAAGG - Intergenic
967324362 3:188224549-188224571 TCGGTAATCTATAAGAAAGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967438992 3:189484852-189484874 TTAGAAATCAATAACAAAAAAGG + Intergenic
967534657 3:190588429-190588451 TGGAAAATGAATAATGAAGATGG - Intronic
967760038 3:193213543-193213565 TTCTAAAACAATCAGGAAGAGGG + Intergenic
968372283 3:198232094-198232116 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
969355137 4:6620710-6620732 TTGGAAAGAAGGAAGGAAGATGG + Intronic
969865244 4:10071828-10071850 TTGGAAATACATAAAGAAAATGG - Intergenic
970520761 4:16881503-16881525 TTAGAAATCCATAAAGATGAAGG - Intronic
970993223 4:22236752-22236774 TTGGAAAGCAGTGAGCAAGAAGG - Intergenic
971503905 4:27345735-27345757 TTGGAAATCAAGAGAGAAAATGG - Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
972027564 4:34404140-34404162 TTGGAAACTACTAAGGAACAGGG + Intergenic
972827924 4:42783005-42783027 TTTGAAATAAATAAGATAGACGG - Intergenic
975580293 4:75901213-75901235 CTAGAAATCAATAAGAAAAATGG + Intronic
976283937 4:83352770-83352792 TTGAAAATCATTAATTAAGATGG - Intergenic
976307971 4:83579909-83579931 TAGGAAATCAATGAGGAAAATGG - Intronic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976632485 4:87253284-87253306 TTTGAAATGAATAAAGGAGAAGG - Intergenic
976981010 4:91229197-91229219 TTCAAAATAAATTAGGAAGATGG + Intronic
977304662 4:95308137-95308159 TTCTAAATCACAAAGGAAGAAGG + Intronic
977531517 4:98206219-98206241 TTGCTAATCAATAAGAAAAAAGG + Intergenic
978008599 4:103651319-103651341 TTTGAAATGAAGACGGAAGAGGG - Intronic
978992943 4:115108995-115109017 TAGGAAAGCAAGAAGGAAGAAGG + Intronic
979260970 4:118644555-118644577 TTAGAACTCAATCAGGAAGAGGG - Intergenic
979341788 4:119533868-119533890 TTGGAACTCAATAACCAAGATGG - Intronic
979654313 4:123174495-123174517 TTTGAAATGTATCAGGAAGAGGG + Intronic
979858999 4:125670166-125670188 TTCTAAATCAAAAAGGATGAGGG + Intergenic
979933627 4:126664294-126664316 TTTGAAACCAATAAGAAATAAGG + Intergenic
980267578 4:130538207-130538229 TAGGCAATCAAAAAGGGAGAGGG - Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980701659 4:136440559-136440581 TTAGGAAGCAATAAAGAAGATGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
980927755 4:139155442-139155464 TCGGAAAACAATAATTAAGAAGG + Intronic
981250636 4:142596812-142596834 GTGGAAATCAATAAAGTAGAAGG + Intronic
981396067 4:144251328-144251350 TTGGAAATCAGTAAGGCACTAGG + Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982626637 4:157775518-157775540 TTGGAACTCATTAAGAGAGAAGG + Intergenic
982940167 4:161540553-161540575 ATAGAAATCAATAAGAAATAAGG - Intronic
983078013 4:163349371-163349393 TTGTAAATAAACAAGGTAGATGG + Intronic
983126879 4:163964029-163964051 TTGGCAATCAATAAGCCAAAGGG + Intronic
983150866 4:164278757-164278779 TTAGAAGTCAATCAGGAAGAGGG + Intronic
983748571 4:171233262-171233284 ATGGAATTCAATAACAAAGAGGG - Intergenic
983812443 4:172079932-172079954 TTAGAAATCATGAAGGAAAAAGG - Intronic
984447974 4:179861596-179861618 TTGCAAATCAAGGAGGAGGAAGG + Intergenic
984722346 4:182986602-182986624 TTGGAAATCAATAGCAAAAAAGG + Intergenic
984825295 4:183918957-183918979 TTGCAAATGAATAAGTAACATGG - Intronic
985284714 4:188323891-188323913 TTGGAATTATATAGGGAAGATGG + Intergenic
985992114 5:3571551-3571573 TTGGAAATCAATAATTATCAAGG + Intergenic
986440574 5:7777886-7777908 TTGAAAATCCATTAGGAAGGAGG + Intronic
986682631 5:10247897-10247919 TTAGAAGTCAATAAGCAAGCAGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987344338 5:16965658-16965680 TTAGAATTCCAAAAGGAAGAGGG - Intergenic
987451513 5:18089586-18089608 TTGGAAATCAAGAAAGAGAAAGG + Intergenic
987868536 5:23579025-23579047 TGGGAAATCTAAAAGGGAGAAGG + Intergenic
988624941 5:32864649-32864671 TTTGAAATCACACAGGAAGAGGG + Intergenic
988692618 5:33588014-33588036 TTGGAAATCAGTAAGCTGGAAGG - Intronic
989177097 5:38538763-38538785 TTGCAACTCACTATGGAAGATGG - Intronic
989237819 5:39169891-39169913 GTGGAAATCAAAAAGGAAAAAGG - Intronic
991475548 5:67015052-67015074 TTGGAAATCCATGAGGGAAAAGG + Intronic
993574781 5:89587396-89587418 TTGTAAATCAAAAGGGAAGAAGG - Intergenic
993671434 5:90765390-90765412 TTGGAAATCCATATGCATGATGG + Intronic
994182169 5:96779503-96779525 TTGGAAATGAAAAAGAATGAAGG - Intronic
994749176 5:103717504-103717526 TTGGAAAAAAAAAAGGGAGAGGG - Intergenic
996065607 5:119075669-119075691 TAGGAAATTAACAAGGAAAAAGG - Intronic
996324616 5:122258716-122258738 TTGGGAATAAATATGGAATAGGG - Intergenic
996460471 5:123734793-123734815 TTGGAAAGCCATAAGAAATAGGG + Intergenic
996656705 5:125947213-125947235 TTGGAAATCAATGAACAAGTAGG + Intergenic
997035849 5:130190309-130190331 TTTGAGATCAGAAAGGAAGAGGG - Intergenic
997124297 5:131210417-131210439 ATTGAATTCAAAAAGGAAGAAGG - Intergenic
997172386 5:131736223-131736245 TTGGTGATCAATAAGTAATAAGG - Intronic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
997906558 5:137822929-137822951 GTGCAAACCAAGAAGGAAGACGG - Intergenic
998030097 5:138859190-138859212 TTGGAAAACAAATAGGAATATGG - Intronic
998359253 5:141570859-141570881 TAGGAAGTCAAGAAAGAAGAGGG + Intronic
999657944 5:153828901-153828923 CTGGAAAACAATAAGCCAGAAGG - Intergenic
999908488 5:156169825-156169847 TTGGAACTCAATGAGTAAGGGGG + Intronic
1002731524 5:181337638-181337660 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
1002753013 6:136454-136476 TTGGAAGTCAATCAGGAAGAGGG + Intergenic
1003217543 6:4128492-4128514 TGGGAAAGAAATGAGGAAGAGGG + Intronic
1003457177 6:6293700-6293722 TTAGAAAGAAAGAAGGAAGAAGG + Intronic
1004236127 6:13875664-13875686 TTGTAAATCAATAAGGACATGGG + Intergenic
1004241908 6:13931270-13931292 TTGGAAATGAACAAGGACAAGGG + Intronic
1004789918 6:19013657-19013679 CTGGAAGTCAAAAAGGAGGAGGG + Intergenic
1005252156 6:23959607-23959629 TTGGAATACAATAATGAAGACGG + Intergenic
1005374487 6:25168553-25168575 TTGGAAATCAAAAAAGAGAAAGG - Intergenic
1005736424 6:28751933-28751955 TTAGAAATAAATGAGAAAGAAGG + Intergenic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007645872 6:43380610-43380632 TGGGAAATCTATAAAGAACAAGG + Intergenic
1008084086 6:47225626-47225648 TTTAAAATTAATAAGAAAGAAGG + Intergenic
1009550078 6:65079808-65079830 TTGGGAAACAATAAGGGAGGTGG - Intronic
1010612802 6:77975622-77975644 TAGAAAACCAATAAGGAAGATGG + Intergenic
1010720979 6:79283060-79283082 TAGGAAAGCAAGCAGGAAGATGG + Intergenic
1010904035 6:81463807-81463829 TTGGAAGCCAGTAAGGAATATGG - Intergenic
1011344951 6:86358848-86358870 TTGGAAATAGAGAAGGAAAAGGG + Intergenic
1012017840 6:93874494-93874516 TGGGAAATTAATAAGGAAAGAGG - Intergenic
1012159054 6:95859939-95859961 CTGGAAATAAATAATGATGAAGG - Intergenic
1012567164 6:100672170-100672192 TTTGAAATAAATAATAAAGAGGG - Intronic
1013439014 6:110142440-110142462 TTAGAAATCACCAAGGAATAAGG - Intronic
1013874462 6:114806325-114806347 TTGAAAATAAAAAAAGAAGAAGG - Intergenic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014495911 6:122122298-122122320 TGGGAAATCAACTAGGAATATGG - Intergenic
1014496196 6:122126405-122126427 TGGGAAATCAACTAGGAATATGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1016149265 6:140718575-140718597 TTCCAAATAAATAAGGAAGATGG - Intergenic
1017381893 6:153840813-153840835 TTGTAAATCAAAAATGAAAATGG - Intergenic
1018588471 6:165389244-165389266 TTGTAAATATATAAGCAAGATGG - Intronic
1018667423 6:166151310-166151332 TTGGAAAACAAATAGCAAGATGG - Intergenic
1019836659 7:3392538-3392560 TTGGAAATAAATAATGGTGATGG - Intronic
1019913404 7:4115452-4115474 TTTGACATCAATAAGCAAAATGG - Intronic
1020283167 7:6661583-6661605 TAGGAATTCAATAAGGAGGGAGG + Intergenic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020604985 7:10326029-10326051 TTGCAAATCAAGAAGTAAAATGG + Intergenic
1020978196 7:15033933-15033955 ATGGTAAGAAATAAGGAAGAAGG + Intergenic
1021301258 7:18975813-18975835 TTGGAAGTCAGTAAGGATGGTGG + Exonic
1022130645 7:27401579-27401601 TGGGAAAGCAATCAGAAAGATGG - Intergenic
1022304856 7:29137499-29137521 TTGGAAAGGAAAAGGGAAGACGG + Intronic
1023234408 7:38068673-38068695 TTGAGAATAAATAATGAAGAGGG - Intergenic
1024339629 7:48243961-48243983 TTGGGAATAAATACGGGAGAGGG - Intronic
1025724638 7:64045577-64045599 TGGGAGATCCATAGGGAAGAAGG + Intronic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1027533094 7:79360421-79360443 TAGAACATCAAAAAGGAAGAAGG + Intronic
1027924598 7:84445193-84445215 TTAGAAATCAATAATGAGGCCGG + Intronic
1028381057 7:90198795-90198817 AGGGAAATAAATAAGGAATATGG - Intronic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1028718014 7:93996314-93996336 ATGGAAAGCTATAAAGAAGAAGG + Exonic
1028882967 7:95900560-95900582 TTGGAAATCCATGTGGAAAATGG + Intronic
1029432505 7:100539972-100539994 GTGGAAAGCAAAAAGGAAAAAGG + Intronic
1031007784 7:116494425-116494447 TTAGAAATAAATGAGGAAGAAGG - Intronic
1031043079 7:116859153-116859175 TTGGAAATTAATTAAGAAAAGGG + Intronic
1031079691 7:117246479-117246501 TAGGAAAACAAGAAGAAAGAAGG - Intergenic
1032204314 7:129848426-129848448 CTGTAATTCAATAAGGAACAGGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1033104729 7:138510926-138510948 TTGGGAAGAAATAAGGTAGATGG - Intronic
1035511990 8:196639-196661 TTAGAAGTCAATCAGGAAGAGGG + Intronic
1037222418 8:16540245-16540267 GTGCAAATCATAAAGGAAGAAGG + Intronic
1038467282 8:27775496-27775518 TAGGAATTCAATAAAGAAAATGG + Exonic
1038510413 8:28129072-28129094 TGGGAAATAAATAATGTAGATGG + Intronic
1038811188 8:30846574-30846596 CCGGAAATAAATAAGGAAGATGG - Exonic
1038874303 8:31530914-31530936 ATGTAAATCTATTAGGAAGATGG - Intergenic
1039126050 8:34203195-34203217 TTGGAAATCAAGAAGAAACATGG + Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040584147 8:48724320-48724342 TTTGAAACAAATAATGAAGATGG - Exonic
1041165471 8:55088392-55088414 TTGGAACTTAATTAGGAAAAAGG + Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1042322051 8:67486366-67486388 TTGCAGATCAATAGGGAAAATGG + Intronic
1042388332 8:68203289-68203311 TTGGAAATAAATCAGGATGGAGG + Intronic
1042677814 8:71342017-71342039 TTGCAAAACAAAAAGGAACATGG - Intronic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1043708569 8:83383391-83383413 ATGGAAATCAATAAAGAGCAGGG + Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044932923 8:97267099-97267121 TTGGAAATCAAGTAGGGAAATGG - Intergenic
1046277293 8:111980718-111980740 TTGGAAAACAAGAACTAAGAAGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047470347 8:125165336-125165358 TTGGAAAACAATATGAAAGCTGG + Intronic
1047836092 8:128694544-128694566 TTAGAAATCAATAAGCAAACTGG - Intergenic
1048234952 8:132680777-132680799 ATGGAAATAAAGAAGGAAGGAGG - Intergenic
1048273623 8:133048978-133049000 TTGGAAATGGAAAAGAAAGAAGG - Intronic
1048662812 8:136625405-136625427 TAAGAAATAAATAAGGGAGATGG + Intergenic
1049864631 8:144926286-144926308 AAGGAAATCAACAAGGATGAGGG + Intergenic
1050713677 9:8495085-8495107 CTGGAAATAAATCAGGAATATGG - Intronic
1051449607 9:17180634-17180656 TGGAACATCAAGAAGGAAGAAGG - Intronic
1051713790 9:19960424-19960446 TTGGAAACCAATGAGGTGGAAGG + Intergenic
1051833537 9:21308885-21308907 TGGAAAATCAATAAGAAATATGG + Intergenic
1052511685 9:29429685-29429707 ATAGAAATCAATTAGTAAGATGG + Intergenic
1052712448 9:32073347-32073369 TAGTAAATCAATAATTAAGATGG - Intergenic
1055335887 9:75233121-75233143 TTAGAAATAAATAAGGAATGTGG + Intergenic
1055424611 9:76181370-76181392 TTGTGAAACAATAAGAAAGAAGG - Intronic
1057049964 9:91916112-91916134 CAGGAAAGCAACAAGGAAGAAGG + Intronic
1057157622 9:92857548-92857570 TTGGGCATCTATCAGGAAGAGGG + Intronic
1057301278 9:93885423-93885445 TTGGAAATAGATAATGATGATGG + Intergenic
1057465592 9:95311425-95311447 TTGGAAGTCACTAAGGTAAATGG + Intronic
1057967625 9:99519416-99519438 GGGGGAATCAAAAAGGAAGAAGG + Intergenic
1058239305 9:102536498-102536520 CTGGAAATCAACAATGAATAAGG - Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1060010410 9:120038765-120038787 TTAAAAATAAAAAAGGAAGAAGG + Intergenic
1060912878 9:127364530-127364552 TTGAAAATCAAGAAGGACCAAGG + Intronic
1061279821 9:129591160-129591182 ATGGAGATCAGTAAGGAATATGG + Intergenic
1061758437 9:132832863-132832885 GTGAAAATCTAAAAGGAAGAAGG + Intronic
1062301163 9:135871179-135871201 AAAGAAATAAATAAGGAAGATGG - Intronic
1062755929 9:138290148-138290170 TTAGAAGTCAATCAGGAAGAGGG - Intergenic
1185870598 X:3662005-3662027 TTGGAAACCAATAAAGAATGTGG - Intronic
1186440055 X:9578083-9578105 TGGGAGATCGATAAGGAAGTGGG + Intronic
1187264480 X:17718675-17718697 AAGGAAAGCAAAAAGGAAGAAGG + Intronic
1187877478 X:23816263-23816285 TGGGAAATAAATAAGGTAAATGG - Intergenic
1188243247 X:27813184-27813206 TTGGAGATCACTAAATAAGATGG - Intronic
1188410882 X:29870776-29870798 TTGGTATTCCATAAGCAAGAAGG + Intronic
1188575427 X:31644122-31644144 TTGGAATACAAAAAAGAAGATGG + Intronic
1190445434 X:50519331-50519353 TGGGAAATGAAAAAGGGAGAAGG - Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1191891572 X:65948260-65948282 ATGGAGATCAATAAGGCAGTGGG - Intergenic
1193201607 X:78697941-78697963 TAGGAAAACTAAAAGGAAGAGGG + Intergenic
1193202910 X:78713509-78713531 TTGGAATCCAATAAGCAAAAAGG + Intergenic
1193698076 X:84733888-84733910 TTGGAAATAAAAAAGTAAAATGG - Intergenic
1195040647 X:101010866-101010888 TTAAAATTCAGTAAGGAAGATGG - Intronic
1195113505 X:101670986-101671008 TTGGAAAGCAAAAAAGAAGAGGG - Intergenic
1195135135 X:101898648-101898670 TCCAAAATCAGTAAGGAAGAAGG - Intronic
1195864303 X:109412842-109412864 TGGGAAAATAATATGGAAGAGGG - Intronic
1198313800 X:135446526-135446548 TTGGGAATCACTGAAGAAGATGG - Intergenic
1199489618 X:148383897-148383919 TTCCAAAGCAATAAGGAACAAGG + Intergenic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200206301 X:154318824-154318846 TTGGAAATCAAGTAGAAAAAGGG - Intronic
1201050797 Y:9932697-9932719 CTGGAAAGCAATAGGCAAGATGG - Intergenic
1201532580 Y:15008501-15008523 TTGGCAAACAAAAGGGAAGATGG - Intergenic
1202167613 Y:22007984-22008006 CTGGAATACAATAAGGCAGAAGG + Intergenic
1202223747 Y:22578385-22578407 CTGGAATACAATAAGGCAGAAGG - Intergenic
1202319369 Y:23617276-23617298 CTGGAATACAATAAGGCAGAAGG + Intergenic
1202551400 Y:26052781-26052803 CTGGAATACAATAAGGCAGAAGG - Intergenic