ID: 950934755

View in Genome Browser
Species Human (GRCh38)
Location 3:16827367-16827389
Sequence TCAAAGCTTTGGAAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950934755 Original CRISPR TCAAAGCTTTGGAAGATGTA AGG (reversed) Intronic
904963869 1:34356511-34356533 TCAAAGTCTTAGAAGATCTATGG - Intergenic
907049012 1:51317236-51317258 CCAAAGCTTCAGAAGATGTTGGG - Intronic
907780224 1:57559885-57559907 TCAAGGATTTGAAAGATGCAGGG + Intronic
908668915 1:66523846-66523868 TCAAAGACTTGGAATATGGAGGG + Intergenic
908941705 1:69443097-69443119 TCAGAGATTTGAAAGATGCAAGG - Intergenic
909063590 1:70906260-70906282 TCAAAACTTTGAAAACTGTAAGG + Intronic
909974036 1:82024604-82024626 ACAAAGATTTGGAAGATGGAAGG - Intergenic
911098940 1:94078641-94078663 TCAAAGCCTGGGAAGAAGTAGGG - Exonic
911640549 1:100284206-100284228 CCAAAGATTTGGAATATGTATGG + Intronic
911935987 1:103972727-103972749 TTAAAGTTTTGGCAGATATAGGG + Intergenic
915599920 1:156915610-156915632 TCAGGGCTGTGAAAGATGTACGG - Exonic
916281889 1:163061019-163061041 TCAATGCTTTGGAAGCTGGTGGG + Intergenic
916999858 1:170345783-170345805 TCAGAGCCTTGCAAGATGCATGG - Intergenic
917831550 1:178895223-178895245 TTAAAGCTTTTGAAGATATGGGG + Intronic
921645822 1:217616451-217616473 TCCAAGCTCTTGAAGATATAAGG + Intronic
921983383 1:221283249-221283271 TAAAAGACTTGGAAGATTTATGG - Intergenic
924091509 1:240506725-240506747 TCAAACCTTAGGAAGGTGCATGG - Intronic
924209812 1:241753104-241753126 TCAAAGCTTTAAAAAATGGAAGG + Intronic
924824414 1:247524313-247524335 TCAAGGCTTTGGAAGAGGAAGGG - Intronic
1064468613 10:15612266-15612288 TCAAAGCTTTTGAGGGTGGAGGG - Intronic
1065103830 10:22359342-22359364 TTAAAGCTTTGTAAAATTTATGG + Intronic
1065460224 10:25953932-25953954 GCAAATCTTTGCAAGATGTTTGG - Intronic
1066450537 10:35524302-35524324 TCAATGCTTTTCAAGATGTTAGG + Intronic
1068393025 10:56423702-56423724 TCAAGGATTTGAAAGATGTAGGG + Intergenic
1070568955 10:77626486-77626508 GGAAAGATTTGGAAGATGAAAGG - Intronic
1071256807 10:83878657-83878679 TCAGAGCTGTGGCAGGTGTATGG - Intergenic
1071333036 10:84580033-84580055 TCAAAGCTTTGGCAGCTGTGAGG + Intergenic
1073050055 10:100661516-100661538 GCAAAGCATTGGATGATGTCGGG + Intergenic
1074337083 10:112588987-112589009 TCAAAGTGTTGAAATATGTAGGG - Intronic
1075126814 10:119707073-119707095 TCAAAGCTCTCAAAGCTGTATGG - Intergenic
1076298353 10:129404750-129404772 ACGAAGTTTTGGAAGATGTCTGG + Intergenic
1077435480 11:2536806-2536828 TCACAGCTCTGGACGATGGAGGG + Intronic
1078964594 11:16323548-16323570 TCAAAGTTAAGGAAGATATAGGG - Intronic
1080751206 11:35152048-35152070 GGAAAGCTTTTGAAGATGAAAGG + Intronic
1084632280 11:70361183-70361205 TTAAAGCTGTAGAAGATGAAAGG + Intronic
1086237917 11:84654341-84654363 TGAATGCTTTAGATGATGTAGGG - Intronic
1086946701 11:92850876-92850898 TCAAAGCTTTGGAACATGCAGGG - Intronic
1087765096 11:102142574-102142596 TCAAAGCTATGGAAAGTGTCTGG - Intronic
1091417004 12:296556-296578 TCACAACTCTGGAAGATGGAGGG - Intronic
1092650334 12:10627821-10627843 TCAAAGCTTTGAAAAATATAAGG + Intronic
1092929910 12:13306019-13306041 TCAGTGTTTTGGAAGATGAATGG - Intergenic
1094727589 12:33136973-33136995 TCAATGATTTGAAATATGTACGG + Intergenic
1096861343 12:54530783-54530805 TAAAAACTTTGGAAAATATATGG - Intronic
1097551787 12:61080648-61080670 TCAAAGCTTTAGAAAATGGAAGG + Intergenic
1097765518 12:63522247-63522269 TAACAGCTTTGCAAGATGGAGGG + Intergenic
1097782347 12:63722876-63722898 TTAAGCCTTTGGAAGCTGTAAGG - Intergenic
1098749736 12:74278612-74278634 TCAAAGACTTGAAAGATGCAGGG + Intergenic
1098898263 12:76086386-76086408 TCAAAGCTGTGCACGATGCAAGG + Intergenic
1098918297 12:76279538-76279560 TCAAAGTTCTGGCAGATGTGGGG - Intergenic
1099128938 12:78802432-78802454 TTAAAGCTATCTAAGATGTAAGG + Intergenic
1099472332 12:83066754-83066776 TCAAAATTTTGGAACATATATGG - Intronic
1099735665 12:86564075-86564097 TCAAAGACTTGAAAGATGCAGGG + Intronic
1101194102 12:102365072-102365094 TCATAGCTTTGGCAGAAGCAAGG - Intergenic
1101219212 12:102618899-102618921 GCAAAGCTCTGGATGAAGTAAGG - Intergenic
1103033916 12:117641066-117641088 TCACAGTTTTGAAAGCTGTAAGG + Intronic
1103974265 12:124691942-124691964 TCAAAGGTTTGGATTATGTGTGG - Intergenic
1106048823 13:26170952-26170974 TCAAAGTATTGGAAGACATAGGG + Intronic
1106781489 13:33062886-33062908 ACAAGGCTTAGGAATATGTATGG + Intronic
1107991914 13:45826273-45826295 TCAAAGCTTAGGATGATGCTTGG + Intronic
1108904168 13:55449000-55449022 TCAAAGACTTGAAAGATGCAGGG + Intergenic
1108959759 13:56210647-56210669 TGAAAGTTTTGGCAGATGTGTGG + Intergenic
1109641256 13:65194561-65194583 GCATAGCTTTGGAAAAAGTAAGG + Intergenic
1110138198 13:72095164-72095186 TCAAATCTTTGGAAAAGATATGG - Intergenic
1110581029 13:77126312-77126334 TCAAAGCAGTGGGAGAGGTATGG - Exonic
1110668410 13:78145698-78145720 TCAAAGCTCTTGGAGATCTAGGG - Intergenic
1113242457 13:108353624-108353646 TCAAAGATGGGGAAGATGTGGGG + Intergenic
1113920078 13:113902531-113902553 TCAAAGCATTGGATGCTGTCAGG + Intergenic
1116604440 14:46971539-46971561 TCAGAGGCTTGGAAGGTGTATGG + Intronic
1117756400 14:58978866-58978888 TCAAAGCTCTGGAAGACATGTGG + Intergenic
1121511580 14:94516689-94516711 TATAAGCTTTGGAAGATGTTGGG - Intronic
1124244082 15:28055569-28055591 CCTAAGCCTTGGAAAATGTAAGG - Intronic
1124915637 15:33969798-33969820 TCAAAGCTTTTGAGGTTTTAAGG - Intronic
1125157444 15:36604066-36604088 TAAAACCTTTGGAATATGTGGGG + Intronic
1125383367 15:39111597-39111619 ACTAAGATTTGGAAGCTGTAGGG - Intergenic
1127974915 15:63990137-63990159 TAAAGGCTTTGAAAGATCTATGG + Intronic
1128359953 15:66954999-66955021 TAAAAGCTGTTGAAGATGTTGGG + Intergenic
1129436460 15:75545077-75545099 TGTAAGCTTGGGAAGATGCAGGG + Intronic
1131062899 15:89415207-89415229 TCAAAGACTTGCAAGATGCAGGG - Intergenic
1131103226 15:89710774-89710796 TCACAACTTTGGAAGTTGTGAGG + Intronic
1131402995 15:92141554-92141576 TCAAAGCATTTGCAGATCTAGGG + Intronic
1132075163 15:98813669-98813691 TCAAAGTATTTTAAGATGTAGGG - Intronic
1134164441 16:11918844-11918866 TCAAAGCTTTGGAAAACCAATGG - Intergenic
1138117972 16:54375327-54375349 TCAGAGCTTTGGCAGTTTTATGG - Intergenic
1138373639 16:56547368-56547390 TCGAAGCTTTGAAAGACGTGGGG - Intergenic
1138703291 16:58887731-58887753 ACAAAGCTATGGTAGATGAATGG - Intergenic
1140597538 16:76434598-76434620 TCAAAGACTTGAAAGATGCAGGG - Intronic
1140811537 16:78583591-78583613 TCCCAGCTTGGGAAGATGAATGG - Intronic
1143152308 17:4815228-4815250 TAAATGCTTGGGAAGATGGATGG + Intronic
1146416074 17:32634490-32634512 TCAATGCATTAGGAGATGTAAGG + Intronic
1147505444 17:41012079-41012101 TTAAAGGGTTGTAAGATGTAAGG - Intronic
1149180795 17:53933566-53933588 TCAAAGCTTTGGTAGAGGTCTGG - Intergenic
1149381743 17:56101136-56101158 TCAAGACTCTGGAAGATCTAGGG - Intergenic
1149593916 17:57852152-57852174 TCAAAGGCTTGGAAGAGGAAGGG - Intergenic
1152437083 17:80283029-80283051 TAAAAGCTCTAGAAAATGTAGGG + Intronic
1152473881 17:80504970-80504992 TTTTTGCTTTGGAAGATGTAGGG + Intergenic
1203172746 17_GL000205v2_random:165176-165198 TCTAAACTTTTGAAAATGTAAGG + Intergenic
1153855242 18:9137831-9137853 TCAACGCTTTGGGATCTGTAAGG - Intronic
1155234438 18:23805342-23805364 TCAAAGACTTGAAAGATGCAGGG - Intronic
1155497178 18:26454238-26454260 TTATGGCTTTGGAAGAAGTAGGG - Intergenic
1156112072 18:33740311-33740333 ACACAGCTTTGGAATCTGTAAGG + Exonic
1157076938 18:44476668-44476690 TCAAAGCTCAGGAAGGTATAAGG + Intergenic
1158495521 18:57951823-57951845 TGAAAGCTTTGGACCATGTCTGG - Intergenic
1160929773 19:1564967-1564989 CCGAAGCTGTGGAAGACGTAAGG + Intronic
1162603119 19:11685208-11685230 TCAAACCTTTTGAAGATACATGG + Intergenic
1162612275 19:11766088-11766110 TCCAAGCTTTGGAATATGTTTGG + Intergenic
1164933660 19:32194886-32194908 TCCATGCTATGGAAGATGGAAGG - Intergenic
925382909 2:3439020-3439042 TGAAAGTTTTGGAAGATGCTTGG - Intronic
925625568 2:5839486-5839508 TCAGAGCTTTTGGAAATGTACGG + Intergenic
925670340 2:6304034-6304056 TCACAGCTCTGGAAGCTGGAAGG + Intergenic
927627609 2:24739000-24739022 ACAAAGGTCTGGAAGATGAAGGG - Intronic
929935794 2:46293911-46293933 ACAATGCATTGGAAGTTGTAAGG + Intronic
930401653 2:50896893-50896915 GCAATGATTTGAAAGATGTAAGG + Intronic
931535669 2:63272757-63272779 TCAAATATTTGGTAGATTTATGG - Intronic
933120289 2:78527681-78527703 TTCAAGCTTTTGAAGATGTTGGG + Intergenic
934954234 2:98603610-98603632 TCTTTGATTTGGAAGATGTATGG - Intronic
938387996 2:130881663-130881685 TGAATGCTTCGGGAGATGTAAGG + Intronic
938828541 2:135031414-135031436 TCAAAGCTTTGGAAGGAGTTAGG + Intronic
938880781 2:135584740-135584762 TCCAAGCTTTGGAAATTGTTAGG - Intronic
942717546 2:178910630-178910652 TGAAAGCTTGGGCAGATGTGGGG - Intronic
943446198 2:187990982-187991004 TTATATCTTTGGCAGATGTAGGG - Intergenic
943513804 2:188859509-188859531 TAAAAGCTTTAGAAGTTTTATGG - Intergenic
944513687 2:200490053-200490075 TGAAAGCTTTGGGAGATGAACGG + Exonic
945933609 2:215881054-215881076 TGGAAGCTTTGGAGGTTGTAAGG + Intergenic
946539684 2:220670568-220670590 TCAAATCTTTGGAAGCAGAACGG + Intergenic
946866683 2:224047171-224047193 TCTAAGAGTTGGAAGAGGTAGGG - Intergenic
947443410 2:230142938-230142960 TGTAAGATTTGGAAGATGGAAGG - Intergenic
947778819 2:232738828-232738850 TTAAGGCTTTGGATGATATATGG + Intronic
1169590729 20:7138898-7138920 TGAAAGCTTTGTTGGATGTAAGG + Intergenic
1170587762 20:17748061-17748083 TGAAAACTTTGGAAAATATAGGG + Intergenic
1174003827 20:47394577-47394599 TTAAATCATTGTAAGATGTATGG - Intergenic
1175516134 20:59571456-59571478 TCAATGCTCTGGAAGATGCACGG - Intergenic
1176289386 21:5036111-5036133 TGAAAGCATTAGAAGATGTGTGG + Intronic
1176328738 21:5526959-5526981 TCTAAACTTTTGAAAATGTAAGG + Intergenic
1176399019 21:6293992-6294014 TCTAAACTTTTGAAAATGTAAGG - Intergenic
1176438138 21:6695112-6695134 TCTAAACTTTTGAAAATGTAAGG + Intergenic
1176462400 21:7022182-7022204 TCTAAACTTTTGAAAATGTAAGG + Intergenic
1176485961 21:7403960-7403982 TCTAAACTTTTGAAAATGTAAGG + Intergenic
1177115540 21:17081914-17081936 TCAAAACTTTGGAGGACATAAGG - Intergenic
1177719801 21:24891425-24891447 TAAAACATTTGGCAGATGTATGG + Intergenic
1177933817 21:27317898-27317920 TCAAGGACTTGGAAGATGCAGGG - Intergenic
1178004091 21:28196883-28196905 TCTAGATTTTGGAAGATGTATGG - Intergenic
1178200116 21:30394011-30394033 ACAGAGCTTTGGAAAATGTCAGG - Intronic
1179867845 21:44227476-44227498 TGAAAGCATTAGAAGATGTGTGG - Intronic
1180802465 22:18638284-18638306 TCATAGCCTCGGAAGATGAAGGG + Intergenic
1180853699 22:19033839-19033861 TCATAGCCTCGGAAGATGAAGGG + Intergenic
1180919514 22:19513875-19513897 ACAAAGCTATGGAAAATGTAAGG - Intronic
1181219258 22:21356977-21356999 TCATAGCCTCGGAAGATGAAGGG - Intergenic
1182131716 22:27857873-27857895 CCAAAGCTTAGGAAGAAATAAGG + Intronic
1182585919 22:31344347-31344369 CCACAGCTCTGGCAGATGTAAGG + Exonic
1183760324 22:39810585-39810607 TCAAAGATTTCAAAGTTGTAGGG + Intronic
1183880967 22:40828825-40828847 TCAAAGCTTTGGGATAAGTAGGG - Intronic
950934755 3:16827367-16827389 TCAAAGCTTTGGAAGATGTAAGG - Intronic
952577714 3:34794867-34794889 TCTTTGCTTTGGAATATGTAGGG - Intergenic
953461118 3:43081822-43081844 TCAAAGGTTTGGAAAGTGTTTGG + Intronic
953942109 3:47109136-47109158 GCAAAGCTATGGAAGGTTTAGGG + Intronic
954511610 3:51130628-51130650 TCAAGGACTTGAAAGATGTACGG - Intronic
956089733 3:65653179-65653201 TGAAAGATATGGAAGATGGAGGG - Intronic
956363561 3:68474484-68474506 CAAAAGCTTTGGAAGTTGTCTGG + Intronic
957204714 3:77181372-77181394 ACACAGCTTTGGAATATATATGG - Intronic
957264675 3:77947750-77947772 TCCATGCTGTTGAAGATGTATGG + Intergenic
957304543 3:78440892-78440914 CCAAAGCTGTGGTAGGTGTATGG + Intergenic
957495110 3:80982312-80982334 TCCAAGCTTGGGAAGCTGTGGGG + Intergenic
957590690 3:82193911-82193933 TCACAGTTTTGCAGGATGTACGG + Intergenic
959842250 3:110991071-110991093 GCAAAGACTTGGAAGAGGTAAGG + Intergenic
962014867 3:131429419-131429441 TAAAAGCTTTGCAAGGTGGACGG + Intergenic
962027521 3:131564239-131564261 TGAAAGCTTTGGTAGCTGTGGGG - Exonic
962136400 3:132738874-132738896 TAAAAGCTTTGGAAAATCTCAGG - Intergenic
962396513 3:135019214-135019236 TCAGGCCTTTGGAAGAGGTAGGG - Intronic
962575793 3:136753566-136753588 TCAAGGGTTTGCAAGATGTGTGG + Intergenic
963382113 3:144543611-144543633 GCAAGGCTTTGGCAGATGTGTGG + Intergenic
964108405 3:153063654-153063676 TCAAGGCTTTGTAAAATGTCAGG + Intergenic
964412516 3:156413561-156413583 GCAAAGCCTTGGGAAATGTATGG - Intronic
965912689 3:173799744-173799766 TCACAGTTTTGAAAAATGTATGG + Intronic
966616919 3:181923266-181923288 TGAAAGCTTTGGAAATTGTAGGG + Intergenic
966671424 3:182530552-182530574 TCAGGGCATTGGTAGATGTATGG - Intergenic
968169446 3:196498066-196498088 TCAAAAGTTGGTAAGATGTACGG + Intronic
968917472 4:3502881-3502903 GCAAAGCTGTTGAAGATGTGAGG + Intergenic
968932818 4:3591253-3591275 TCACAGCTATGAGAGATGTAGGG - Intergenic
970481008 4:16474557-16474579 TCAAAGCTTTAGCAGAAGCAGGG + Intergenic
970623918 4:17856483-17856505 TCAAAGTTTTGGAGGCTGGAAGG - Intronic
971150464 4:24026024-24026046 TCAAAGGTTTTAAAGATGTAGGG - Intergenic
974146870 4:57959694-57959716 TCAAGGCCTTTCAAGATGTATGG + Intergenic
974262496 4:59543246-59543268 TCAAGGCCTTGAAAGATGCAGGG - Intergenic
974786323 4:66623169-66623191 TCAAAGACCTGAAAGATGTAGGG + Intergenic
975024361 4:69530655-69530677 TCAAGGATTTGCAAGATGCAGGG + Intergenic
975466581 4:74716061-74716083 TGACAGCTTTTGAAGATGTTTGG - Intergenic
977430649 4:96927255-96927277 TCAAGGACTTGGAAGATGGAGGG + Intergenic
977465875 4:97382421-97382443 TCAAAGACTTGAAAGATGCAGGG + Intronic
979365681 4:119820145-119820167 TCAAAGCAATGAAAGATGGAAGG + Intergenic
981349163 4:143709055-143709077 TTAAAACTTTGGGAGATGTTGGG - Intergenic
983395221 4:167185522-167185544 GCAGAGCTTTGGATGATTTAGGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
986770917 5:10972831-10972853 TCAAACTTTTGAAAGATGTATGG - Exonic
986990656 5:13549116-13549138 ACAAACATTTGGAAGATGTCTGG - Intergenic
987967567 5:24895370-24895392 TCAAGGACTTGAAAGATGTAGGG + Intergenic
990041030 5:51378934-51378956 TGAAAGCTTTGCCAAATGTACGG + Intergenic
990857624 5:60287750-60287772 TCAAAGTTTTAGAAGTTTTAGGG - Intronic
991180146 5:63741281-63741303 TCTAAGCTTTGGAAGTTACAAGG - Intergenic
992434589 5:76743223-76743245 TCAAAGGTTATGAACATGTAAGG - Intergenic
995604896 5:113843122-113843144 TCAATACTTTGGAAAAGGTAAGG - Intergenic
995890349 5:116944205-116944227 TCAATGCTCTGGAAGAGGAAAGG - Intergenic
996193049 5:120568932-120568954 TCAAAGCTTTGAGAGATGGCTGG - Intronic
997370263 5:133355235-133355257 TCAAAACTTGGGAAGCTGTCTGG - Intronic
1000004544 5:157170836-157170858 CCAATGCTTTGGAAGATTTGAGG - Intronic
1000561172 5:162791249-162791271 TTAAAAGTTTGGAAGATGGATGG + Intergenic
1001098291 5:168793393-168793415 TCAATGGTTTGGGAGAGGTAGGG - Intronic
1001776961 5:174336347-174336369 CCAAAGCTGGGGAAGGTGTATGG - Intergenic
1001838676 5:174854355-174854377 TCAAGGACTTGAAAGATGTAAGG + Intergenic
1002204893 5:177555584-177555606 TCAAAGATTTGAAAGACGCAGGG + Intergenic
1004519505 6:16348364-16348386 TCAAAGCTTAGAAAGTTGAATGG - Intronic
1008000536 6:46355561-46355583 TCAAAGCATTTTAAGCTGTAGGG - Intronic
1008562910 6:52739607-52739629 TGAAAGCTTTAGAAGAAGCAAGG - Intergenic
1009362461 6:62831433-62831455 TCAAGGATTTGGAATATGAAAGG - Intergenic
1010051387 6:71508265-71508287 TCAAAGCATAGGAAAAAGTATGG + Intergenic
1012246182 6:96928384-96928406 TGAAAGCTGTGGAAGAACTATGG + Intronic
1012376164 6:98564017-98564039 TCAAAGACTTGAAAGAGGTAGGG - Intergenic
1013160162 6:107535576-107535598 TCAGAGCTTTGGGATATATAAGG - Intronic
1013925012 6:115461783-115461805 TCATGGCTTTTGGAGATGTAAGG - Intergenic
1014445860 6:121526601-121526623 TCTAAGCTTTGGCAGATATGAGG + Intergenic
1017484033 6:154886212-154886234 TCAAGGCTTTTGAAGATGGTAGG + Intronic
1019003010 6:168771116-168771138 TCAAGGTTTTGAAAGATGCAGGG + Intergenic
1020339409 7:7093534-7093556 TCAAAGCATTAGAGGATTTATGG - Intergenic
1022889474 7:34681800-34681822 TCTCAGCTTTGAAAGATTTAGGG - Intronic
1022940945 7:35238976-35238998 TTAAGCCTTTGGAAGCTGTAAGG - Intronic
1024140234 7:46455706-46455728 TCAAAGCTGTGGACAATGTTAGG - Intergenic
1025965759 7:66269242-66269264 TCATAGCTTTGGAAAATGAATGG - Intronic
1027542009 7:79478403-79478425 TCAAAGATGTAGAGGATGTAGGG + Intergenic
1028996303 7:97104301-97104323 GGAAAGCTTTGGAAGATGGTGGG + Intergenic
1030174295 7:106635066-106635088 ACAAAGGTTGGGAAAATGTAAGG - Intergenic
1031333360 7:120495101-120495123 TCAAATCTTTAAAAGATGTAAGG + Intronic
1031731087 7:125301430-125301452 TCTAATCTTTGGAATATATATGG + Intergenic
1031784039 7:126006207-126006229 TCAAAGATCTGAAAGATGCATGG - Intergenic
1034114341 7:148570411-148570433 TTAAAGCTTTGTAATATGTTTGG - Intergenic
1036150150 8:6289503-6289525 TAAAAACTTTGAAAAATGTATGG + Intergenic
1037131567 8:15413097-15413119 TTAAGGCTTTTGAAGATGTTGGG - Intergenic
1037618333 8:20541444-20541466 ACAAAGATTTGGAATAGGTAAGG + Intergenic
1040008932 8:42644731-42644753 TTAAAGTTTTTGAAGATGTGTGG + Intergenic
1042289261 8:67151073-67151095 TCAAAGCCTTGAAAGATGCAGGG - Intronic
1042382012 8:68127534-68127556 CCAAAGCTTTGGAGAAGGTAGGG - Intronic
1042669493 8:71246250-71246272 GCAAACCTTTGGAATAAGTATGG + Intronic
1042739974 8:72032195-72032217 TTAAAGCTTTTGAAGAGGCATGG + Intronic
1042755643 8:72207542-72207564 TTAAAGCTTTTGAAGAGGCATGG + Intergenic
1044484963 8:92741574-92741596 TAAAAGCTTTAACAGATGTATGG + Intergenic
1046376631 8:113390870-113390892 TCTAAGGTTTTCAAGATGTAGGG - Intronic
1046553286 8:115743999-115744021 GCAAAGCATTGGAACAGGTAGGG + Intronic
1047460619 8:125061076-125061098 TACAAGCTTTGGAAGAGGTAAGG - Exonic
1047564891 8:126033479-126033501 TCAAAGACTTGGAAGATGCAGGG - Intergenic
1048319437 8:133386904-133386926 TCATTGCTTTGGAAGAGGGAGGG - Intergenic
1048644658 8:136406452-136406474 ACAAATATTTGGAAGATGTTTGG + Intergenic
1048782020 8:138012535-138012557 TCAAATCATTGGAAGATTTGGGG - Intergenic
1050589866 9:7149819-7149841 TTAAAGGTATGGAAGATGTAGGG - Intergenic
1051326547 9:15977538-15977560 TCAAAGCTTTATATGTTGTAGGG - Intronic
1051804847 9:20981038-20981060 GAAAAGCTCTGGAAGATGAAAGG - Intronic
1052879974 9:33595810-33595832 TGTAGACTTTGGAAGATGTATGG + Intergenic
1052926309 9:34019570-34019592 ACAAAGGTTCGGAAGATGGACGG + Intronic
1053495999 9:38548410-38548432 TGTAGACTTTGGAAGATGTATGG - Intronic
1055150377 9:72990986-72991008 TAAAACCTTTGGCAAATGTAAGG - Intronic
1055163768 9:73165463-73165485 TAAAAGATTTGGAATATGTGTGG + Intronic
1056586108 9:87928221-87928243 TGTAGACTTTGGAAGATGTATGG - Intergenic
1056610774 9:88124722-88124744 TGTAGACTTTGGAAGATGTATGG + Intergenic
1057675927 9:97135928-97135950 TGTAGACTTTGGAAGATGTATGG - Intergenic
1058906072 9:109483657-109483679 TGAGAGCTTTGGGAGACGTATGG - Intronic
1062175038 9:135156949-135156971 TGAAAGCCTTGGAAGAGGAACGG - Intergenic
1203433370 Un_GL000195v1:113503-113525 TCTAAACTTTTGAAAATGTAAGG - Intergenic
1187533567 X:20117326-20117348 TCAAAGCGTGTGTAGATGTAGGG + Intergenic
1187750316 X:22456424-22456446 TGAAACCTTTTGAAAATGTAAGG + Intergenic
1188340118 X:28989339-28989361 TCAAAGTTTAGGATGATTTAAGG - Intronic
1188559061 X:31447123-31447145 TCAATGTTTTGGAGGATGAAGGG + Intronic
1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG + Intronic
1190321227 X:49180455-49180477 TGACAGCTTTGGAAGAGGGATGG - Intronic
1191095857 X:56672395-56672417 TCAAGGACTTGGAAGATGCAGGG - Intergenic
1191832830 X:65433284-65433306 TCAAAGACTTGAAAGATGCAGGG - Intronic
1193226711 X:78992348-78992370 TCAAGGACTTGAAAGATGTAGGG - Intergenic
1193447041 X:81617810-81617832 TCAAAGACTTGAAAGATGCAGGG + Intergenic
1195007878 X:100704566-100704588 TCATAGCAATAGAAGATGTAAGG + Intronic
1196553644 X:117060978-117061000 TGAAAACTTTGGAAGAGCTAGGG - Intergenic
1197927509 X:131662460-131662482 TCAAAAATTTAAAAGATGTAAGG + Intergenic
1198614052 X:138434619-138434641 TAGAAGCTTTGAGAGATGTAGGG + Intergenic
1199157916 X:144572066-144572088 TCTAGATTTTGGAAGATGTATGG + Intergenic
1199370492 X:147042354-147042376 CCAAGGTTTTGGAAGATGAAAGG + Intergenic
1201632792 Y:16087996-16088018 TCACAGTTTTGGAAGCTGGAAGG + Intergenic