ID: 950935599

View in Genome Browser
Species Human (GRCh38)
Location 3:16835780-16835802
Sequence AACAGCCGTGTGAGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950935599_950935608 30 Left 950935599 3:16835780-16835802 CCACCAGGCCTCACACGGCTGTT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 950935608 3:16835833-16835855 AAAGTATGTGACACAAAGTGTGG 0: 1
1: 0
2: 0
3: 18
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950935599 Original CRISPR AACAGCCGTGTGAGGCCTGG TGG (reversed) Intronic
900081105 1:858399-858421 AACAGCTGTGTGTGGCTTGAAGG + Intergenic
900186339 1:1334886-1334908 CACAGCAGTGGGAGGCCAGGTGG + Exonic
901089932 1:6634469-6634491 AACAGCTGTGGGTGGGCTGGAGG + Exonic
902229218 1:15016824-15016846 AAGACCTGTGTGAGGCCTGAAGG - Intronic
902768140 1:18630494-18630516 AGCAGCCGTGGGCGACCTGGGGG + Intergenic
907081064 1:51622595-51622617 AACAGCCATGTGAGTCATCGTGG - Intronic
907461363 1:54607583-54607605 GACAGCCCTGTGTGGGCTGGAGG + Intronic
909330089 1:74399559-74399581 AACAGCTGGGTGGGGCCGGGGGG + Intronic
910684350 1:89901178-89901200 AGCAGCCGTGAAAGGCCTGCAGG - Intronic
911040506 1:93587586-93587608 GACAGCTGTGTGCTGCCTGGAGG - Intronic
911584458 1:99674497-99674519 ATAAGCAGTGTGAGGTCTGGTGG - Intronic
919814139 1:201427129-201427151 AACATTAGTGTGAGGCCTCGAGG - Intronic
920054045 1:203180100-203180122 AACAGAGATGTGAGGCCTGCTGG + Intronic
922785355 1:228279826-228279848 AACGGCCGTGTGAGGACTACGGG - Exonic
1062872127 10:914507-914529 AAAAGTCGAGTGAGGCGTGGTGG + Intronic
1062975569 10:1680042-1680064 AACAGGCTGGGGAGGCCTGGGGG - Intronic
1063670516 10:8096086-8096108 AGCAGCCGTCGGTGGCCTGGTGG + Intergenic
1064687929 10:17883804-17883826 AGCTGCCATGGGAGGCCTGGAGG + Intronic
1067202046 10:44181461-44181483 AAAAGAGATGTGAGGCCTGGTGG - Intergenic
1067729024 10:48795770-48795792 AACAGAGATGTGAGGCTTGGTGG + Intronic
1069827742 10:71264664-71264686 TAGAGCCGTGTGTGGACTGGCGG + Intronic
1071565276 10:86668384-86668406 ATTAGCCGTGTGAGTCATGGTGG + Intergenic
1074690850 10:116002905-116002927 AACAGCCATGTGAGGGTTGAAGG + Intergenic
1075344645 10:121673300-121673322 GACAGCAGTCTGAGGCCTGTGGG - Intergenic
1076450500 10:130554042-130554064 AACACCAGTCTGTGGCCTGGGGG + Intergenic
1077393560 11:2310557-2310579 ATCATCTGTGTCAGGCCTGGTGG + Intronic
1077410351 11:2400942-2400964 AGCATCCTTGTGAGGCCCGGAGG + Intronic
1081666082 11:44917936-44917958 AACAGCCTTGTGAGCCCAGAGGG - Intronic
1083756286 11:64793405-64793427 AACAGCCCTGTGGGGCCAGGGGG + Intronic
1083778609 11:64906649-64906671 CACCGAGGTGTGAGGCCTGGGGG - Exonic
1085510729 11:77086796-77086818 AAGAGGCTGGTGAGGCCTGGCGG + Intronic
1089211653 11:116808046-116808068 GACAGAAGTGTGAGGCATGGCGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1092144315 12:6203967-6203989 AACAGCAGTGTGGGGCTGGGAGG + Intronic
1092155767 12:6280699-6280721 AGCAGCCATGTGGAGCCTGGAGG - Intergenic
1096177891 12:49535102-49535124 AGCTGCCGTGGGAGGCCTGTGGG - Intergenic
1097083266 12:56448935-56448957 AAAACCGGTGTGTGGCCTGGCGG - Intronic
1102650661 12:114439990-114440012 AAGAGCCAGGTGGGGCCTGGAGG - Intergenic
1103278518 12:119734247-119734269 AGCGGCAGTGGGAGGCCTGGAGG - Exonic
1103327689 12:120132374-120132396 AACAGCCCTGTGAGGCAGGGAGG + Intronic
1104202886 12:126609120-126609142 AAAAACAGTGTGAGGCCTGCTGG - Intergenic
1108180849 13:47838344-47838366 AACAGCAGTTGGAGGCGTGGAGG + Intergenic
1112379232 13:98872914-98872936 AGCAGCCATGTGAGGCATGGAGG - Intronic
1119350838 14:73964036-73964058 AAAAGCTGTGTGACTCCTGGCGG + Exonic
1122123400 14:99566562-99566584 AACAGGCATTTGAGACCTGGGGG - Intronic
1122203028 14:100133980-100134002 AGGAGCTTTGTGAGGCCTGGGGG - Intronic
1122969253 14:105145842-105145864 GACCACCCTGTGAGGCCTGGGGG - Exonic
1202894725 14_GL000194v1_random:400-422 AACAACCCTGTGAGACCTGCAGG + Intergenic
1124247867 15:28086018-28086040 AGCATCCCTGTGAGGACTGGGGG - Intronic
1126663825 15:51057466-51057488 AACAGCCCTGTGAGGCAGGCAGG + Exonic
1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG + Intergenic
1129697239 15:77747633-77747655 GACAGCAGCGTGAGCCCTGGGGG + Intronic
1129766413 15:78172037-78172059 AACATCCGTGTGTGGCCAGTGGG - Intronic
1131508298 15:93034957-93034979 AGCAGCCCTGGAAGGCCTGGAGG + Intergenic
1132298768 15:100763735-100763757 AAGAGCCCAGTGAGGCCTGCAGG - Intergenic
1132547871 16:541457-541479 AGGGGCCGTGTGGGGCCTGGTGG + Intronic
1133191929 16:4140152-4140174 AACATCAGTGTGAGGTGTGGAGG + Intergenic
1139228635 16:65258518-65258540 AACACCCCAGTGAGGCCTAGAGG - Intergenic
1142212693 16:88816019-88816041 GACACGCGTGTGAAGCCTGGGGG - Intronic
1142224514 16:88871098-88871120 CACAGCCATGTGCAGCCTGGTGG - Intergenic
1144279236 17:13708108-13708130 AACAGCCTTGTGGGCCTTGGGGG + Intergenic
1146392967 17:32439926-32439948 ATCAGCTGGGTGAGGCATGGTGG + Intergenic
1147325523 17:39667847-39667869 AACGGACGAGAGAGGCCTGGAGG + Intergenic
1147338848 17:39742201-39742223 AACCGCCGTGTGAGGTCAGGAGG + Intronic
1147423153 17:40332407-40332429 AGCAGCCGTGAGAGGGGTGGTGG - Intronic
1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG + Intronic
1153924055 18:9817542-9817564 AACAGGCGTGTGTGGCCAAGAGG + Intronic
1154499805 18:14990307-14990329 AACAACCCTGTGAGACCTGCAGG + Intergenic
1156533166 18:37837568-37837590 AACAGCCAGGTGAGGCCTGGAGG + Intergenic
1157664062 18:49470339-49470361 AACAGCAGGGTGAGGCTTGCGGG - Intergenic
1158241499 18:55383743-55383765 AAGGGCAGTGTCAGGCCTGGCGG + Intronic
1158561137 18:58514852-58514874 AGCAGCCGTGTGAGCCCTCATGG + Intronic
1160215073 18:76921475-76921497 AGCAGTTGTGTGTGGCCTGGAGG + Intronic
1160438318 18:78868139-78868161 AATTGCCGTGTAAGGCCTCGAGG + Intergenic
924978078 2:196104-196126 AACACCTGGGTGAGGCATGGAGG + Intergenic
925116158 2:1379701-1379723 AACAGCCGTGTCCTGCCAGGAGG - Intronic
925355198 2:3236135-3236157 AACAACCCTGTGAGGCAGGGAGG + Intronic
925837468 2:7960026-7960048 AGCAGCCGGGGGAGGCCTTGGGG + Intergenic
926697294 2:15779826-15779848 AACAGCAGTAGGATGCCTGGTGG + Intergenic
930281908 2:49379375-49379397 AAAAGCCATGTGGGACCTGGAGG + Intergenic
932300486 2:70663575-70663597 AACATCCGTGTCAGCACTGGTGG + Exonic
932404431 2:71503992-71504014 TTCCGCCCTGTGAGGCCTGGGGG + Intronic
937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG + Intergenic
938493476 2:131778003-131778025 AACAACCCTGTGAGACCTGCAGG - Intergenic
938499013 2:131820662-131820684 AACAACCCTGTGAGACCTGCAGG + Intergenic
940711064 2:157164427-157164449 ACCAGCCGAGTGAAGCCTGCTGG - Intergenic
942372868 2:175304766-175304788 AACAGCCTTTTGATGCCTGAAGG + Intergenic
945986650 2:216359944-216359966 AACAGAGGTGTGGGCCCTGGAGG - Intronic
946369606 2:219272645-219272667 AAGAGCCCGGTGAGGCCAGGAGG + Intronic
948045442 2:234940229-234940251 AACAGACGTAGGAGGGCTGGTGG + Intergenic
1170374890 20:15689651-15689673 AGCAGGCGAGTGAGCCCTGGGGG + Intronic
1170590424 20:17767239-17767261 ACCAGCTCTGTGAGCCCTGGGGG - Intergenic
1170949475 20:20923890-20923912 TACAGCCCTGTGAGACCTAGGGG + Intergenic
1171501224 20:25594782-25594804 CACAGCCGTCTGAGGGCTGCTGG - Intergenic
1172770706 20:37380993-37381015 AACACCCGTGTCAGGACTGCTGG - Intronic
1173550756 20:43931627-43931649 AAGAGCAGTGGGAGTCCTGGAGG + Intronic
1174806572 20:53608705-53608727 ACCCGCTGTGTGAGGGCTGGGGG - Intronic
1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG + Intergenic
1176614424 21:9016387-9016409 AACAACCCTGTGAGACCTGCAGG + Intergenic
1176710776 21:10147483-10147505 AACAACCCTGTGAGACCTGCAGG - Intergenic
1179561466 21:42218805-42218827 CACAGCCGCTTGAGGCTTGGAGG + Intronic
1179735763 21:43391016-43391038 AATGGCCTTGTGAGGACTGGAGG - Intergenic
1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG + Intronic
1183925893 22:41205601-41205623 AACAGCCGTCCCTGGCCTGGGGG + Intronic
1185147245 22:49145309-49145331 AACAGCCCTGTGAGGCTGGGAGG - Intergenic
949833886 3:8246849-8246871 AACATCATTGTAAGGCCTGGTGG - Intergenic
950631843 3:14287185-14287207 ACCAGCAGTTTGAGACCTGGAGG + Intergenic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
952414273 3:33076244-33076266 AAACTGCGTGTGAGGCCTGGGGG + Intronic
953901722 3:46847300-46847322 GACAGCCCTGTGAGCCCAGGCGG - Intergenic
957685771 3:83502214-83502236 ACCAGCAGTGGGGGGCCTGGAGG + Intergenic
968656344 4:1779974-1779996 AAGAGTCCTGTGAGGGCTGGTGG + Intergenic
968729862 4:2264604-2264626 AGCAGCCAGGAGAGGCCTGGAGG + Intergenic
979692397 4:123573931-123573953 GACAGCCTTTTGAGGACTGGAGG - Intergenic
985723371 5:1502284-1502306 AACTGCTGAGTGAGGCCTGCGGG - Intronic
986653429 5:9987782-9987804 ACTAGTCGTGTGAGGCTTGGGGG - Intergenic
986708420 5:10470429-10470451 GACAGGAGTGTGAGGCCAGGTGG - Intronic
987501160 5:18710822-18710844 TTCAGCCTGGTGAGGCCTGGAGG + Intergenic
990325889 5:54674950-54674972 AACAGCCGGGTGAGGCCTGAAGG + Intergenic
998914237 5:146996853-146996875 TCCAGGAGTGTGAGGCCTGGTGG - Intronic
1000218952 5:159193012-159193034 AACAGAGGTGTGGGGGCTGGTGG + Intronic
1000337710 5:160253910-160253932 CACAGCCAGGTAAGGCCTGGTGG - Intronic
1001054982 5:168441863-168441885 AACATCCGGGTGCGGCCTTGTGG - Intronic
1001580811 5:172797013-172797035 AGCAGCAGTGGGAGACCTGGAGG - Intergenic
1002068135 5:176662727-176662749 AACAGCCTTGGCAGGGCTGGGGG - Intergenic
1016796706 6:148125581-148125603 AAAAGGCCTGAGAGGCCTGGGGG + Intergenic
1019496464 7:1342692-1342714 AGCAGCTGTGTGTGGCATGGGGG + Intergenic
1019611883 7:1940932-1940954 AAGAGGAGGGTGAGGCCTGGGGG - Intronic
1022498564 7:30868397-30868419 AAAAGCCTTGTAAGGCCAGGAGG - Intronic
1029493712 7:100885933-100885955 AACATCCGTGTGAGTGCTGGGGG + Exonic
1033410772 7:141115417-141115439 AAAAGCCGGGTGGGGCCTAGGGG + Intronic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1034816720 7:154178319-154178341 AAAAGAGGTGTGGGGCCTGGAGG - Intronic
1035442074 7:158910281-158910303 ATCGGCCGTGTCAGGCCTGTGGG + Intronic
1035442140 7:158910588-158910610 ATCAGCTGTGTCAGGCCTGTGGG + Intronic
1035524164 8:299061-299083 AACAGCTGTGTGTGGCTTGAAGG - Intergenic
1037376770 8:18238628-18238650 ATCAGCCTTGTGAGGCTTTGGGG - Intergenic
1038447468 8:27614045-27614067 ATCAGAGGTCTGAGGCCTGGTGG + Intronic
1040816641 8:51515043-51515065 AACAGCAGCGTGAAGCCAGGAGG + Intronic
1047037118 8:120952211-120952233 AAAAGACTTGTGAGGCTTGGAGG + Intergenic
1047422101 8:124715771-124715793 AAAAGCCTTGTGTGGCCTAGTGG + Intronic
1049731833 8:144182143-144182165 ATCAACCGGGTGAGGCCTAGTGG + Intronic
1053647759 9:40133179-40133201 AACAACCCTGTGAGACCTGCAGG - Intergenic
1054328735 9:63731130-63731152 AACAACCCTGTGAGACCTGCAGG - Intergenic
1054536821 9:66242991-66243013 AACAACCCTGTGAGACCTGCAGG + Intergenic
1055169806 9:73242374-73242396 TACAGGCATGTGAGGCCTGGAGG - Intergenic
1056029820 9:82541624-82541646 AACAGCCTTTTGAGGGATGGGGG - Intergenic
1057438012 9:95059902-95059924 AACAGCAGGGCCAGGCCTGGTGG - Intronic
1061338816 9:129962215-129962237 TCCAGCCCTGTGAGGCCTGGGGG + Intronic
1061359146 9:130130084-130130106 AGAAGCTGTGTCAGGCCTGGTGG - Intronic
1202795536 9_KI270719v1_random:116471-116493 AACAACCCTGTGAGACCTGCAGG - Intergenic
1186497342 X:10022110-10022132 AACAGCATGGTGAGGCCTCGTGG - Intronic
1191634183 X:63358548-63358570 AACAGGTGTGTCAGGCATGGTGG + Intergenic
1196886603 X:120251460-120251482 AACAGCAGAGTGAGGGCGGGAGG - Intronic