ID: 950935690

View in Genome Browser
Species Human (GRCh38)
Location 3:16836635-16836657
Sequence TGGCCTTTTCCCTGATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950935690 Original CRISPR TGGCCTTTTCCCTGATTTCA GGG (reversed) Intronic
900163778 1:1236700-1236722 GGGCCTGCTCCCTGGTTTCAGGG + Intergenic
904305773 1:29588211-29588233 TTGCCTTGTTCCTGATTTTAGGG - Intergenic
904361735 1:29978984-29979006 TTGTCTTTTTCCTGATTTTAGGG + Intergenic
905961711 1:42048410-42048432 TCAGCTTTTCCCTGATTTTAGGG + Intergenic
906777630 1:48543990-48544012 TGGCCCATTTCCTGATTTGAAGG + Intronic
908804014 1:67910883-67910905 TGGCCTTTTTACTGTATTCATGG + Intergenic
911302315 1:96190311-96190333 TAGCTTTTTGCCTGACTTCATGG - Intergenic
912842921 1:113054593-113054615 TGATTCTTTCCCTGATTTCAGGG - Intergenic
913026243 1:114844320-114844342 TGCCCTTTTCCCATATATCATGG + Intergenic
913379179 1:118189576-118189598 TGGCCTTTTCCATTATTCTAGGG + Intergenic
915164977 1:153943313-153943335 TGGCCTTTGGCCTTATTTCATGG + Intronic
916081828 1:161238255-161238277 AGGCCTTTGCCCTGAGTCCAGGG - Intronic
916427338 1:164693268-164693290 TGGCCTTTGCCTGGTTTTCAGGG + Intronic
916966536 1:169950480-169950502 GGACCATTTCCCTGATTTAAAGG + Intronic
917432125 1:174981152-174981174 TTGCCTTTTGCATTATTTCAAGG - Intronic
917539193 1:175897274-175897296 AGGCCCTTTCCCTGATCTCTAGG + Intergenic
918891088 1:190269541-190269563 TTTCCTTTTCCTTGATTTCTAGG - Intronic
919018936 1:192078040-192078062 TGGCCTTTTCCCTGATTTCTGGG - Intergenic
919269982 1:195328264-195328286 TGACCTTTTACCTCATTTCACGG - Intergenic
919458129 1:197844340-197844362 TTGCCTTGTCACGGATTTCAAGG + Intergenic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920383510 1:205550027-205550049 TGGCATGTTCCTTGAATTCAGGG - Intergenic
921435018 1:215108571-215108593 TGGCCTTGGCAATGATTTCATGG - Intronic
922181474 1:223237415-223237437 TTGCCTTGTCCCTGATCTTACGG + Intronic
924153720 1:241154492-241154514 TGGCCTTTTCTTTCATTTCAGGG - Intronic
1062879751 10:968433-968455 TTGACTTTTCCCTCATTCCACGG + Intergenic
1065142081 10:22727821-22727843 GGGCCATTTCCCTGTGTTCAGGG + Intergenic
1065320858 10:24508416-24508438 TGGCCTTGCTCCTGATTTTATGG - Intronic
1065479223 10:26175982-26176004 AGTCTTTTACCCTGATTTCAGGG - Intronic
1065691965 10:28343553-28343575 TTGCCTTGTGCCTGTTTTCAAGG + Intergenic
1065905231 10:30245128-30245150 AGCCCTGCTCCCTGATTTCAGGG + Intergenic
1066133496 10:32418185-32418207 CTGCCTTCTGCCTGATTTCAAGG - Intergenic
1067226814 10:44382138-44382160 TGGCTTTTTCCTGGTTTTCAGGG - Intronic
1067258895 10:44668245-44668267 TGGGCTTTTCTCTGAGTTGAGGG - Intergenic
1068147451 10:53089212-53089234 TGGCATTTTCCCTGTGTTCTGGG + Intergenic
1068560683 10:58511982-58512004 AGGGCTTTTCTCTGTTTTCAAGG - Intergenic
1069243139 10:66167135-66167157 TGTCCCTTTCTCTTATTTCATGG - Intronic
1069727889 10:70592958-70592980 TGGCCTTCTCACTGATCTCAGGG - Intergenic
1071460682 10:85891594-85891616 TGGTCCTTTCCCTGGATTCAGGG - Intronic
1073555573 10:104447637-104447659 AGGCATTTTCCCTGTTTTGACGG + Intronic
1073921964 10:108469733-108469755 TGTCTTTTTCCCTTATATCAGGG + Intergenic
1074586347 10:114770705-114770727 TGGCCAAGTCCCTGATTTCAAGG - Intergenic
1075340539 10:121644094-121644116 TGTCCTTTCCCCTTCTTTCAAGG - Intergenic
1076053724 10:127354647-127354669 TTTTCTTTTCCCTGATTTCCAGG + Exonic
1077149561 11:1064444-1064466 TGGTCTTGTTCCTGATTTCAGGG - Intergenic
1077908464 11:6553420-6553442 TTGCCTTTTAACTGATTTTAGGG - Intronic
1078644063 11:13122410-13122432 TGGTCTTGTTCCTGATCTCAGGG + Intergenic
1078960953 11:16269985-16270007 TGGCCTTGTTCCTGATCTTAAGG + Intronic
1079373547 11:19872151-19872173 TGGCCTTATTCATAATTTCAGGG + Intronic
1079775078 11:24515071-24515093 TTACCATTTCCCCGATTTCAGGG + Intronic
1082791655 11:57349943-57349965 CAGCCCTTTCCCAGATTTCAGGG + Intronic
1082988145 11:59185419-59185441 TGGCCTGTTCCCTGATATGGAGG - Intronic
1083680366 11:64348907-64348929 TGGCCTTTTCCCTGTAGCCAAGG + Intronic
1086043666 11:82508169-82508191 TGGCTTTGTTCCAGATTTCAGGG + Intergenic
1086266978 11:85011960-85011982 ACTCATTTTCCCTGATTTCAAGG + Intronic
1086320667 11:85643864-85643886 TTGCATTTTCCCTGATCTTAGGG - Intergenic
1088288602 11:108212132-108212154 TTACCTTTTCCCTGATCTTATGG - Intronic
1088531490 11:110815534-110815556 TGGCCAGGTCCCTGCTTTCATGG + Intergenic
1088932128 11:114363023-114363045 TGGCCTCTGCCCTGGTTTCCTGG + Intergenic
1091392913 12:136815-136837 AGGCCTTGTCCCTTATTTAAAGG + Intronic
1091968448 12:4765170-4765192 TGGCCTTCTCCCTGGATTCAAGG + Intronic
1092521807 12:9283714-9283736 TGGCGTTTGCCCTGATTCCCGGG + Intergenic
1092545476 12:9448142-9448164 TGGCGTTTGCCCTGATTCCCGGG - Intergenic
1094507477 12:31073909-31073931 TGGCGTTTGCCCTGATTCCCGGG + Exonic
1095932802 12:47645989-47646011 TGGCCTTGTACCTGATCTTAGGG - Intergenic
1096642422 12:53005248-53005270 TGGGCTTTTACCTCATTTAATGG - Intergenic
1098125235 12:67284843-67284865 TTGCCTTGTCCCTGACTTTAGGG - Intronic
1099963746 12:89422570-89422592 TGGCCTATTCTCTGATTAGAAGG + Intronic
1102435991 12:112923992-112924014 TGGTCTTTCCAGTGATTTCAGGG + Intronic
1103485435 12:121279702-121279724 TGGCCTCTGCCTGGATTTCATGG - Intronic
1104336969 12:127907861-127907883 TTGTCTTGTCCTTGATTTCATGG - Intergenic
1104713468 12:131002076-131002098 TGACCTCTTTCATGATTTCAAGG + Intronic
1105260374 13:18774682-18774704 AGGCCTTTTCCCTGTTATCTTGG + Intergenic
1105456329 13:20544500-20544522 TGGACTTCTCCCTGATGTCCTGG - Intergenic
1107931862 13:45313696-45313718 AGCCCTTGTCCCTGCTTTCATGG + Intergenic
1108039751 13:46329129-46329151 TGACATTTCCCCTGAATTCATGG + Intergenic
1108816502 13:54298220-54298242 TGTCCTTTGCCCTTATTTAATGG - Intergenic
1110266736 13:73546552-73546574 TGGCATATTCACTGACTTCATGG - Intergenic
1111229953 13:85331470-85331492 TGGCATTTTCCTTCATTTCCTGG - Intergenic
1112402583 13:99088251-99088273 TGGGCCATTCCCTCATTTCACGG - Intergenic
1113960543 13:114123434-114123456 TGGCCTTTTCCCTGCTTTGAGGG - Intronic
1114256142 14:21002818-21002840 TGGCCTTCTCACTGATCTCTGGG - Intergenic
1115081358 14:29454790-29454812 ATGCCTTTTCCTTTATTTCATGG - Intergenic
1115487919 14:33930306-33930328 AGGCCTTTTCACTGATTCAATGG + Intronic
1115683688 14:35770344-35770366 TTGCATTATTCCTGATTTCAGGG - Intronic
1116361412 14:44003306-44003328 TTGCCTTTTTCCTGAAGTCAGGG + Intergenic
1116878566 14:50140626-50140648 TGGCTTTTTCCTTGATTTAAAGG - Intronic
1117013984 14:51499665-51499687 TTTGCTTTTCTCTGATTTCATGG - Intronic
1117481253 14:56147637-56147659 GGGTATTTTCCCAGATTTCATGG - Intronic
1118099891 14:62585877-62585899 TTGCCTTGTACCTGATTTTATGG + Intergenic
1118750550 14:68804938-68804960 TGACCTTGTTCCTGATTTTAGGG + Intergenic
1120300683 14:82702428-82702450 TTGCCTTTTGCCAGTTTTCAAGG + Intergenic
1121785032 14:96651692-96651714 TCGCCTTGTTCCTGATTTTAGGG + Intergenic
1122340413 14:101024521-101024543 TGGCCTCTTCACTGACCTCACGG + Intergenic
1122704379 14:103610926-103610948 TGGCATTTTCCCTGTGTTCATGG - Intronic
1122987579 14:105219612-105219634 AGTCGTCTTCCCTGATTTCATGG - Intronic
1124384939 15:29199305-29199327 TGGCTTAGTCCCTCATTTCAAGG - Intronic
1124622915 15:31287822-31287844 TTGCCTTGTTCCTGATTTTAGGG + Intergenic
1125339753 15:38663146-38663168 TGGCCTGTTCCTTGAGCTCAAGG + Intergenic
1125707832 15:41756116-41756138 TTGGCTTTTCACTGTTTTCACGG - Intronic
1126267439 15:46770870-46770892 TACCCTTTTCCCTGTTTTCTTGG + Intergenic
1126301349 15:47200162-47200184 TCGCCCTTTCCCTTATTTCAGGG - Intronic
1126757871 15:51941973-51941995 TGGCCCTTGCCCCCATTTCAAGG + Intronic
1128979619 15:72176597-72176619 TGGCTATTTCCCTGGTTTCTGGG - Intronic
1129121120 15:73397361-73397383 TGACCTTTTCCCTGAAGCCACGG - Intergenic
1129320266 15:74770863-74770885 TGGGCTGCTCCCTGATTTGAAGG - Intergenic
1129456894 15:75680888-75680910 TAGCCTCTTCCCTGCTTTCCTGG + Intronic
1130388908 15:83437519-83437541 TGGCCTTGTCCCTGATCTTGTGG - Intergenic
1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG + Intronic
1131172351 15:90187455-90187477 AGGCCTTGTCCCTGCATTCAAGG + Intronic
1131942997 15:97587330-97587352 TGGTCTTGTCAATGATTTCATGG + Intergenic
1132326991 15:100979305-100979327 TTGCCTTGTTCCTGATCTCAGGG - Intronic
1133431882 16:5744376-5744398 TTACTTTGTCCCTGATTTCAAGG - Intergenic
1133438478 16:5800633-5800655 TGGCCTATTACCTAGTTTCACGG + Intergenic
1135059190 16:19256392-19256414 TGGCCTTTTCCCTTATATGCTGG + Intronic
1135458812 16:22623226-22623248 TGGCCTCTTCCCTTGTATCAGGG + Intergenic
1135926853 16:26702268-26702290 TGGCCTTTTGCCTCATCACATGG - Intergenic
1135947496 16:26877698-26877720 TGGCCTTGTCCCTAATTTAAGGG + Intergenic
1136245488 16:28973648-28973670 TGGCATTTTACCAGGTTTCAGGG - Intergenic
1137556926 16:49476492-49476514 TGGCCTCTTTTCTGATCTCAGGG + Intergenic
1137745782 16:50819036-50819058 TAGCCTTTTCCCTGTTTTGTGGG + Intergenic
1138052790 16:53798825-53798847 TGGCTTTTTTCCTCATTTTAGGG + Intronic
1139030586 16:62875998-62876020 TTGCCTTTTCCTTGGTTTCAGGG - Intergenic
1139301741 16:65950757-65950779 AGGCTTGTTCCCTGCTTTCATGG + Intergenic
1140177510 16:72677666-72677688 TTGTCTTGTTCCTGATTTCAGGG - Intergenic
1140340793 16:74158597-74158619 TTGCCTTGTTCCTGATCTCAGGG - Intergenic
1140780452 16:78291809-78291831 TGGCTTCTTGCCTGGTTTCAAGG - Intronic
1141255074 16:82394360-82394382 TTGCCTTTTTCCTGATTTAAGGG + Intergenic
1141255837 16:82401707-82401729 TTGCCTTTTCCCTGAGTTAATGG + Intergenic
1143585728 17:7849282-7849304 TGGCCTTTGCCCTGCCCTCACGG - Exonic
1143727839 17:8861834-8861856 TCGCCTTTTCACTCACTTCAAGG - Intronic
1144608100 17:16685702-16685724 TTGCCTTGTTCCTGATTTTACGG + Intergenic
1144794035 17:17878942-17878964 GGGCCTTGACCCTGGTTTCAGGG + Intronic
1145196740 17:20900498-20900520 TTGCCTTGTTCCTGATTTTACGG - Intergenic
1146366594 17:32233719-32233741 TGTCCTTTTCCCTGACCCCAAGG + Intronic
1148578085 17:48725317-48725339 TGGCCTTTTCCCTCAGTCCCGGG + Exonic
1149208084 17:54272145-54272167 TGTGTTTTTCACTGATTTCAAGG + Intergenic
1149898173 17:60447537-60447559 TTACCTTTTCCCGGATTCCAGGG - Exonic
1151056438 17:71037312-71037334 TGGCCTTTTGCCTCTTTCCAAGG + Intergenic
1151112499 17:71695764-71695786 TGTGCTTTTTCCTGATCTCAAGG - Intergenic
1151632333 17:75319350-75319372 GTGCCTTTTTCCTTATTTCAAGG - Exonic
1152057145 17:78038705-78038727 TTATCTTTTCCCTGATTACAAGG - Intronic
1152224804 17:79087743-79087765 TGGCCTCTTCCCTCACTGCAGGG - Intronic
1153390835 18:4557085-4557107 TTGTCTTCTTCCTGATTTCATGG - Intergenic
1154495286 18:14952630-14952652 TTGCCTCCTTCCTGATTTCAAGG + Intergenic
1155091208 18:22513527-22513549 TTGTCTTTTGCCTGTTTTCAAGG + Intergenic
1157365797 18:47063155-47063177 TGGCCTTTAACTTGATCTCAAGG - Intronic
1157770272 18:50339569-50339591 TGGCCTGCTCCCTGTTTTCAAGG - Intergenic
1157797837 18:50591823-50591845 GGTCCTCTTTCCTGATTTCAAGG + Intronic
1158784702 18:60696279-60696301 TGCCCTTTTAACTGAGTTCACGG + Intergenic
1159483754 18:69026617-69026639 TGGGCTTTTCTCTGACTTCAGGG - Intronic
1159721085 18:71891510-71891532 TGGCCTTTCCACCGATTTTATGG - Intergenic
1163739716 19:19003928-19003950 TGGACATTTCCCTGATTGCCTGG - Intronic
1164240439 19:23383718-23383740 TTGCCTTTTGCCAGTTTTCAAGG - Intronic
1165533760 19:36425850-36425872 TGGCCTCTTCCTTGGCTTCAGGG - Intergenic
1167088083 19:47324206-47324228 TTGCCCCTTCCCTGATTTCCTGG + Intergenic
1167559962 19:50221011-50221033 TCTCCTTGTCCCTGATTTCTGGG + Intronic
1167772605 19:51530558-51530580 AGCCCCTTTCCCTGTTTTCATGG - Intronic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
926173613 2:10569770-10569792 TGGCCTGTTTCCTGACGTCAGGG - Intergenic
926221509 2:10938652-10938674 AGGCCTTTTTCCTGTTTTCTGGG + Intergenic
926428383 2:12760871-12760893 TTGCCTTTTACCTGAGGTCAGGG - Intergenic
927577116 2:24209052-24209074 AGGCCTTCTCCCAGAGTTCAAGG + Intronic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
929271354 2:39975681-39975703 TGGCTTTTTCCCTTTTTTCCAGG - Intergenic
929302805 2:40325332-40325354 GGGACTTTTTCCTGGTTTCAGGG - Intronic
929647492 2:43642526-43642548 TTGTCTTGTTCCTGATTTCAGGG + Intronic
929873375 2:45776292-45776314 TGGCATTTTCCTTGAGGTCAGGG + Intronic
931993694 2:67818896-67818918 TGACCTTGTTCCTGATTTTAGGG - Intergenic
932602703 2:73139631-73139653 TTGCCTTGTTCCTGATCTCAAGG + Intronic
933420499 2:82039750-82039772 TGGCCTTATTCCTGATCTTAGGG - Intergenic
933748285 2:85586277-85586299 TGGCCTTTTCCCAGTTTTATAGG - Intronic
933813152 2:86045571-86045593 TAGCTTTTTCCCTCATTTCTAGG - Intronic
934578456 2:95418346-95418368 TGGCCTGTTTCCTGAGCTCAGGG - Intergenic
935336425 2:102021255-102021277 TGTCCTTTTTGCTCATTTCAGGG + Intronic
935432686 2:102993326-102993348 TGGCCTTGTACTTGATTACATGG - Intergenic
936735466 2:115437130-115437152 TGGCCTCTTACATGATTTCATGG + Intronic
937567852 2:123317659-123317681 TGGCATTTTCCCTCATTTTTTGG - Intergenic
938419740 2:131135573-131135595 TTGCCTTGTTCCTGATTTTAGGG + Intronic
940092363 2:149934739-149934761 TAGCCACTTCCCTGCTTTCATGG - Intergenic
941038454 2:160592954-160592976 TTGCCTTTTCACTTATTTTATGG + Intergenic
941254990 2:163217694-163217716 TGGCCGTTTCCCTGGCTTCTAGG - Intergenic
941595286 2:167468912-167468934 TTGCCTTATGCCTGATTTTATGG - Intergenic
944451563 2:199849284-199849306 TAGCCTTATCCCTGTTTTCAAGG + Intronic
944870585 2:203907673-203907695 TAGCCTTGTTCCTGATTTTAAGG + Intergenic
945980164 2:216303494-216303516 TGGCTTTTTCCCTGATGTCCAGG + Intronic
947222810 2:227810248-227810270 CTGCCTTTTCCCTGAGATCAAGG - Intergenic
947375366 2:229489838-229489860 TGCCCTTCTCACTGATTTCGAGG - Intronic
948187920 2:236035834-236035856 TGCCCTTTTCCTTCATTTTATGG + Intronic
948433719 2:237937728-237937750 TTGCCTTTTTCCTGTTCTCAGGG - Intergenic
1169031471 20:2411572-2411594 TGGTCTTGTCCCTGATTTTGGGG - Intronic
1169124366 20:3116356-3116378 TGGCCTTCACCCTCATTCCATGG - Intronic
1169347396 20:4839418-4839440 TGGCCTTTTCTCTCACCTCAGGG - Intergenic
1170987164 20:21269008-21269030 TGGCATGATCCCTGACTTCAAGG + Intergenic
1171142523 20:22755356-22755378 TGCCCCTTTCCCTGGCTTCAGGG + Intergenic
1171324987 20:24283276-24283298 TTGCCTTTCCACTGATTCCAGGG + Intergenic
1171565415 20:26180638-26180660 TGGCCTTTTCCAGAATATCATGG + Intergenic
1172183106 20:33015632-33015654 CAGCCTTTTCCCTGCCTTCATGG - Intronic
1172384502 20:34524394-34524416 TGGCCTTTTCCCTAATTGTTAGG + Intronic
1173234750 20:41234491-41234513 GTCCCTTTTCCCTGATTTGAGGG - Intronic
1174802895 20:53579974-53579996 TGGCCTTTTCATTTCTTTCAGGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175573526 20:60042172-60042194 TGCCCATTTCCCTCATTTTATGG + Intergenic
1175759569 20:61552171-61552193 TGGCCTTTTCACTTTTTTGATGG - Intronic
1176990468 21:15490477-15490499 TGGCCTTTTCCCTGGGCTCCTGG - Intergenic
1177217949 21:18153531-18153553 TGCCTTTTTCCCTGCTTTTAAGG + Intronic
1177442892 21:21150407-21150429 TTGTCTTGTTCCTGATTTCAGGG + Intronic
1179772996 21:43637938-43637960 TTGCCTTGTTCCTGATCTCAGGG - Intronic
1180746905 22:18095584-18095606 TGTCCTGTTCCTGGATTTCATGG + Exonic
1180894470 22:19319492-19319514 TTGCCTTTTCCCTGATATTAGGG + Intergenic
1182084340 22:27551126-27551148 TGGCCTCCACTCTGATTTCAGGG - Intergenic
1182496562 22:30712450-30712472 TGGCCATTTCCATGAGGTCAGGG + Intronic
1185248079 22:49783979-49784001 TGGCTTTTTCACTGTTTTCCAGG - Intronic
949421671 3:3872582-3872604 TGCCCTTTCTCCTTATTTCATGG + Intronic
949958375 3:9289422-9289444 TTGTCTTTTCCCAGATCTCAAGG - Intronic
950023501 3:9805584-9805606 TGGCATCTTCCATGTTTTCAAGG + Intronic
950670642 3:14523326-14523348 TCCCCTTTTCCCTGATCTCTAGG + Intronic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
950960967 3:17107050-17107072 TTGCCTTTGCCATGATTGCAAGG + Intergenic
952333757 3:32387384-32387406 TGGCCTTTTCTCTGTGTACATGG - Intergenic
953917795 3:46931651-46931673 TGGCCTGTTCCCTGAGAACAAGG + Intronic
956147150 3:66201963-66201985 TGGCAGCTTCCTTGATTTCATGG - Intronic
956215171 3:66841244-66841266 AAGACTTTTCCGTGATTTCAGGG + Intergenic
956528521 3:70190937-70190959 TGCCTTCATCCCTGATTTCAGGG + Intergenic
957938869 3:86978643-86978665 TGTCCTTTTCACTTATTTCCAGG - Exonic
958681212 3:97333869-97333891 TGGCCTTTTTCCTGAACTTATGG + Intronic
958962097 3:100520673-100520695 TAGTCTTTTCCCTGCTTTCTTGG + Intronic
959194542 3:103162898-103162920 TGCCCTTTTGCCTTATTTCATGG - Intergenic
959207340 3:103326914-103326936 AGGCCTTGTTCCTGCTTTCATGG + Intergenic
959841543 3:110982516-110982538 TGCTCTCTTCCCTGCTTTCATGG + Intergenic
959871761 3:111337133-111337155 TGGGCATTTGCCTGATTTCATGG + Intronic
960056753 3:113281376-113281398 AGGTCTATCCCCTGATTTCATGG - Intronic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
961682264 3:128607372-128607394 AGGCCATCTCCCTGATGTCAGGG + Intergenic
961696063 3:128705786-128705808 TGGCCTGTTCCCAGCTTTAAAGG + Intergenic
964192566 3:154021293-154021315 TGACATTTTTCTTGATTTCAAGG - Intergenic
964210445 3:154220860-154220882 TTGCCTTTTCACTTTTTTCATGG - Intronic
964920512 3:161890571-161890593 GGGCCCTTTGCCTCATTTCATGG + Intergenic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
966627449 3:182033661-182033683 TAGCCTTGTCACTGTTTTCATGG + Intergenic
967889201 3:194353055-194353077 TGGCTTTTTCACTCATTGCATGG + Intergenic
968074233 3:195807748-195807770 GTGTCTTTTCTCTGATTTCACGG - Intronic
969926213 4:10588021-10588043 TGGCCTCTTCTCTGATGTCTTGG + Intronic
969941359 4:10735145-10735167 TTGCCTTCTCACTGTTTTCATGG + Intergenic
973145838 4:46824956-46824978 TTGTCTTTTGCCTGTTTTCAAGG - Intronic
973552834 4:52052274-52052296 TGTCCGTTTCGCTGATTTCTGGG - Intronic
973855066 4:55002969-55002991 TGGCCTTCTTCCTGATTTGTAGG - Intergenic
973867995 4:55133759-55133781 TGACCTAATCCCTGATTTGAGGG - Intergenic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
977005617 4:91565956-91565978 TTGTCTTGTGCCTGATTTCAAGG + Intronic
977332521 4:95655474-95655496 TTGTCTTTTCCCAGTTTTCAAGG + Intergenic
978379074 4:108107479-108107501 AAGCCTTTTCCCTGATTGTAAGG - Intronic
978640575 4:110866481-110866503 AGACCTTTTCCCTAATTTTAAGG - Intergenic
981349747 4:143716049-143716071 TGACCTTCTCCCTGAGTTTAAGG + Intergenic
982139089 4:152300421-152300443 TGGCCTTTTCCCTTGTTTAATGG - Intergenic
982310003 4:153974800-153974822 TAGCCTCTGCCTTGATTTCAGGG + Intergenic
982670647 4:158316584-158316606 TGAGCATTTACCTGATTTCAGGG + Intronic
984052836 4:174888140-174888162 TGTCTTTTTCACTGATTTGAAGG + Intronic
984171659 4:176367676-176367698 TGCCCTTTTCCCCCATTTCTAGG + Intergenic
986400782 5:7377455-7377477 TGTTCTTTTCCATCATTTCAGGG + Intergenic
986748587 5:10764960-10764982 TGGCCTTCTGTCTGAATTCAAGG - Intergenic
987205365 5:15619797-15619819 TGGCCTTTTCCCTGATGGGATGG + Intronic
987425331 5:17766493-17766515 TGGCCATTACCTTGATTGCAGGG + Intergenic
987457606 5:18165972-18165994 AGGCATTTTCCCTGTTGTCATGG + Intergenic
988703863 5:33703890-33703912 TGCTCTCTTTCCTGATTTCATGG - Intronic
988911590 5:35848652-35848674 CAGTCTTTTTCCTGATTTCACGG - Intergenic
989128245 5:38077980-38078002 TGGCCTTTGCCCTGACTTTTAGG + Intergenic
989577475 5:43001535-43001557 TTGCCTTGTTCCTGATTTCATGG + Intergenic
992006089 5:72478866-72478888 TGGGCTTTGGACTGATTTCAGGG - Intronic
992762237 5:79960980-79961002 TGGCCATCTCCCTGTTTTGAAGG + Intergenic
992893414 5:81225776-81225798 TGGCCTTGCCCCTGAGTCCACGG + Exonic
993943868 5:94095293-94095315 TGGCCTTTGCCCTCACTTTACGG - Intronic
994062410 5:95494305-95494327 TTCCCTTTTGCCTTATTTCATGG + Intronic
994308118 5:98233010-98233032 TGGTCTTTTCTAAGATTTCAAGG - Intergenic
996280062 5:121719607-121719629 TTGCCTATACCCTGGTTTCAGGG - Intergenic
996702256 5:126462079-126462101 TGGACTTGTCCCTGTTGTCAGGG - Intronic
997116031 5:131126669-131126691 TTGCCTTTTGCCAGCTTTCAAGG + Intergenic
998170698 5:139870617-139870639 TGGCCTTTGCCCAGATGCCATGG + Intronic
999030893 5:148289963-148289985 TGGCCTTTTAACTCATTTCCTGG + Intergenic
999723710 5:154417769-154417791 TGGCCTTTTCCGTGGGCTCAGGG - Exonic
1000313677 5:160068699-160068721 TGGCCCTTTCCATGAGCTCATGG - Intronic
1001051664 5:168418997-168419019 TTGCCTTGTCTGTGATTTCACGG + Intronic
1001807873 5:174604034-174604056 TTGCCTTTTTCTGGATTTCAGGG + Intergenic
1002402214 5:178997052-178997074 TGGCCTCTTCCCTCAGTTCCAGG - Intergenic
1002948973 6:1789447-1789469 TGGCCTTTGTCCTGATTCCTAGG - Intronic
1003998394 6:11567323-11567345 TGGCCTATTCCCATATGTCAGGG + Intronic
1004680103 6:17885525-17885547 AGGCATTGTCCCTGATCTCAGGG + Intronic
1005031458 6:21512777-21512799 TGGCATGTTCCCTGACCTCAGGG + Intergenic
1006852635 6:37110032-37110054 TTGCATTATCACTGATTTCATGG - Intergenic
1007046540 6:38780996-38781018 TGCCCTTATCCCAAATTTCAAGG - Intronic
1007538439 6:42618214-42618236 TGTCCTTTTCCCACACTTCAGGG + Intronic
1007725934 6:43915619-43915641 TGTCTTTTACCCTGATATCAGGG + Intergenic
1008720924 6:54350705-54350727 TGACGTTTTCCTTGATTTCCAGG + Intronic
1010612932 6:77977539-77977561 TTGCCTTTTTCCTGATATTAGGG - Intergenic
1011348790 6:86400100-86400122 AGGCCTTTTCCCCGTTTTCTTGG + Intergenic
1011655891 6:89551556-89551578 TTGCCTCTTCCCTAATCTCAGGG - Intronic
1014194426 6:118536671-118536693 TGGCCTTTTCTCTTATCTCATGG - Intronic
1016084347 6:139894623-139894645 GGGCCTTTTGCCTCATTGCATGG + Intergenic
1016885082 6:148951471-148951493 TGGCCTTTAGTCTGATTCCATGG - Intronic
1017432961 6:154389148-154389170 TGGTCTTGTCAATGATTTCATGG - Exonic
1018013266 6:159691303-159691325 GGGCCTTTTCCCGTAATTCAAGG + Intronic
1018272348 6:162093810-162093832 CGGCTTTGTCCCTGCTTTCAGGG - Intronic
1018759884 6:166884700-166884722 TTGCCTTTTCCTTGACTTAAGGG - Intronic
1018905454 6:168073083-168073105 TGGACTTTTCCCAGTTTTCAGGG - Intronic
1019966641 7:4505031-4505053 TCACCTATTCCTTGATTTCATGG + Intergenic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1021137026 7:16977655-16977677 AGACCTTTTCCCTGCTTTCTTGG + Intergenic
1021675933 7:23080950-23080972 CTGCCTTTTTCCTGTTTTCATGG - Intergenic
1022280113 7:28899647-28899669 TAGAATTTTCCCTAATTTCATGG - Intergenic
1022416510 7:30182393-30182415 TGGCGTTATCCCTGATTGCCTGG + Intergenic
1022664030 7:32393181-32393203 TTGCCTTGTTCCTGATTTTAGGG - Intergenic
1022857301 7:34327897-34327919 TTCCCTAATCCCTGATTTCATGG - Intergenic
1023273373 7:38491497-38491519 TGGATTTTTTTCTGATTTCATGG - Intronic
1023372343 7:39524222-39524244 TGGCCTTAGCCATGATTTCCTGG + Intergenic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1025901972 7:65751704-65751726 AGGACTTTTCCCAGATCTCAGGG - Intergenic
1027201652 7:76067758-76067780 TGGCCTTTTCCCCGAGGTCTTGG + Intergenic
1030145867 7:106354963-106354985 TTGACTTGTCCCTGATTTTAGGG - Intergenic
1033765247 7:144482329-144482351 AGGCCTTTTCCTTGATTAAAAGG - Intronic
1033963879 7:146949712-146949734 TGGCCTATTCCCTTCTTTAAGGG - Intronic
1034852604 7:154509173-154509195 TTGCCTTTTCCCTTTCTTCATGG - Intronic
1035145044 7:156806516-156806538 TTGCCTTGTTCCTGATCTCAGGG + Intronic
1036062482 8:5339621-5339643 TGCTCTTTCCCTTGATTTCATGG + Intergenic
1036210084 8:6834625-6834647 GGGACTTTTCCCTGAGTTCGCGG - Intronic
1036747406 8:11419771-11419793 GGGCCTTTTCCCTGAATTCCAGG + Intronic
1037158777 8:15741101-15741123 TATACTTTTCCCTGAGTTCATGG + Intronic
1037161083 8:15773059-15773081 TTGCCATGTCCCTGATTTCAGGG - Intergenic
1037223791 8:16558315-16558337 TGGCCTTTACCGTGTTGTCATGG + Intronic
1038028386 8:23613551-23613573 TGGCCTTTTCCAGAATTTTATGG + Intergenic
1040448783 8:47523450-47523472 TGGCCTTTTCCCTCAAAACATGG - Intronic
1040791339 8:51233560-51233582 TTTCCATTTCCCTTATTTCAAGG - Intergenic
1041749234 8:61240829-61240851 TTGCCTTTGCCTTGATCTCACGG + Intronic
1042725213 8:71867977-71867999 TTGTCTCTTCCCAGATTTCAGGG - Intronic
1043001364 8:74764040-74764062 TTGCCTTGTTCCTGTTTTCAAGG - Intronic
1045253244 8:100498667-100498689 AGGCCATTTCCCGGATGTCAGGG - Intergenic
1045730974 8:105240355-105240377 TTGCATTTTGCCTGATTTCTGGG + Intronic
1046432994 8:114152894-114152916 TTGCCTCTTCCCTGATTTTGAGG - Intergenic
1046471626 8:114682545-114682567 TGGCCTTTACCTAGATTTCAAGG - Intergenic
1049110055 8:140636515-140636537 TCGCCTTTTCCCAGATTTCCCGG + Intergenic
1049189095 8:141276718-141276740 TGCCCTTTTCCCTTCTTTCCAGG + Intronic
1049678978 8:143908121-143908143 TGCCCTTTTTCCTGATCTTAAGG + Intergenic
1050510014 9:6384529-6384551 TGGCCTTTTCCCTCCTTTTTCGG - Intergenic
1050867162 9:10516631-10516653 TAGCCTTGTCAGTGATTTCATGG - Intronic
1051009475 9:12393980-12394002 TGGGCTTAGCCCTAATTTCAGGG - Intergenic
1052435683 9:28425538-28425560 TGGCCTTTTTCCTTTTATCATGG + Intronic
1052643555 9:31201527-31201549 TCGCCTTGTCCCTGATATTAGGG - Intergenic
1052879046 9:33589307-33589329 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1053362715 9:37500759-37500781 TGGCCTTTTCTCTTAGCTCATGG + Intronic
1053496930 9:38554912-38554934 AGGCCTTTTCCCTGTTGTCTTGG + Intronic
1056263285 9:84871076-84871098 TGGCTTGTTCCCTGCTCTCAAGG + Intronic
1056586240 9:87929240-87929262 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1056610642 9:88123703-88123725 AGGCCTTTTCCCTGTTGTCTTGG + Intergenic
1056821769 9:89847306-89847328 TGGCCTTTTCCCACATTCCTTGG - Intergenic
1057676050 9:97136950-97136972 AGGCCTTTTCCCTGTTGTCTTGG - Intergenic
1059008483 9:110430408-110430430 TGGCCATTTTCCGGATTTCCTGG + Exonic
1059559572 9:115320411-115320433 TTGCCTTCTCTCTGATTTCATGG - Intronic
1060019363 9:120115923-120115945 TCTCCTTTACCCTGATTGCAAGG - Intergenic
1060610155 9:124956738-124956760 TTGCCTTCTTCCTGATTTTAGGG - Intronic
1061269730 9:129531783-129531805 TTGCCTTGTTCCTGATTTTAAGG - Intergenic
1061586110 9:131569815-131569837 TGGCCATGTCCATGTTTTCAAGG + Intergenic
1061644220 9:131986976-131986998 TGGGCCTTTCCTTGAGTTCATGG + Intronic
1061819127 9:133214832-133214854 TTGCCTTGTCCCTGATGTTAAGG - Intergenic
1186037914 X:5444620-5444642 TGCCATTTTCCCTGAAATCATGG - Intergenic
1186271443 X:7892488-7892510 AAGCCTTATCCCTGATTTAATGG + Intergenic
1186367105 X:8907111-8907133 TGGCCTACTTCCTGGTTTCATGG - Intergenic
1186824541 X:13326232-13326254 TTGCCTTTTCCATGATTTTTTGG + Intergenic
1187960996 X:24565801-24565823 TTGCCTTTTTTCTTATTTCATGG - Intronic
1189554161 X:42125051-42125073 TGCTCTTTTCCCTAATTTCAAGG + Intergenic
1190047304 X:47122952-47122974 TTGTCTTTTTCCTGATTTAAAGG - Intergenic
1192603979 X:72494380-72494402 TTGCCATTTCCCTGTTTCCAGGG - Intronic
1193259101 X:79384129-79384151 TTGTCTTTTCCCAGTTTTCAAGG - Intergenic
1194649275 X:96496501-96496523 TGGCCTTTTCTCTGTGTGCAAGG - Intergenic
1194874980 X:99175593-99175615 TTGTCTTTTCCCAGCTTTCAAGG - Intergenic
1195776369 X:108410447-108410469 TGGCCTTTACCATGTTTTCCAGG + Intronic
1196455929 X:115891623-115891645 TGCCCTGTTCCCTGATCTCTAGG + Intergenic
1197497651 X:127205189-127205211 TGGCTTTTTGTCTGATTTCCAGG - Intergenic
1197532914 X:127652694-127652716 TTGCCTTTTGCCAGTTTTCAAGG - Intergenic
1198006123 X:132495446-132495468 AGGGCTTTTCCCTGGTCTCAAGG - Intergenic
1198220348 X:134593969-134593991 TTGCCTTTTTCCTGATCTAAGGG + Intronic
1198569285 X:137938106-137938128 AGGCCTTTTCCCTGTTTTCTTGG + Intergenic
1200170345 X:154068675-154068697 TTGCCTTTTTCCTGATTTTCGGG + Intronic
1200753080 Y:6964888-6964910 TGGCTTTATCAATGATTTCATGG + Intronic
1201450523 Y:14107647-14107669 AAGCCTTATCCCTGATTTAATGG - Intergenic
1202054658 Y:20817529-20817551 TGGCCATCTTCCTGATTTGAAGG - Intergenic