ID: 950937893

View in Genome Browser
Species Human (GRCh38)
Location 3:16861426-16861448
Sequence CTAATTATTAGGGCCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950937893_950937897 -5 Left 950937893 3:16861426-16861448 CCAGCATTGGCCCTAATAATTAG 0: 1
1: 0
2: 1
3: 5
4: 55
Right 950937897 3:16861444-16861466 ATTAGTTTTTAATAAGGTGATGG 0: 1
1: 0
2: 2
3: 40
4: 362
950937893_950937898 -4 Left 950937893 3:16861426-16861448 CCAGCATTGGCCCTAATAATTAG 0: 1
1: 0
2: 1
3: 5
4: 55
Right 950937898 3:16861445-16861467 TTAGTTTTTAATAAGGTGATGGG 0: 1
1: 0
2: 4
3: 31
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950937893 Original CRISPR CTAATTATTAGGGCCAATGC TGG (reversed) Intronic
907572071 1:55492546-55492568 GTATTTCTTGGGGCCAATGCTGG + Intergenic
908861019 1:68489831-68489853 GTTATTATTAGGGTCAATTCTGG + Intronic
915115598 1:153597200-153597222 ATAATTATTGGGGCCAAAACCGG + Intergenic
918403625 1:184190531-184190553 CTAATAATTGGGGGCAATGCCGG - Intergenic
920814121 1:209314969-209314991 CTAGTTATTAAGGCCACTGCAGG + Intergenic
922914289 1:229243130-229243152 CTTGTCATTAGGGCCAAAGCAGG + Intergenic
924002076 1:239565254-239565276 CTAATTATTAGGGCCCATCCAGG - Intronic
1073243257 10:102072065-102072087 CTAATTATTATTGTGAATGCAGG + Intergenic
1074276714 10:112009565-112009587 CTAGTTGTTAGGGCCTGTGCAGG - Intergenic
1080298598 11:30758546-30758568 CAAATTATTAGGGCCAAGTATGG + Intergenic
1086589882 11:88501467-88501489 TGAATTATTAGGGCTAATGATGG + Intergenic
1088577206 11:111283893-111283915 TTAGTTATTTGGGCTAATGCAGG + Intronic
1092209505 12:6637242-6637264 ATAATAATAAAGGCCAATGCTGG + Intergenic
1095931530 12:47630970-47630992 CTAATTACAAGGGTCAATCCTGG - Intergenic
1096719982 12:53513978-53514000 CTAATGCTTAGGGCCAAGGAGGG + Exonic
1114059498 14:19006621-19006643 CTTAGAATTTGGGCCAATGCAGG + Intergenic
1114103048 14:19395130-19395152 CTTAGAATTTGGGCCAATGCAGG - Intergenic
1137895021 16:52202669-52202691 CTAATTGTTGTGGCCAATTCTGG + Intergenic
1138353300 16:56358125-56358147 CTAATTATTACAGCAAAAGCGGG - Intergenic
1148910926 17:50942343-50942365 CTAATCCTGAGGGCCAATGAAGG - Intergenic
1160226399 18:77014628-77014650 CAGATTTTTAGGGCCATTGCGGG + Exonic
1165687734 19:37836832-37836854 CTAATTATTCCTGCCAAGGCAGG - Intergenic
925439679 2:3873834-3873856 CTGTTTATTAGAGCCAAAGCTGG + Intergenic
933684204 2:85130582-85130604 CTTAGTATAGGGGCCAATGCTGG + Intergenic
937053383 2:118910496-118910518 GAAAATATTAGGGCCAAAGCGGG - Intergenic
1176888953 21:14291014-14291036 AGGATGATTAGGGCCAATGCTGG - Intergenic
1180477978 22:15729236-15729258 CTTAGAATTTGGGCCAATGCAGG + Intergenic
1182597074 22:31430112-31430134 CTAATTTTCAGGGCTAGTGCAGG - Intronic
1183164580 22:36138205-36138227 CTAAGTGTCAGGGCAAATGCTGG + Intergenic
1183170882 22:36187355-36187377 CTAAGTGTCAGGGCAAATGCTGG + Intergenic
950937893 3:16861426-16861448 CTAATTATTAGGGCCAATGCTGG - Intronic
953827194 3:46263897-46263919 TTAATAACTGGGGCCAATGCGGG - Intronic
959369548 3:105505482-105505504 CTAATTATAATCCCCAATGCTGG - Intronic
961106618 3:124248263-124248285 ATACTCCTTAGGGCCAATGCCGG + Intronic
971835240 4:31754651-31754673 CTAATTATAAGGCACAATGTGGG + Intergenic
973680422 4:53312269-53312291 CTAATTTGTACAGCCAATGCCGG - Intronic
980526012 4:133992111-133992133 CTTATGATTTGGGCCAATGGGGG - Intergenic
980632904 4:135460345-135460367 CTGATTATTAGTGCCACTGAGGG + Intergenic
981094824 4:140768025-140768047 CTAATTATGAGGGCTGAGGCGGG + Intergenic
987539524 5:19236105-19236127 CTACTTTTTAGGGCCATTTCTGG + Intergenic
992002405 5:72448695-72448717 TATATTTTTAGGGCCAATGCTGG + Intronic
993347396 5:86801549-86801571 CTAATTCTACGGGCCAATACAGG - Intergenic
993594231 5:89832449-89832471 CTATTTATTATGGCCCATGACGG - Intergenic
1005152643 6:22770586-22770608 CTGATTATTAGGACCTATGCAGG - Intergenic
1009397622 6:63218275-63218297 ATGATTATTAGTGCAAATGCAGG + Intergenic
1012527113 6:100191209-100191231 AGAATTGTTAGGGTCAATGCTGG - Intergenic
1030816481 7:114045666-114045688 CTAATTAAGAAGGCCAATGAAGG - Intronic
1034631795 7:152536813-152536835 CTAATCATTTGGGCCAATCAAGG - Intergenic
1037747497 8:21658707-21658729 CTAATTATAATTGCCAATGGTGG - Intergenic
1038768690 8:30455587-30455609 ATAATTATAAGAGACAATGCAGG + Intronic
1044234577 8:89815643-89815665 CTGATTATTTGGGCCATTGCTGG + Intergenic
1047702240 8:127460717-127460739 ATAATTATTAGGACAAATACAGG - Intergenic
1047721258 8:127642284-127642306 CTAAGTATTAGGGACTAGGCTGG - Intergenic
1048308315 8:133298585-133298607 CTGATTATTAGGGCCAGTTTTGG + Intronic
1050171787 9:2827461-2827483 CTAATCATTATGTCCAGTGCTGG - Intronic
1052470266 9:28885191-28885213 GCAATTATTAGGGACAATGCAGG - Intergenic
1055537073 9:77259486-77259508 GTAATTTTTAGGGAAAATGCAGG + Intronic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1187948657 X:24450921-24450943 CTAATACTTAGGGCAAAAGCTGG + Intergenic
1197012796 X:121587535-121587557 CTAATTCTGACTGCCAATGCTGG - Intergenic
1199459778 X:148071781-148071803 CTAAGTCAAAGGGCCAATGCTGG + Intergenic
1201520646 Y:14870118-14870140 CCTATGATTTGGGCCAATGCAGG - Intergenic