ID: 950939634

View in Genome Browser
Species Human (GRCh38)
Location 3:16880120-16880142
Sequence AAAGAAATGCAGACTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950939630_950939634 8 Left 950939630 3:16880089-16880111 CCTGTCAATAAAAAACAGATTGA 0: 1
1: 0
2: 0
3: 36
4: 360
Right 950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG 0: 1
1: 0
2: 8
3: 67
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950939634 Original CRISPR AAAGAAATGCAGACTTTGGA AGG Intronic
900472995 1:2863709-2863731 AAGGAAATGCTGACTTTGAAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901353636 1:8622503-8622525 AAAAAAAAACACACTTTGGAAGG + Intronic
901792638 1:11662313-11662335 AAGGAAAGGCAGACTTTAGGTGG + Exonic
902056280 1:13603124-13603146 AAAGAAATGCCCACTTTGGGAGG + Intronic
903096954 1:20985783-20985805 AAAGATATTCAGACTTTAGGTGG - Intronic
904013388 1:27403108-27403130 AAAGATATGCAGTCTTTGGCAGG + Intergenic
904191079 1:28744183-28744205 ACAGAAATACGGACTTTGAAAGG + Intronic
904512518 1:31024249-31024271 AAAGAAAGGCAAAATTTGGTGGG - Intronic
904879265 1:33682580-33682602 AAAGAAAAGGAGTCTTAGGAGGG + Intronic
905062738 1:35153543-35153565 AAAGAAATGATGACTTTGTAGGG - Intergenic
905899451 1:41571648-41571670 AAAGAACTACAGAGTGTGGAGGG + Intronic
906200213 1:43955252-43955274 AAAAAAAAAAAGACTTTGGAAGG - Intronic
906750819 1:48258095-48258117 AAAGAAATGCTGACAATTGAGGG - Intergenic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
908259028 1:62325398-62325420 AAAGAAAGGCAGAATTGGGCAGG - Intergenic
908725202 1:67168360-67168382 AAAGAAATCCTGCATTTGGAAGG - Intronic
909856674 1:80542297-80542319 AAAGAAATGAAAACTTAGGCTGG + Intergenic
910071240 1:83216259-83216281 AAAGAAATGCAGAATTTCCTAGG + Intergenic
910292176 1:85609899-85609921 AAAGAAATGGAGACATGGGGAGG + Intergenic
910527751 1:88200574-88200596 AAAGAACTGCTGACATTGTATGG - Intergenic
910659776 1:89659435-89659457 CAAGAAATGGAGGCTTAGGAAGG - Intronic
910826489 1:91413681-91413703 AAGGAAATGAAGAATTTGGCGGG - Intergenic
911083687 1:93958262-93958284 AAAGAAGAGAAGCCTTTGGATGG - Intergenic
911429723 1:97769192-97769214 AAAGAAAAGGACATTTTGGAAGG + Intronic
912547402 1:110460882-110460904 ACAGAAATGCAGATTTGGGGAGG - Intergenic
912819635 1:112856463-112856485 AAAGAAATGTACACTTTAGCTGG + Intergenic
913082832 1:115404949-115404971 AAGGAAATGCAGCCTTTAGAGGG + Intergenic
913150347 1:116035996-116036018 AAAGAAATTCTGAGTTTGGCTGG - Intronic
913616566 1:120566020-120566042 AAAGATATGAAGTCATTGGAGGG - Intergenic
914573710 1:148944891-148944913 AAAGATATGAAGTCATTGGAGGG + Intronic
914679761 1:149930970-149930992 AAAGAAATTAAGAGGTTGGAAGG + Intronic
915889121 1:159754752-159754774 ATAAAAATACAGACTTTGCAGGG + Intergenic
915926877 1:160028972-160028994 ATAGAAATGCAGACCTGTGAGGG - Exonic
916174683 1:162027921-162027943 AAAATAATGAAGAGTTTGGAAGG - Intergenic
916314099 1:163428291-163428313 AAATAAAGGCAGTCTGTGGATGG + Intergenic
918314606 1:183312754-183312776 GAAGAAATTGAGACTTAGGAAGG - Intronic
918613509 1:186518096-186518118 TAAAAAATGCTGATTTTGGATGG + Intergenic
918898399 1:190379486-190379508 CAAGAAATGCTGACATTTGAGGG + Intronic
920118443 1:203637783-203637805 CAAGAAAAGCAGACTATAGATGG - Intronic
920328500 1:205186372-205186394 AAAGAAATATGGACTGTGGAAGG + Intronic
920455273 1:206096439-206096461 AAAGAAATGAAAATTGTGGAAGG - Intronic
920605628 1:207381716-207381738 AAACAAATAAATACTTTGGAAGG + Intergenic
920640547 1:207747973-207747995 AAAGAAATGAAAACTTTCCAAGG - Intergenic
921131607 1:212224643-212224665 AAAGAAATGCACACTTTATTTGG - Intergenic
921131654 1:212224979-212225001 ATAGAAATGCACACTTTGGCCGG - Intergenic
921565038 1:216706513-216706535 ACAGGATTGCAAACTTTGGAAGG - Intronic
923430610 1:233916526-233916548 AAAGAAGTTTATACTTTGGAAGG - Intronic
923599508 1:235389831-235389853 AAAGAAATGCAGACTGGGCGTGG + Intronic
923763693 1:236872314-236872336 AAGGAAAGGCAGACTCTAGATGG - Intronic
923887241 1:238172294-238172316 AAAGAAATGCAGAGCTCAGATGG + Intergenic
1062896224 10:1105393-1105415 AAAGAATAGCAGAATTTGAAAGG - Intronic
1063313325 10:4977665-4977687 AAAAAAATGCACACTCTGAATGG - Intronic
1063314628 10:4990051-4990073 AAAAAAATGCACACTCTGAATGG + Intronic
1063921330 10:10936238-10936260 AAAGAAATGGTTACTTTGAATGG + Intergenic
1064279066 10:13934528-13934550 AAAGAGAAGCAAACTTTGCAGGG + Intronic
1064644316 10:17445516-17445538 AAAGAAAGGCAGACGGTGGGAGG - Intronic
1065169388 10:23011237-23011259 ACAGAAATCCAAACTTTGGCAGG + Intronic
1066199647 10:33132573-33132595 AAAGAAATGCGGACAGTGGCTGG - Intergenic
1066270150 10:33814403-33814425 AAACAAATACAGACTAAGGAAGG + Intergenic
1067267050 10:44755632-44755654 GAGGAAATGAAGACTTAGGAAGG + Intergenic
1067313344 10:45136676-45136698 AAAGCAATACAGAATATGGAAGG + Intergenic
1067763044 10:49064131-49064153 AACCAAATGAAGACTTTGAAAGG - Intronic
1068112946 10:52702990-52703012 AAAGTAAAGCAGAATTTTGAGGG + Intergenic
1068543861 10:58325698-58325720 AAAGAAATGCAGGTCTTAGAAGG + Intergenic
1068579057 10:58718373-58718395 TAAGAGGTGGAGACTTTGGAAGG - Intronic
1068864225 10:61878102-61878124 ACAGTAATGCAGGCTTTCGAGGG + Intergenic
1068873270 10:61968495-61968517 AAAGAAATGCAAATTCTGCAGGG - Intronic
1068950560 10:62772707-62772729 AGAGCAGTGCAGGCTTTGGATGG + Intergenic
1069347614 10:67488265-67488287 CAAGAAATGAAGACATTGAAAGG + Intronic
1070697056 10:78571280-78571302 AAAGAAATGTACACTTGGCAGGG + Intergenic
1071536419 10:86435604-86435626 ATAGAGATGCAGATTTTGGTGGG - Exonic
1071661576 10:87507881-87507903 AAAGTAATACAGAGTTGGGAAGG + Intronic
1072102076 10:92239201-92239223 AAAGAACTGGAGGCTTCGGAAGG + Intronic
1073413431 10:103361577-103361599 AAAAAAATGCAAACTTAGAAAGG + Intergenic
1074358936 10:112809792-112809814 AAAGAAATTCGGACTGTGGAAGG + Intronic
1074635024 10:115304944-115304966 AAAGAAATGAAAACTTTCCAAGG + Intronic
1076030235 10:127151317-127151339 AATGAAATAAAGACTTTGGGAGG + Intronic
1076067509 10:127460424-127460446 CATGAAAAGCAAACTTTGGAAGG + Intergenic
1076326931 10:129631525-129631547 AAAGAAATTAAAAATTTGGACGG + Intronic
1076830019 10:132989387-132989409 AATGAAATGCACACGTTTGAGGG + Intergenic
1077510910 11:2962055-2962077 AAAGAAATGCAAAATTAGGCAGG + Intronic
1078414538 11:11154649-11154671 AAAGAAATCAAAACTTTAGAGGG - Intergenic
1080140305 11:28910428-28910450 AAAAAAATGAAGAATTTGGAGGG - Intergenic
1080332519 11:31155681-31155703 AAAGAAGTGTGGAATTTGGAGGG + Intronic
1080454662 11:32407425-32407447 AAAGAAAAAGAGCCTTTGGAAGG + Intronic
1080498384 11:32844872-32844894 AAAGAAATACAAATATTGGATGG - Intronic
1080527906 11:33145511-33145533 AAAGAAATGCAAATATTGGCCGG + Intronic
1080894270 11:36436076-36436098 AAAGATGTGCAGATTTTGAAAGG - Intronic
1081557153 11:44175347-44175369 AAAGAAAGGTAGATTGTGGAGGG - Intronic
1082746705 11:56970296-56970318 AAAGAAATGCAGCCCTTTCAAGG - Intergenic
1083321848 11:61852555-61852577 AAAGAAGTACAGACCTTGGCCGG - Intronic
1083785471 11:64943282-64943304 CTAGAGATCCAGACTTTGGAAGG - Intronic
1083956801 11:65988339-65988361 TAAGAACTGCAGCCTCTGGAAGG - Intergenic
1085721603 11:78917178-78917200 AAGAAAATGGAGACTTTGCAAGG + Intronic
1086272285 11:85081904-85081926 AAGGAAATGCATACTTGGGGAGG + Intronic
1088209472 11:107438678-107438700 AAAAATTTGCAGTCTTTGGAAGG - Intronic
1088761238 11:112930773-112930795 GGAGAAATGCAGCCTCTGGAGGG - Intergenic
1088934142 11:114381527-114381549 AAAAAAAAAAAGACTTTGGAGGG + Intergenic
1090019125 11:123111528-123111550 AAAGAAATGCTGTAGTTGGATGG - Intronic
1090188376 11:124752454-124752476 GAAGGAAAGCTGACTTTGGAAGG + Intergenic
1090238475 11:125165860-125165882 AAAGAAATGCAAACTTTGAGCGG - Intronic
1090516967 11:127438941-127438963 AAAGAAAAGAAGAGCTTGGAGGG - Intergenic
1090692083 11:129194559-129194581 AAACAAATGCAGACTATCTATGG + Intronic
1090926061 11:131251410-131251432 GAAGAAATGCAGAGCTAGGATGG + Intergenic
1091030034 11:132177991-132178013 AAAGAAATGGAAAATTTTGATGG + Intronic
1091663735 12:2403502-2403524 AAGGAAAAGCAGCCTTGGGATGG - Intronic
1091668213 12:2434441-2434463 AAAGAAATGGAGACACAGGAAGG + Intronic
1091984024 12:4892940-4892962 AGAGAAATGCAGAGTTTTGGAGG + Intergenic
1093302510 12:17473490-17473512 TAAGAAATGTGGGCTTTGGAGGG - Intergenic
1093562211 12:20554555-20554577 AAAGAAAAATAGACTTTTGAGGG - Intronic
1094231166 12:28105030-28105052 AAAGTAAAGGAGACTTTGGATGG + Intergenic
1095548527 12:43403025-43403047 AAACAAATGCAAAATTTGCAAGG + Intronic
1097126170 12:56777350-56777372 AAAAAAATTTACACTTTGGAAGG - Intronic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098318606 12:69217472-69217494 AAAAAAATGCAGTCATTGGGAGG + Intergenic
1098558993 12:71851401-71851423 AAGGAAATGGAGATTTGGGAGGG - Intronic
1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG + Intronic
1098910282 12:76202107-76202129 AAAGAAAGGGAGAATTTAGAGGG + Intergenic
1100890416 12:99119547-99119569 AAAGAAATCAAGAATTTGGGAGG - Intronic
1101584978 12:106077804-106077826 GAAGAAATGCAGGCTTAGAATGG - Intronic
1102126753 12:110489028-110489050 AGACAAATCCAGACTTTGGAAGG + Intronic
1102321934 12:111943515-111943537 AAAGAATTTCAGACTTGGTATGG - Intronic
1102890238 12:116552994-116553016 AAAGAAATAGAGACTTGGGGGGG - Intergenic
1103292775 12:119860735-119860757 AAAGAAATGGAGATTTGGAATGG - Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1104758123 12:131281475-131281497 AGAGAGATGCAGGCTTTGGGAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105984789 13:25554854-25554876 ATAGAAATGCTGATTTTGGCTGG - Intronic
1107338100 13:39377239-39377261 AAAGAAATGAAGACTTGGAGAGG - Intronic
1107663171 13:42660699-42660721 AAAGAGATGAAGAGTTTGAAAGG - Intergenic
1108250902 13:48566881-48566903 AAAGAAAAGAAAACTTTGTATGG + Intergenic
1109744433 13:66604532-66604554 AAAGATATGCTAATTTTGGATGG - Intronic
1109756419 13:66766619-66766641 AAAAAAATGTAGAGTTGGGAAGG + Intronic
1110887424 13:80656613-80656635 AAAGAAGTGAAGGATTTGGAAGG - Intergenic
1111660361 13:91202375-91202397 TAAGAAGTGGAGACTTTGGGAGG + Intergenic
1111705001 13:91737842-91737864 AAAGAATTTCAGAGTGTGGAAGG - Intronic
1111866018 13:93769760-93769782 AAATAAATGCAGGCCTGGGAAGG + Intronic
1112041374 13:95552138-95552160 AAAGAACTGCAGAGTTTTGAGGG + Intronic
1112046569 13:95603704-95603726 AAAAAAATGCATACTGGGGATGG + Intronic
1112209098 13:97356407-97356429 AAAAAAATGCAAAATTTGTAAGG - Intronic
1112293946 13:98170172-98170194 AAAAAAATGCAGACATTCTAGGG - Intronic
1113305868 13:109078124-109078146 AAAGACATGCAGAATTTTAAGGG - Intronic
1113732979 13:112655859-112655881 AAAAAAAAGCAGAGTTTGGGAGG - Intronic
1113809142 13:113127050-113127072 AAAGAAATGGGGAATTTGGAAGG + Intronic
1115117113 14:29894454-29894476 AAAGAAAGGCAGATAATGGATGG + Intronic
1115765455 14:36618388-36618410 ACAGAGAAGCAGACTTTGAAAGG - Intergenic
1117462777 14:55962690-55962712 TAAGAGATGGAGCCTTTGGAAGG + Intergenic
1117629357 14:57673636-57673658 AAAGAAATGCCTACTGTGGCAGG + Intronic
1117832637 14:59767775-59767797 AAAGCAATGAAAACATTGGAAGG - Intronic
1119627541 14:76192819-76192841 AAAGAACTGAAGACTTTCTAAGG - Intronic
1119707716 14:76795741-76795763 AAAGAAATGGAAAATTTGGATGG - Intronic
1119845564 14:77827055-77827077 AAAGAAATGCATAATTTGGCTGG + Intronic
1119906522 14:78308449-78308471 AGAGAAAAGCAGGCTTTGCAGGG - Intronic
1120548503 14:85840564-85840586 ATAGAAATGCAAAGTTGGGAAGG + Intergenic
1120587134 14:86326758-86326780 AATTAAATACAGTCTTTGGATGG - Intergenic
1121363361 14:93283372-93283394 AAAATAATGCAGAATTTGGCTGG - Intronic
1121364757 14:93299081-93299103 AAATAAACACAGACCTTGGAAGG + Intronic
1121480869 14:94271665-94271687 AAAGATATACTGATTTTGGAAGG + Intronic
1122527646 14:102399532-102399554 AAAGAAATGAAGATCTTGGCCGG + Intronic
1123634002 15:22284681-22284703 AAAAAAACACACACTTTGGAAGG - Intergenic
1123677244 15:22722970-22722992 AAAGAAATGCAGACCTGGCTGGG - Intergenic
1124321355 15:28714116-28714138 AAAAAAATGAACACTTTGGCCGG - Intronic
1124329454 15:28797239-28797261 AAAGAAATGCAGACCTGGCTGGG - Intergenic
1124481143 15:30081234-30081256 AAAAAAATGAAAACTTTGGCCGG + Intergenic
1124487593 15:30133336-30133358 AAAAAAATGAACACTTTGGCCGG + Intergenic
1124522453 15:30415942-30415964 AAAAAAATGAACACTTTGGATGG - Intergenic
1124536211 15:30550272-30550294 AAAAAAATGAACACTTTGGATGG + Intergenic
1124542682 15:30602314-30602336 AAAAAAATGAACACTTTGGCCGG + Intergenic
1124755935 15:32404987-32405009 AAAAAAATGAACACTTTGGCCGG - Intergenic
1124762441 15:32457319-32457341 AAAAAAATGAACACTTTGGATGG - Intergenic
1124776187 15:32591752-32591774 AAAAAAATGAACACTTTGGATGG + Intergenic
1125246582 15:37647634-37647656 GAATAAATTAAGACTTTGGAAGG + Intergenic
1125271054 15:37939176-37939198 AACCAAGTGCAGGCTTTGGAGGG - Intronic
1125345095 15:38711230-38711252 AAGGAAACACAGAATTTGGATGG + Intergenic
1125648748 15:41295491-41295513 AAAAAAATGCACACCTTGGCCGG - Intergenic
1127716226 15:61651744-61651766 AAAGATATTTAGACTTTGCAGGG + Intergenic
1129877927 15:78988937-78988959 AAAGAAACCAAGACTCTGGAAGG - Intronic
1129895983 15:79106250-79106272 AAAGAAATGGAGGCTCAGGAAGG + Intergenic
1130663661 15:85851379-85851401 AAATAAATGCAGACTATGGCTGG - Intergenic
1131456352 15:92585392-92585414 AAAGCAATGTCCACTTTGGATGG - Intergenic
1131672551 15:94634907-94634929 AAAGAAATGCACACTTTCCTGGG + Intergenic
1132009817 15:98266274-98266296 AAGGAAATGCAGACGTGGGAGGG - Intergenic
1132122632 15:99191073-99191095 AAAGAAATGTAGACTAGGCACGG - Intronic
1132790303 16:1682681-1682703 AAAAAAATGTAGAATTAGGAGGG + Intronic
1132927128 16:2436675-2436697 ACAGAATTGCAGGCTTTAGAGGG - Intronic
1133012373 16:2921200-2921222 AATGAATTGTAGACTTTAGATGG - Intronic
1133647420 16:7777214-7777236 ATAGAAATGGAAGCTTTGGAAGG + Intergenic
1133662621 16:7933663-7933685 AAAAAAAAGCAAACTTTAGATGG - Intergenic
1133855574 16:9546417-9546439 AAAGTAAAGCAGAGTATGGAAGG + Intergenic
1134267926 16:12707660-12707682 AAAGAAAGGCTGACTTGGGAAGG + Intronic
1134855877 16:17518610-17518632 ACAGAAATGTAAACTTTGGATGG - Intergenic
1135460806 16:22641072-22641094 AATGAACTTCAGCCTTTGGAAGG + Intergenic
1135692568 16:24554311-24554333 AAAAATAGGCAGACTTTTGAGGG + Intronic
1135715126 16:24757667-24757689 AAGGAAGAGCAGACATTGGAAGG + Intronic
1135823347 16:25704388-25704410 AGAGAGATTGAGACTTTGGAAGG + Intronic
1136588849 16:31204923-31204945 AAGGAAATGGAGATTCTGGAAGG - Intergenic
1138364129 16:56458999-56459021 AAAGATATGCATACTTTTAAGGG - Intronic
1138432009 16:56975074-56975096 AAAGAAATGAGGAAGTTGGAGGG - Intronic
1139112872 16:63913284-63913306 AAAGAAATGCACACTTTGAAAGG + Intergenic
1139557380 16:67720954-67720976 AGGCAAATGCAGACTTTGGTTGG - Intergenic
1139746019 16:69075160-69075182 AAAAAAAAGCAGACTTTGGAAGG - Intronic
1139916977 16:70434448-70434470 AAAAAAATTCAGACTTTTGGGGG + Intronic
1141081406 16:81056398-81056420 AGAGAAAAGCAGACTTCGCAGGG + Intronic
1141569330 16:84924808-84924830 AAAGCAATGATGACTTTGGAGGG + Intergenic
1142526537 17:545861-545883 CAAGAAATGCTGACATTGTAAGG + Intronic
1142707771 17:1707587-1707609 GAAGAAATGCTGATGTTGGATGG - Exonic
1143415643 17:6747167-6747189 AAAAAAATACAGATTCTGGAGGG + Intergenic
1143458516 17:7083858-7083880 TCAGAGATGCAGACTTTGAAGGG + Intergenic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144818338 17:18052643-18052665 AGAGAAATGTAGACTTTTTACGG + Intronic
1146256788 17:31396219-31396241 AAAGAAATGCAGATTTTTGAGGG + Intronic
1146433092 17:32817815-32817837 AAAGAAATGGAGACTTTAAGAGG + Intronic
1146939863 17:36836891-36836913 AAAGAAAGGCAGAGTGTGGGTGG + Intergenic
1146966593 17:37036454-37036476 AAAGAAATGCTATCTTTGAAAGG + Intronic
1147479352 17:40744544-40744566 AAAGAAAGGCAGACTTGGCTGGG - Intergenic
1148730020 17:49828538-49828560 AAAGAGAAGCAAACTTTGGCAGG - Exonic
1149271513 17:54983592-54983614 AAAGAAATGCAGAGTTCAAATGG - Intronic
1149278229 17:55069774-55069796 AATTAAATGAAGACTCTGGATGG - Intronic
1150107001 17:62469628-62469650 AAAGAAAAGCAGACTGTTTAAGG + Intronic
1150481654 17:65515925-65515947 AGAGAAATGCAGACTTTTGCAGG - Intergenic
1150841995 17:68617123-68617145 ACAGAAATGGACATTTTGGAAGG + Intergenic
1150919121 17:69465008-69465030 AAATAAATGCACAGTCTGGATGG - Intronic
1151343007 17:73483955-73483977 AAAGAAATGCTGAGATTTGAGGG + Intronic
1151380205 17:73720456-73720478 AAAGAGATGCAGACACTGGCAGG - Intergenic
1151425166 17:74026286-74026308 AAATAAATCTAGACTTTGGCCGG + Intergenic
1152135731 17:78502150-78502172 AAAAATATACAGACTCTGGATGG - Intronic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1155033864 18:22007632-22007654 AAAAAAAGGCACACTTTGGGAGG + Intergenic
1155202854 18:23532676-23532698 AAAGAGATGAGCACTTTGGAAGG - Intronic
1155680162 18:28477732-28477754 AAATAAATGGTGACTGTGGAAGG - Intergenic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1156266475 18:35493028-35493050 AAAAGAATGTAGACTCTGGACGG + Intronic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157051922 18:44176174-44176196 AAAGAAATACTGACTCTAGAGGG - Intergenic
1157245107 18:46046745-46046767 AATGAAATGCAAACCATGGAGGG - Intronic
1157966582 18:52215612-52215634 AAATAAATTCAGAGTTTGTATGG + Intergenic
1158067011 18:53422725-53422747 AATGTAATCCAGACTTTGCAGGG + Intronic
1158236041 18:55315122-55315144 AAAAAAATGCAGGCTTTGGCTGG - Intronic
1158397080 18:57087934-57087956 AAAGAAATGCAGACATTTTGTGG + Intergenic
1158442154 18:57485911-57485933 AAAGCAATGTACTCTTTGGAAGG - Exonic
1158523011 18:58187368-58187390 TAAGAAGGGCAGCCTTTGGAAGG + Intronic
1158610650 18:58937267-58937289 AAAGAAAGGCAGACTTCAAACGG - Intronic
1158724539 18:59958139-59958161 CAAGATATGAAGACCTTGGAAGG + Intergenic
1158967213 18:62633004-62633026 GAAGAAATGTGGACTTTGGAAGG - Intergenic
1159346545 18:67214092-67214114 AAGGAAATCCAATCTTTGGAAGG - Intergenic
1159642424 18:70879123-70879145 AAAGAAATTGTGCCTTTGGATGG + Intergenic
1159909771 18:74134713-74134735 CTAGAAATGCAGACTAGGGATGG + Intronic
1160081411 18:75730999-75731021 AAAGAAATGCAGACTGTGCTTGG + Intergenic
1160327767 18:77966670-77966692 AATGGAATGCAGACACTGGATGG - Intergenic
1160514596 18:79471435-79471457 AAAAAAATACTGACTTTGGTAGG - Intronic
1162621221 19:11846061-11846083 AAAGAAATCCAGACATTTGTTGG - Intergenic
1162649212 19:12073151-12073173 AAAAAAAAGCAGACTGTGGTAGG - Intronic
1162955288 19:14094158-14094180 AAAGAAATGCAGATTCTTGCTGG - Intronic
1164655164 19:29915693-29915715 AAAGAAATGAAGAGTCTGGATGG - Intergenic
1164770965 19:30808620-30808642 AGAGAAAGGCAGAGTTGGGATGG + Intergenic
1165833418 19:38740810-38740832 AAAAAAATTCAGACTCTTGACGG + Intronic
1166506029 19:43372374-43372396 AATGAAGGGCAGGCTTTGGATGG + Intergenic
1168141293 19:54389153-54389175 GAAGGACTGCAGACTGTGGATGG - Intergenic
1168531789 19:57136073-57136095 AAAAAAATGGGGACATTGGAGGG - Exonic
1168637529 19:58008216-58008238 TAAGAGATGCAGACATCGGAGGG + Exonic
925249258 2:2417293-2417315 TAGGAAATGGAGGCTTTGGAGGG + Intergenic
926787399 2:16531631-16531653 AAAGAACTGCAGCCCTTGCAGGG + Intergenic
928053939 2:28031360-28031382 AAAGAAATGCATACTTTGTATGG - Intronic
928350575 2:30549478-30549500 AAAGAAATTCAGAATTTGGAGGG + Intronic
930487790 2:52029514-52029536 AAAGAAATGCTTACTTTATATGG - Intergenic
930626798 2:53707663-53707685 AAAGAAATGCAGAGTATGCCGGG + Intronic
930665112 2:54094175-54094197 AAAGAAAGGAAGATTTTGGTAGG + Intronic
930785335 2:55266696-55266718 AAAGAAATTAAGGCTCTGGACGG + Intronic
931906018 2:66844844-66844866 CAAGAAATGTAGAGTTTGTAAGG + Intergenic
933066040 2:77797620-77797642 ACATAAATGCAGAATTTTGAGGG - Intergenic
933268037 2:80203259-80203281 AAATGAGTGGAGACTTTGGAGGG - Intronic
935010123 2:99126470-99126492 AAAGAATTTAAGACTTTGAAAGG - Intronic
935057949 2:99583670-99583692 AAAGAAGTGTAGAATTTGGCTGG - Intronic
935111282 2:100096510-100096532 AAGGAAATGCAAATTTTGAAAGG + Intronic
935349133 2:102139030-102139052 AAACAAATGCAGGGTTTGGAAGG - Intronic
935497923 2:103804651-103804673 GAAGAATTGAAGACTTTGAAGGG - Intergenic
935930069 2:108114179-108114201 AAAGAAATGAAGTCTTAAGATGG - Intergenic
936123687 2:109768654-109768676 AAGGAAATGCAAATTTTGAAAGG - Intergenic
936220999 2:110602812-110602834 AAGGAAATGCAAATTTTGAAAGG + Intergenic
936993187 2:118387367-118387389 GAAGAAATGCAGCCTTTTGAAGG - Intergenic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
937630596 2:124097242-124097264 AAACTAATGAAGGCTTTGGATGG + Intronic
937842602 2:126538762-126538784 AAACTAATGGAGAATTTGGAGGG + Intergenic
938394662 2:130934838-130934860 TAAGAAATACAAACTTTGGCCGG - Intronic
939117294 2:138074940-138074962 GAAGAAATGAAGACATTTGAGGG + Intergenic
939261439 2:139815432-139815454 ATAGAAAAGGGGACTTTGGAAGG + Intergenic
939272144 2:139953750-139953772 AAAGAGATGAAGACTTTAAAGGG + Intergenic
939909026 2:147957021-147957043 AAAGACCTACAGACTTTGGAAGG + Intronic
940084469 2:149842833-149842855 ATAGAAATGCGTAATTTGGAAGG + Intergenic
940133355 2:150408897-150408919 AAATGAATGAAGACTTTGAAAGG + Intergenic
940454824 2:153883651-153883673 AAAGAAATGGAGGGTTTGGTTGG + Intronic
940741527 2:157515050-157515072 AAAGAAATGCAGATTGGGGCTGG - Intergenic
941147371 2:161866308-161866330 AAAGAATGGTAGACTTGGGAAGG - Intronic
941147521 2:161869267-161869289 CAATAAATTCAGATTTTGGAAGG - Intronic
941261421 2:163303117-163303139 AAAGAATTGGCTACTTTGGAGGG + Intergenic
941540884 2:166782637-166782659 AATGCAATTCAGACTTTGGAAGG - Intergenic
941818283 2:169820250-169820272 AAAGACATGCATAGTTTGGCCGG - Intronic
942688585 2:178560983-178561005 AGATAAATGCAGACATTGCAGGG - Exonic
943732731 2:191320040-191320062 AAGGAAAGGGTGACTTTGGAAGG + Intronic
944456189 2:199897288-199897310 AATAAAATGAAGAATTTGGAAGG - Intergenic
944493793 2:200285472-200285494 AAAAAAAGGCAGATTTTGGAAGG + Intergenic
945019161 2:205553809-205553831 AAAGAAATGTGAACTTAGGAAGG + Intronic
945043015 2:205758170-205758192 AGAGATAGGCAGACCTTGGAAGG + Intronic
945050270 2:205817433-205817455 AAAGAAAACCAGATTTTGTAGGG + Intergenic
945172285 2:207009214-207009236 AAATCAATAAAGACTTTGGAGGG + Intergenic
945179489 2:207077261-207077283 AAAGAAATGGGGCTTTTGGATGG - Exonic
945380888 2:209138605-209138627 AAAGAAAAGGAGCCTATGGATGG - Intergenic
945458320 2:210074263-210074285 AAAGACAAGCAGAGTTTTGAAGG - Intronic
945793046 2:214329378-214329400 GAATAAATGAAGACTTTTGAAGG - Intronic
946852530 2:223920935-223920957 AAAGAAAAACAGACTTCTGAGGG - Intronic
948164400 2:235850200-235850222 AAAGGAATGGAGATTCTGGAAGG + Intronic
948762689 2:240202477-240202499 AAAAAAATGTAGAGTTTGCAAGG + Intergenic
1170191613 20:13650352-13650374 AGAGAAATGCAGACGTGGTATGG + Intergenic
1170199690 20:13729462-13729484 AAAGTGATGCAGACATTTGAAGG + Intronic
1170312515 20:15007942-15007964 AAAGAAATGTAGGATCTGGAGGG + Intronic
1170594017 20:17792186-17792208 GTAGAAATGCAGAGTATGGAGGG + Intergenic
1170998539 20:21390999-21391021 AAAGAGATGAAGACTAAGGATGG - Intergenic
1172753548 20:37268012-37268034 AGAGAAAGGCAGACTTTAAAAGG + Intergenic
1172907827 20:38382125-38382147 AAAGAAATGCAGGCTAGGCATGG - Intergenic
1172976825 20:38912366-38912388 TTAGAAATGCAGACTTTGGCTGG + Intronic
1173163509 20:40670040-40670062 AAAGAGAGGCAGCTTTTGGAGGG + Intergenic
1173238966 20:41276236-41276258 AAAGAAAAACAGACTTTTAAGGG - Intronic
1173451777 20:43171019-43171041 AAAGAAATGCAGTCTTAGTGAGG - Intronic
1173902278 20:46599768-46599790 AAAAAAATGCAGACATGGAAAGG - Intronic
1175029732 20:55940043-55940065 TAGGAGATGCAGTCTTTGGAAGG - Intergenic
1175428075 20:58882767-58882789 TAAGAAAGACAGACTTGGGAAGG - Intronic
1176920568 21:14683299-14683321 TAAGAAATGCAGCCTTTAGGAGG + Intergenic
1177009468 21:15714870-15714892 AAAGAAATGTAAACTTAGAATGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177391471 21:20479003-20479025 ATACAAATGCTGAATTTGGAAGG - Intergenic
1177406203 21:20672011-20672033 AAAGAAATACACACTTTGATAGG + Intergenic
1177718777 21:24877131-24877153 AAATAACTGCAGACTTAGGCAGG + Intergenic
1178642419 21:34355818-34355840 AAAGAAAAGCAGAGGCTGGAGGG + Intergenic
1180151929 21:45952982-45953004 AAAGAAATGCAAAGATTGGAAGG - Intergenic
1180173072 21:46070771-46070793 AGAGAAAGGCGGGCTTTGGAGGG - Intergenic
1180201551 21:46227819-46227841 AAAGAGTTTCAGACTTTTGATGG - Intronic
1180818800 22:18810712-18810734 AAAGAAATCCATGCTCTGGAGGG + Intergenic
1181205024 22:21245167-21245189 AAAGAAATCCATGCTCTGGAGGG + Intergenic
1181816804 22:25444266-25444288 TAAGAAAAGCAAACTTTGGGGGG + Intergenic
1181838410 22:25630547-25630569 AAAGCAATCCAGCCATTGGAAGG + Intronic
1181875590 22:25938045-25938067 TAAGAAATGGTGTCTTTGGAAGG - Intronic
1182080554 22:27525733-27525755 AAATAAATAAAGATTTTGGAAGG + Intergenic
1183065694 22:35361213-35361235 AAAGAAATGGAGATTTTGCAGGG + Intergenic
1184107575 22:42377058-42377080 TAAGAAGTGCAGGCTCTGGAAGG - Intergenic
1203221901 22_KI270731v1_random:50248-50270 AAAGAAATCCATGCTCTGGAGGG - Intergenic
1203268928 22_KI270734v1_random:36565-36587 AAAGAAATCCATGCTCTGGAGGG + Intergenic
949252482 3:2003552-2003574 GAAGAAATGGAGACTTTGATCGG - Intergenic
949274408 3:2261025-2261047 AAAGAAATGAAAACTTAGGCCGG - Intronic
950028864 3:9838772-9838794 AAAGAATGGCAGACTTAAGAGGG + Intronic
950894830 3:16439468-16439490 TACAAAATGAAGACTTTGGATGG + Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
952544428 3:34403640-34403662 AGAGTAATGCAGCCTTTGTAAGG - Intergenic
953713188 3:45292564-45292586 AAAGAATTTCAGACATAGGAAGG + Intergenic
954620911 3:51994905-51994927 AAGGAATTGCAGGCTTTGGGTGG + Intronic
955531923 3:59882494-59882516 AGAGAAATCCAGACTTGGCAAGG + Intronic
955594265 3:60571640-60571662 AAATAAAGGCAGGCTTTAGAGGG + Intronic
956395473 3:68821601-68821623 AAAAAAAAGCACACTTTGGGAGG - Intronic
957171107 3:76737854-76737876 TAAGAAATGCAGACTGGGAACGG + Intronic
957628810 3:82691878-82691900 AAAGATATGTTGAATTTGGAAGG + Intergenic
958638403 3:96775659-96775681 AAAAAAATGCATACTTTTCATGG + Intergenic
958893024 3:99801346-99801368 AAAGAAATGTAGAATTTGGATGG + Intergenic
959060367 3:101611137-101611159 AAAGATAACCAGACCTTGGAGGG - Intergenic
960142362 3:114163419-114163441 AAAGAAATGGAGACCTGGAAGGG + Intronic
960244783 3:115388174-115388196 AAAGAAATGCAGCTCTTGGACGG - Intergenic
960480417 3:118181066-118181088 AAAGTAAGGTAGACTCTGGAAGG - Intergenic
960677441 3:120209924-120209946 AAACAAATGAAGACTATGGTTGG + Intronic
960823359 3:121757769-121757791 GAAGAAATGCACATTCTGGAAGG + Intergenic
961100894 3:124198137-124198159 AAAGAAGGGTAGATTTTGGATGG + Intronic
961179448 3:124865100-124865122 AAAGAAATGCTGCCTTCAGAAGG - Intronic
961192356 3:124972532-124972554 ATGGGGATGCAGACTTTGGATGG - Intronic
961769953 3:129241758-129241780 AAACAAATGCTGACTTTGGGAGG + Intergenic
963087219 3:141449257-141449279 AAAGTAATGCAGCTTTAGGATGG + Exonic
964144954 3:153448563-153448585 AAAGAAATGAATATTTTGAATGG + Intergenic
964641632 3:158915214-158915236 AAACAAATGGCGACTGTGGAAGG + Intergenic
964838675 3:160969713-160969735 CAAGAATTGGAGAATTTGGAAGG + Intronic
965842011 3:172917010-172917032 AAAGAAAAGGAGACTGTGCAAGG - Intronic
966030669 3:175343539-175343561 AAAGAAATGCAGATTGTAGAAGG - Intronic
967144017 3:186590740-186590762 AAAGAAATGTTGACATTGGTGGG + Intronic
967148432 3:186626436-186626458 AAGGAGATGCAGATGTTGGATGG - Intergenic
967627237 3:191701520-191701542 AAACATATGAAGACTTTGAAGGG + Intergenic
967936822 3:194735226-194735248 AAAGAAAAGCAGCTTTTGTAAGG - Intergenic
968265795 3:197362532-197362554 AAAGAAATACAGATGTTGAAAGG - Intergenic
968840394 4:3000393-3000415 AGAAAAATTGAGACTTTGGAGGG + Intronic
969044507 4:4327120-4327142 AAAGAAATATAGACTCTTGAAGG + Intergenic
970014119 4:11493528-11493550 AAATAAATGAAGTGTTTGGAAGG - Intergenic
970114912 4:12684080-12684102 AAAAGAGAGCAGACTTTGGAAGG - Intergenic
970597594 4:17614428-17614450 TAAGAATTGAAGACTTTGGCCGG - Intergenic
972456742 4:39262887-39262909 AAAGAAATGGAGGATTGGGAAGG - Intronic
972796689 4:42428348-42428370 AAGGAAGAGCAGCCTTTGGAGGG - Intronic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
973956513 4:56068448-56068470 TGAGACAGGCAGACTTTGGAGGG + Intergenic
974139064 4:57860626-57860648 AAAGAATTTCAGACTTAGAAGGG + Intergenic
975419122 4:74141546-74141568 AAAGGAAGGAAGACCTTGGAGGG - Intronic
976883460 4:89958934-89958956 AAAGACATGCAATCTCTGGAGGG - Intergenic
977271128 4:94918378-94918400 AAAGAAATGCAACTTCTGGATGG + Intronic
977497137 4:97791057-97791079 AAAGCAAAGCAGACTTCTGAAGG + Intronic
977715808 4:100182411-100182433 AAAGAATTCAAGACTTTGGGAGG + Intergenic
979904248 4:126264938-126264960 TGAGAAATGCTGAGTTTGGAAGG + Intergenic
980672978 4:136033686-136033708 AAAGAAATGGAAACTTTAGAGGG + Intergenic
982062727 4:151620943-151620965 AAACAAATGCAGAGAGTGGAGGG + Intronic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
982501829 4:156167351-156167373 AAAGAAACTCAGTATTTGGATGG + Intergenic
982625969 4:157766841-157766863 AAACAAATCCAGACTTAGTAAGG + Intergenic
982670666 4:158316823-158316845 AAAGAGATACAGCCTTTGAAAGG + Intronic
983031825 4:162812144-162812166 AAAGAAATGCAGAATATTGTTGG + Intergenic
983123606 4:163920461-163920483 AAAGTAAAGCAGGCTTTAGAAGG - Intronic
983326383 4:166262786-166262808 AAAGAAAAGAGGATTTTGGAGGG + Intergenic
983691782 4:170479580-170479602 AAATGAATGCATATTTTGGATGG - Intergenic
983877240 4:172892077-172892099 AATAAAATCCAGAATTTGGATGG - Intronic
984506661 4:180628082-180628104 TAAGAAATACAGTCTTTAGATGG + Intergenic
984710815 4:182882773-182882795 CAAGAAATGCAGACATAGAAAGG + Intergenic
985051542 4:185996948-185996970 AAAGAAAAATATACTTTGGAAGG - Intergenic
985423231 4:189804627-189804649 CAACAAATGCACACTTTTGATGG - Intergenic
985912267 5:2893676-2893698 AAAGAAATGGAGACACAGGAAGG - Intergenic
986280582 5:6318829-6318851 TAAGACATGGGGACTTTGGAAGG + Intergenic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
988046342 5:25960575-25960597 AAAGAAATGGAAAATATGGAAGG + Intergenic
988127114 5:27054651-27054673 AAAGAAATGCAGAGTTGGTAGGG - Intronic
988225994 5:28412013-28412035 AAATAAATGTTGACTGTGGAAGG + Intergenic
988406633 5:30832505-30832527 AAATAAATGCTGAATTGGGAGGG + Intergenic
989275332 5:39582184-39582206 AAAGAAATGAATACTTTGGGAGG - Intergenic
989304572 5:39938442-39938464 AAAAAAGTGCAGAATTTGGAAGG + Intergenic
989686007 5:44088251-44088273 AAGGCAATGCAGACTTTAGCAGG + Intergenic
989766629 5:45092673-45092695 AAAGAAATGAAGATTTTAGAAGG + Intergenic
990243462 5:53838588-53838610 TCCGAAGTGCAGACTTTGGAAGG + Intergenic
990340725 5:54820339-54820361 AAGGAAATGCTGTCTTTTGAGGG + Intergenic
990927055 5:61037957-61037979 CAAAAAATGCAGACTTCTGAGGG + Intronic
991259861 5:64655395-64655417 TAAGAAGTGGGGACTTTGGAAGG - Intergenic
991491123 5:67183502-67183524 AAGGAAATGGAGGTTTTGGAAGG + Exonic
992335016 5:75758144-75758166 AAAGAAATGCACAGAATGGACGG + Intergenic
992774106 5:80074867-80074889 AAAGAGATGCACACTTTGGGAGG - Intronic
993548263 5:89240535-89240557 ATACAAATGGAGACTTTGCAAGG - Intergenic
995054236 5:107741768-107741790 GAAGGGGTGCAGACTTTGGAGGG + Intergenic
995058263 5:107786512-107786534 AAGGAAATGGAGCCTTTGGGAGG + Intergenic
995423845 5:111997126-111997148 AAACAATGGCAGACTTTTGAAGG - Intronic
996671136 5:126118881-126118903 AAAGAAAGTAAGAATTTGGATGG + Intergenic
996796154 5:127350636-127350658 AATGAAATACAAACTGTGGAAGG + Intronic
996823921 5:127660183-127660205 AAAGAAGGGCAGGCTTTGGGAGG - Intergenic
997212227 5:132083659-132083681 CAAGAACTGCAGGCTTTTGAAGG - Intergenic
997476997 5:134148717-134148739 AAAAAGATGCAGTCTTTGGGAGG - Intronic
998362704 5:141603486-141603508 AAAAAGATGCTGATTTTGGAAGG - Intronic
998653757 5:144151588-144151610 AAAGACATGAAGAATTCGGAAGG + Intergenic
998727305 5:145032190-145032212 AAAGAAATACAAACTTTCAATGG - Intergenic
998889020 5:146726584-146726606 AAAGAAATTGAGACTTTGAAAGG + Intronic
1000257489 5:159554076-159554098 AAAGAAATGAAGAGTTTTGTGGG + Intergenic
1000990883 5:167910531-167910553 AAAGAAATGCAGATGCTAGAAGG - Intronic
1001116402 5:168944392-168944414 AAAGAAATGCAGACTTCTGAAGG + Intronic
1001673504 5:173493388-173493410 AAAGAGAGGAAGCCTTTGGAAGG + Intergenic
1003862973 6:10338647-10338669 TAAGAATTGCGGACTTTGGCTGG - Intergenic
1003981296 6:11392759-11392781 AAAGAAATGCAGAGCTTGAATGG + Intergenic
1004879210 6:19989489-19989511 AAAGCAATGCAGCCTGTGGCAGG - Intergenic
1005270609 6:24159487-24159509 AAAAAAAAGTAGACTTGGGAAGG + Intergenic
1005926353 6:30448665-30448687 GAAGAAATTCAGACATTGCAAGG + Intergenic
1005965524 6:30723838-30723860 AAAGAAATGGAGACGTGGGAAGG - Exonic
1006628430 6:35413972-35413994 AAAGAAATGCACACTTGGCCAGG - Intronic
1006900610 6:37498523-37498545 AAAAAAATGCAGATTCTGGCCGG + Intronic
1007189327 6:39999902-39999924 AAAGAAATGGAGATGTGGGAAGG - Intergenic
1007407040 6:41641111-41641133 AAAGAAATGAAGACTAGGGGTGG - Intronic
1007856062 6:44859039-44859061 AAAGTAATGCAAACTCTGAAAGG - Intronic
1008051898 6:46908755-46908777 AAAGAAATGGAGATGTAGGAAGG + Intronic
1008138320 6:47802533-47802555 ATAGACATGCAGAGTTTAGAAGG - Intronic
1008243226 6:49138257-49138279 ATAGAAATTCTGACATTGGAGGG - Intergenic
1008254780 6:49283514-49283536 TAAGAAATGGAGAACTTGGAAGG - Intergenic
1008396542 6:51015294-51015316 AAGGAAATGCTGAGTTTGGGGGG - Intergenic
1008503683 6:52208628-52208650 AAAGAAATGCATACCTTTGATGG + Intergenic
1008551330 6:52634837-52634859 AAAGAAAAGAAGACTCTGAAAGG + Intergenic
1009774599 6:68189942-68189964 AGAGACATGTAGAGTTTGGAGGG - Intergenic
1009802443 6:68556501-68556523 AAATAGATGAAGACTATGGAGGG + Intergenic
1010170244 6:72966602-72966624 AAAGAAAAGCATATTTTGAAAGG + Intronic
1011232988 6:85184631-85184653 AAAGAAATTCACAGCTTGGAAGG + Intergenic
1011292433 6:85790700-85790722 TAAGAAATGAGGTCTTTGGAAGG - Intergenic
1011638550 6:89398517-89398539 AAAGTACTGCAGAATTTGGATGG + Intronic
1011807389 6:91087598-91087620 AAATAAATATAGACTTTGGTTGG - Intergenic
1011882784 6:92051680-92051702 ATAGAAATGCAGACTATAAAAGG + Intergenic
1012053633 6:94375769-94375791 AAAGAAATTCAGAATTTGAGTGG + Intergenic
1012180751 6:96149659-96149681 AAAGAAATGCTTGCTTTTGATGG - Intronic
1012875394 6:104720557-104720579 AATGCACTGCAGTCTTTGGAGGG + Intergenic
1013395081 6:109727940-109727962 AACTAAATGCAGATTTTGGTCGG + Intronic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1013744408 6:113327859-113327881 AGGTAAATGGAGACTTTGGATGG + Intergenic
1013753856 6:113438089-113438111 AATGAATTGCAGGCTTTGGTAGG - Intergenic
1013920808 6:115400888-115400910 AAAGAACTGCTGATTTTGGGGGG + Intergenic
1014489030 6:122038620-122038642 AAAGAAATGAAGACTCTCAATGG + Intergenic
1014512631 6:122343171-122343193 AAATAAATGCAGACATTTGATGG + Intergenic
1014694517 6:124602524-124602546 AAATAAATGCAAATTGTGGATGG + Intronic
1014847692 6:126298766-126298788 TAAGAAATGAGGTCTTTGGAAGG - Intergenic
1015700776 6:136033963-136033985 AAAAAAATGCAAACTATGGAGGG - Intronic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016168501 6:140977742-140977764 AAAGCAATGCAGGATTAGGAGGG - Intergenic
1016379467 6:143460031-143460053 AAAGAAAAACAGGCTTTGCATGG - Intronic
1016442370 6:144096665-144096687 ACCGAAATGCAGACTTTTTAAGG + Intergenic
1016667564 6:146659790-146659812 AAAGGAATGCTGCCATTGGAAGG - Intronic
1016780764 6:147955326-147955348 AAAGATATTCACAGTTTGGAGGG + Intergenic
1017137001 6:151156685-151156707 AAAGAAATATAGACTTTGGCCGG + Intergenic
1017625074 6:156339759-156339781 AAAGAAATGCAGATGCTGGAAGG - Intergenic
1018504158 6:164445797-164445819 ACAGGAATGCAGTCTCTGGATGG + Intergenic
1019074829 6:169378886-169378908 AAAGCAATTCAGGGTTTGGAGGG - Intergenic
1020872911 7:13656051-13656073 AAAGAAAAGCAGAGTTAGGGTGG - Intergenic
1022118876 7:27287596-27287618 ACAGAAAGACAGACTTTGCATGG + Intergenic
1022668496 7:32432801-32432823 AAATAAATCCAGACTTAGCAAGG - Intergenic
1022768883 7:33447740-33447762 ACACAAATGCTGACTTTTGATGG + Intronic
1022977769 7:35574799-35574821 AGAGAAAGGCAGAGTCTGGAAGG + Intergenic
1023671011 7:42576730-42576752 AAAGAAATGCAGAATTATAATGG + Intergenic
1023786502 7:43713620-43713642 GAAGAAATACAGACTTTGCAGGG - Intronic
1024093843 7:45968829-45968851 AGAGAAATCCTGACTTGGGAAGG - Intergenic
1024199916 7:47096212-47096234 AAAGAAAAGCAGATGCTGGAGGG + Intergenic
1025041091 7:55646393-55646415 AAAGAAATGGAGATATGGGAAGG - Intergenic
1027288954 7:76681207-76681229 AAAGAAATGCAGAATTTCCTAGG + Intergenic
1028138284 7:87245428-87245450 AAAGAAAAGCATACTTTCTAGGG + Intergenic
1028823316 7:95238593-95238615 AAAGAAAAATAGACTTTGTATGG - Intronic
1029099701 7:98118794-98118816 GTAGAAATGCAGATTTTGGCCGG + Intronic
1029792751 7:102862348-102862370 AAAGAAATGGACGTTTTGGAGGG + Intronic
1030779558 7:113582993-113583015 AAACATATGGAAACTTTGGATGG + Intergenic
1031405572 7:121382101-121382123 GAAGAAATGCATACTTTACATGG - Intronic
1031430456 7:121661993-121662015 ACAGAAATGAATACTTTTGATGG - Intergenic
1031553057 7:123138394-123138416 AAAGAAAATCAGTATTTGGAAGG - Intronic
1031599605 7:123690629-123690651 AAAGAAAGGGAGAGTTGGGATGG + Intronic
1032184174 7:129709350-129709372 AAAGAATATCAGTCTTTGGAGGG - Intronic
1032211208 7:129915759-129915781 AAAGACAGGCAGAGTTAGGAGGG - Intronic
1032339150 7:131054689-131054711 AAAGAACTGGAGACAGTGGATGG - Intergenic
1032381281 7:131484759-131484781 AAAGAAATGTTGAGTTTGGTTGG + Intronic
1032663383 7:134010836-134010858 AAAGAAATGAAGGATCTGGAGGG + Intronic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1033031495 7:137831735-137831757 AAATGAGTTCAGACTTTGGAGGG - Intronic
1033328685 7:140399879-140399901 AAAGATATGCGAACTTTGGCCGG - Intronic
1033507675 7:142021867-142021889 AAAAAAATGTATACTTTAGAAGG - Intronic
1035495664 7:159323547-159323569 AAAGAAATGCTGACTTGGCATGG + Intergenic
1036040797 8:5078688-5078710 AAAGAAATTCAGTCTCTAGAAGG + Intergenic
1036942579 8:13065734-13065756 ATAGAAATCCAGACTTTGAGGGG - Intergenic
1038757222 8:30352783-30352805 AAAGAAATGGAGACGTGGGAAGG - Intergenic
1038917674 8:32042699-32042721 AAAGAAATACAGACATTTTATGG + Intronic
1038978352 8:32726698-32726720 AACAAAATGTAGACTTTCGAAGG + Intronic
1040102253 8:43516251-43516273 AAAGAATGGGAGAGTTTGGAGGG + Intergenic
1041248186 8:55908753-55908775 CAGGCAATGGAGACTTTGGAGGG - Intronic
1041337472 8:56803103-56803125 AAAAGAATGCAGATTTTGAAAGG + Intergenic
1041419493 8:57650384-57650406 AAAGAAATGCTAACATTCGAGGG + Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042421282 8:68592119-68592141 AAATAAATGGAGACATTGCAGGG - Intronic
1042952304 8:74213755-74213777 AAAGAAGTGCAGCCTTTAGGAGG - Intergenic
1043421807 8:80105715-80105737 AAAAAAAAGCAGACCTGGGATGG - Intronic
1043529616 8:81135058-81135080 AAAGAGGTGGAGACTTTGTATGG - Intergenic
1043706252 8:83354856-83354878 AAATAAATGCACACTATGCAGGG - Intergenic
1044077499 8:87840905-87840927 AAACAAAAGCAGCATTTGGAGGG + Intergenic
1045057307 8:98380707-98380729 AAAGAAATGCAAATTTTTCATGG - Intergenic
1045181745 8:99791766-99791788 AAACAAAGGCAGATTTTGGAGGG + Intronic
1046054414 8:109061966-109061988 AAAGAAATGAAGAAATCGGAAGG + Intergenic
1046494707 8:114998553-114998575 AAAGAAATGTAGACCTAGAAGGG - Intergenic
1046780309 8:118207879-118207901 AAAGAAAAGCACACTTTTAAAGG + Intronic
1047724666 8:127673554-127673576 AAAGAAATGCATTCTTTTTAAGG - Intergenic
1047895621 8:129363328-129363350 ATAGAAATGCAGCCTTTAGAGGG - Intergenic
1049201810 8:141343968-141343990 GAAGAAATGCAGACTCAGGATGG - Intergenic
1050115614 9:2260435-2260457 AATGAAATGCAGTCTTATGAAGG - Intergenic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1051038060 9:12773374-12773396 AAAAAAATGTAAACTTTTGAAGG - Intergenic
1051274465 9:15385922-15385944 AAAGAAATGCTCACTTTAGGAGG + Intergenic
1052175239 9:25453650-25453672 AAGGAAAGGCAGAATTTAGAAGG + Intergenic
1052320315 9:27160397-27160419 AAAAAAATGCAGACTACAGATGG - Intronic
1052679104 9:31665793-31665815 AAATAAATGTAGAGATTGGATGG - Intergenic
1053459110 9:38254797-38254819 ACAGAAAGAGAGACTTTGGAGGG - Intergenic
1055282320 9:74688983-74689005 AAAGAAAGGGAAATTTTGGAGGG + Exonic
1055327826 9:75150567-75150589 AAATAAATGCATCCCTTGGAAGG + Intergenic
1055417232 9:76096896-76096918 AAAGAAATGCACCTTTTGGTGGG - Intronic
1055417281 9:76097227-76097249 AAAGAAATGCACTTTTTGGCTGG - Intronic
1056486930 9:87068262-87068284 AAAAAATTACAGCCTTTGGATGG - Intergenic
1056852661 9:90097409-90097431 AAACAAATGCACACTAGGGATGG + Intergenic
1056985182 9:91357311-91357333 AAAGAAATGGAGACTTGGAGAGG + Intronic
1057872327 9:98727686-98727708 TAAGAAATGCAGGCCTTGCAGGG - Intergenic
1058395668 9:104551129-104551151 AAGGAAATGCTGAATTTGAATGG + Intergenic
1058565720 9:106283043-106283065 AAAGGAATGCAGAGTGTGCAGGG + Intergenic
1059187345 9:112286556-112286578 AAAGAGACGTATACTTTGGAAGG - Intronic
1059278115 9:113112091-113112113 AAAGAAATACAGTCTTTGCCTGG + Intergenic
1059623428 9:116034645-116034667 AAAAAAATGCAGAATTTGGAGGG - Intergenic
1061131409 9:128710432-128710454 GAGGAAATGCAGGCTCTGGATGG + Intronic
1061835047 9:133323295-133323317 AAAGACAAGCAGACTATGCATGG + Intergenic
1186207569 X:7216403-7216425 CAACAAATGCAGACTTAGTAAGG + Intergenic
1186800147 X:13084352-13084374 AAAGAAATGAAAACTTTCCAAGG + Intergenic
1186990405 X:15060798-15060820 AAACAAATTCAGACTTAGTAAGG - Intergenic
1187542558 X:20212199-20212221 AAAAAAATGCAGAGTCTGGCTGG + Intronic
1188306278 X:28563305-28563327 AAAGAAATGGTGACATTGGCAGG - Intergenic
1188357419 X:29209311-29209333 AAAGCAATTCATACTTTGAAAGG - Intronic
1188375571 X:29424185-29424207 ATAAAAATCCAGACTTTGTAAGG + Intronic
1188870919 X:35370729-35370751 AAAAAAATGCGGACTTTGGGAGG + Intergenic
1189053901 X:37678214-37678236 AAAGAATTATAGATTTTGGAAGG + Intronic
1189341348 X:40206911-40206933 AAAGAAAATGAGACTTTGGCCGG + Intergenic
1189498966 X:41536402-41536424 AAAGTAATGCAGATTTCGGCCGG - Intronic
1189686937 X:43574211-43574233 AAAGACATACAGAATTTTGATGG - Intergenic
1189925981 X:45955847-45955869 AAATAAATGCAAACCCTGGAGGG + Intergenic
1190322893 X:49188798-49188820 AAAGAAAGGCAGAGATTGGGGGG - Exonic
1192476776 X:71450876-71450898 GAAGATAAGCAGACTTGGGAGGG + Intronic
1193127639 X:77886342-77886364 TTAAAAATGCAGACTTTGGCCGG + Intronic
1193739367 X:85199443-85199465 AAAGAAAAGCAGTATATGGAAGG + Intergenic
1194506105 X:94735627-94735649 GAAGAAGGGCATACTTTGGAAGG - Intergenic
1194682085 X:96866788-96866810 AAAGAAATGAAGCCTTTTGGAGG + Intronic
1194770810 X:97902593-97902615 AAGGAAATGGAGACTATGCAAGG - Intergenic
1195749445 X:108149656-108149678 AAAGAAATGCTGACTTTTTATGG - Intronic
1196370915 X:114978927-114978949 AAAGAAATGAAAATTTTGGCCGG + Intergenic
1196693893 X:118590614-118590636 GAGGAAATGGAGACTCTGGAGGG - Intronic
1198236926 X:134744301-134744323 AAAGAAAGGTATATTTTGGATGG + Intronic
1199424068 X:147681119-147681141 AAATAAATGCAGAACTGGGATGG + Intergenic
1199700512 X:150372087-150372109 AAAGAAATGCAGCCAATGGAGGG + Intronic
1199915122 X:152331161-152331183 ACATAAAAACAGACTTTGGAAGG + Intronic
1201285213 Y:12373640-12373662 AAAGAAACGCAGACGTTCAACGG - Intergenic
1201530148 Y:14983010-14983032 AAAGAAAAAAAGACTTGGGAGGG - Intergenic
1201579404 Y:15495071-15495093 AAACAAATGCAGACTTAGTAAGG + Intergenic
1201785854 Y:17778040-17778062 ATGGAAATCCAGACTTTGCATGG + Intergenic
1201815699 Y:18127948-18127970 ATGGAAATCCAGACTTTGCATGG - Intergenic
1202025187 Y:20514422-20514444 AAAGAAATAGAGAATGTGGAAGG + Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic