ID: 950941590

View in Genome Browser
Species Human (GRCh38)
Location 3:16898458-16898480
Sequence CAGCTATTCCTTAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950941590_950941594 -2 Left 950941590 3:16898458-16898480 CCTTTTGTCCTAAGGAATAGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 950941594 3:16898479-16898501 TGCCGGGTATGAATGCTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
950941590_950941596 1 Left 950941590 3:16898458-16898480 CCTTTTGTCCTAAGGAATAGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 950941596 3:16898482-16898504 CGGGTATGAATGCTACCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 23
950941590_950941598 3 Left 950941590 3:16898458-16898480 CCTTTTGTCCTAAGGAATAGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 950941598 3:16898484-16898506 GGTATGAATGCTACCCGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 93
950941590_950941597 2 Left 950941590 3:16898458-16898480 CCTTTTGTCCTAAGGAATAGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 950941597 3:16898483-16898505 GGGTATGAATGCTACCCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 42
950941590_950941599 8 Left 950941590 3:16898458-16898480 CCTTTTGTCCTAAGGAATAGCTG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 950941599 3:16898489-16898511 GAATGCTACCCGGAGGGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950941590 Original CRISPR CAGCTATTCCTTAGGACAAA AGG (reversed) Intronic
904371514 1:30050422-30050444 CAGTTTTTACTTATGACAAAAGG + Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
909235041 1:73142155-73142177 AAACTATACCTTAGAACAAATGG - Intergenic
909625776 1:77714173-77714195 CAGCTATTCATTTAGACAATGGG + Intronic
912402050 1:109402179-109402201 CAGCTATTCATTAGGAACTAAGG + Intronic
912472525 1:109915363-109915385 CATCTCTTCCTTAAAACAAATGG + Intronic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
915782740 1:158570807-158570829 CACCTATGCCCTAGAACAAAGGG - Intergenic
916297476 1:163235630-163235652 CAGCCATTGCTTATGAAAAAAGG - Intronic
918346317 1:183610337-183610359 TGGCTATTCTGTAGGACAAATGG + Intergenic
919299093 1:195738385-195738407 CCCCAATTCTTTAGGACAAATGG - Intergenic
919572017 1:199260807-199260829 AAGCTAATCCTTAGGAAATAGGG + Intergenic
920739696 1:208568980-208569002 CAGGTATTCCTTAGGTAAAGAGG + Intergenic
921999905 1:221466533-221466555 AAGCTATACCTTAGAACAAATGG - Intergenic
924029480 1:239871811-239871833 CAGCTTTTCCTTACGAGGAAAGG - Intronic
1066145305 10:32551912-32551934 AAACTATACCTTAGAACAAATGG - Intronic
1067214126 10:44286396-44286418 CACCTCTACCTTAGGACAGAAGG + Intergenic
1068055274 10:52005428-52005450 CAGGTATTTCTCAGGACAATAGG - Intronic
1068263272 10:54612369-54612391 CAGCTATTCACTAAGATAAAAGG + Intronic
1070389024 10:75952662-75952684 AAGTTATTTATTAGGACAAACGG + Intronic
1071062776 10:81592470-81592492 AAACTATACCTTAGAACAAATGG + Intergenic
1072746797 10:97945786-97945808 CATCTGCCCCTTAGGACAAAAGG - Intronic
1074649853 10:115508479-115508501 CAGCTAATTCTTCGGACAAGAGG - Intronic
1078438256 11:11343412-11343434 CAGCTGATACTTAAGACAAAAGG + Intronic
1080243234 11:30151331-30151353 CAGCTTTTCCATAAGACATAGGG + Intergenic
1081188959 11:40080286-40080308 AGGCTATTCATTAGGACAATGGG + Intergenic
1081574516 11:44310676-44310698 GAGCTTTGCCTTAGGGCAAAGGG + Intergenic
1083546944 11:63555945-63555967 CAGGTGTTCGTTAGAACAAATGG + Intronic
1084704832 11:70810136-70810158 GAGCTATGCCTTTGGACAAGAGG - Intronic
1085156475 11:74299918-74299940 AAACTATACCTTAGGAGAAAAGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088800297 11:113299612-113299634 AAGCTATACCCTAGAACAAATGG + Intergenic
1092701250 12:11233537-11233559 CAGGTATTCCTTTGTAGAAATGG - Intergenic
1093388953 12:18593672-18593694 CAGCTTTTCCTTAGTAAAACTGG - Intronic
1096728579 12:53586306-53586328 CAGGTATTTTTTAGGACTAACGG - Intronic
1101024382 12:100586202-100586224 AAACTATACCTTGGGACAAATGG + Intronic
1101559655 12:105844398-105844420 CAGATATTTCCTTGGACAAATGG - Intergenic
1101604363 12:106236829-106236851 CAGATATTCCACAGGCCAAATGG + Intergenic
1107982038 13:45743242-45743264 CAGCTTTCCCTTAGGATATAAGG - Intergenic
1109249599 13:60003012-60003034 CAGTTTTTCCTTAGTAGAAAAGG - Intronic
1112746979 13:102537508-102537530 AAGCTATTCCTTATGTCAAAAGG + Intergenic
1115706152 14:36000243-36000265 CAGATATTCCTCAGGAAACAAGG - Intergenic
1116831779 14:49727317-49727339 CAGCAATTCCTGATGCCAAAGGG + Intronic
1117509910 14:56440586-56440608 CAACTATACCTTGGAACAAATGG - Intergenic
1117833447 14:59777640-59777662 CAGGAGTTCCTTAGGACCAAAGG + Intronic
1118817194 14:69321960-69321982 CAGCTACTCCACAGCACAAAGGG + Intronic
1119078749 14:71672178-71672200 CTCCTATTCATTAGGCCAAAAGG - Intronic
1119118974 14:72055369-72055391 TATCTATCCCTTAGGAAAAAAGG + Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1119400512 14:74359261-74359283 CAGCTTTTCCTGGAGACAAAAGG + Exonic
1122564739 14:102644915-102644937 CAGCCATTTCTTAGGGAAAAGGG - Intronic
1124668024 15:31610432-31610454 AAACTATACCTTAGAACAAATGG + Intronic
1130348350 15:83068456-83068478 CGGCAATTCCTAAAGACAAAGGG + Intergenic
1132210062 15:100014875-100014897 AAGCTATACCTTGGAACAAATGG - Intronic
1135245331 16:20851630-20851652 CATCTTTTTCTTAGGAAAAAGGG + Intronic
1139835295 16:69833612-69833634 CAGTTATTACTTAGAACAGAAGG + Intronic
1140551509 16:75870926-75870948 CAGCTAATTCTTTGAACAAATGG - Intergenic
1144278148 17:13697024-13697046 AAACTATACCTTAGAACAAATGG - Intergenic
1146448284 17:32950962-32950984 CTTCTATTCCTTAAGATAAAAGG - Intergenic
1147566412 17:41538999-41539021 CTGCTCTTCCTTGGGGCAAAGGG - Intergenic
1152564190 17:81092901-81092923 CAGCTCCTCCTTAGAACAGAGGG + Intronic
1153772241 18:8425455-8425477 CAGCTAATTCATGGGACAAAAGG + Intergenic
1153828983 18:8903303-8903325 AAGCTATACCCTAGAACAAATGG + Intergenic
1154948196 18:21183169-21183191 CAGGTAGTCCTGAGGACACACGG - Intergenic
1156011094 18:32498885-32498907 AAGCTATACCTTAGAACAAATGG - Intergenic
1159611318 18:70528423-70528445 AAGTTATTCCTGAGGACAACAGG + Intergenic
1163888082 19:19986642-19986664 AAGCTATACCCTAGAACAAATGG + Intergenic
1164199932 19:23009380-23009402 AAACTATACCTTAGAACAAATGG - Intergenic
1164722194 19:30440515-30440537 CAGCTCTGCCTTAGGACCCAAGG + Intronic
1166899898 19:46052111-46052133 AAGCTATACCCTAGAACAAATGG + Intronic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926156583 2:10458155-10458177 CAGCAATTGTTTAGAACAAAGGG + Intergenic
927914500 2:26926275-26926297 CAGCCATTCCTTATCTCAAATGG + Intronic
928988692 2:37207279-37207301 AAACTATACCTTAGAACAAATGG + Intronic
930369392 2:50484403-50484425 AAGCTATTCTTAAGGAGAAATGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933110982 2:78399724-78399746 AAACTATACCTTAGAACAAATGG + Intergenic
935161100 2:100530182-100530204 CAGCTTTTCATTAGGAAAACTGG + Intergenic
935704079 2:105840838-105840860 CAGCTGTTCATTAGGAAAAGGGG - Intronic
937213392 2:120293283-120293305 CAGCTGCTCCTAAGGACACAGGG + Exonic
938216330 2:129520345-129520367 AAACTATACCTTAGAACAAATGG - Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
942478760 2:176358934-176358956 CAGCTTTTGCTTAGGAGCAAGGG - Intergenic
942988327 2:182167786-182167808 TATCTATCCCTTAGGACAAATGG + Intronic
943199027 2:184795048-184795070 AAACTATACCTTAGAACAAATGG + Intronic
943891065 2:193288058-193288080 AAACTATTCCTTGGGACAAATGG - Intergenic
945229459 2:207570063-207570085 CTGCTAGTGCTTAGGACAGAAGG - Intronic
947133799 2:226956366-226956388 CAGCTATTACTAAAGACACAAGG - Intronic
947410155 2:229829204-229829226 CAGCTTTTCCATAGAACAATTGG - Exonic
1169974857 20:11313038-11313060 CAGCTATTCCATCTGCCAAATGG + Intergenic
1170241499 20:14171849-14171871 AATCTATACCTTAGAACAAATGG - Intronic
1170375646 20:15697568-15697590 AAACTATACCTTAGAACAAATGG - Intronic
1170412515 20:16106698-16106720 CAGCTATTCCCTATGACCAAGGG - Intergenic
1171080350 20:22175902-22175924 AAACTATACCTTAGAACAAACGG - Intergenic
1171283873 20:23922267-23922289 CAGCTGTGCATTAGGATAAATGG + Intergenic
1173848543 20:46203120-46203142 CAGCTGTTCCTAAGGCCATAGGG + Intronic
1177257170 21:18679700-18679722 CAGCTATTCATTTGAACACATGG + Intergenic
1177618330 21:23555153-23555175 AAGCTATTCATCAGGACAATGGG + Intergenic
1178917725 21:36718261-36718283 CAGCTTTTACTTGGGACCAAGGG - Intronic
1180253234 21:46604206-46604228 CAACTATTTCTTAGGTCAAAGGG - Intronic
1182649614 22:31840531-31840553 CAGCTATTCCAGAGAACAACAGG - Intronic
1185033671 22:48459512-48459534 CTGCTGGACCTTAGGACAAATGG - Intergenic
949940687 3:9151980-9152002 CAGCATTTCCATAGGACACATGG - Intronic
950592171 3:13945672-13945694 AAACTATACCTTAGAACAAATGG - Intronic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
951658305 3:25033903-25033925 CAACTATTCATGAGGAGAAAAGG - Intergenic
951761272 3:26149408-26149430 TAGCTATACCTTGGAACAAATGG + Intergenic
952435015 3:33264855-33264877 CAACTATACCTTAGAACAAATGG - Intergenic
952482517 3:33776109-33776131 GAGCTATTCCTCTGAACAAACGG - Intergenic
955757019 3:62235355-62235377 CAGCTATTACTTAGAAAAGAAGG - Intronic
959067989 3:101677052-101677074 CCGCTTTTCCTTCGGACTAAGGG - Exonic
959814154 3:110655636-110655658 CAACTATTCCTAAGGTAAAATGG + Intergenic
960242550 3:115362402-115362424 CAGCTATTTCTTAGGAGTTATGG + Intergenic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
963050879 3:141142556-141142578 CAACTATACCCTAGAACAAATGG - Intronic
964252971 3:154741521-154741543 CAACTATACCTTGGAACAAATGG + Intergenic
965805211 3:172535001-172535023 TAGCTATTCCCTAGAACTAAGGG - Intergenic
967257286 3:187606823-187606845 AAGCTATACCTTGGAACAAACGG - Intergenic
970191826 4:13524894-13524916 CAACCTTTCCTTAGGACCAAAGG + Intergenic
971898060 4:32622246-32622268 CAGATATTCCTTAGGAGTAGAGG - Intergenic
974133237 4:57782714-57782736 AAACTATACCTTAGAACAAATGG - Intergenic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
976460956 4:85312094-85312116 AAACTATACCTTAGAACAAATGG - Intergenic
979638671 4:122986288-122986310 CAACTATACCTTGGAACAAATGG - Intronic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
980766104 4:137306926-137306948 CAGCTATTTCTTAAGAACAATGG + Intergenic
981177486 4:141699342-141699364 AAGCTATACCATAGAACAAATGG - Intronic
983261523 4:165461882-165461904 AAGTTATTCCTGAGGACAGAAGG + Intronic
990891536 5:60656130-60656152 AAACTATACCTTAGGACAAATGG - Intronic
994495453 5:100506610-100506632 CAGCTATTATTTAGGACAATAGG + Intergenic
995722793 5:115153807-115153829 AAACTATTCCTTGGAACAAATGG + Intronic
996288710 5:121826871-121826893 AAACTATACCTTAGAACAAATGG - Intergenic
996386951 5:122918431-122918453 CAGCTCTTCCTTAGGACTTTTGG + Intronic
996657315 5:125956553-125956575 AAACTATACCCTAGGACAAATGG + Intergenic
1000525380 5:162351399-162351421 CAACTATACCCTAGAACAAATGG - Intergenic
1003625708 6:7739440-7739462 CAGCCATTCTTTAAGGCAAAAGG - Intronic
1008021415 6:46582277-46582299 CAGCTATTTCTAAGTATAAAAGG + Intronic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1010823728 6:80447615-80447637 CATGGATTCCTTGGGACAAAAGG - Intergenic
1010858176 6:80869963-80869985 AAACTATTCCCTAGAACAAATGG - Intergenic
1011225399 6:85099518-85099540 AAACTATACCTTAGAACAAATGG + Intergenic
1011630327 6:89316973-89316995 CATCTCTTCCTTATGAAAAAGGG - Intergenic
1012177419 6:96105584-96105606 CAGCTTTTCATTTAGACAAAAGG - Intronic
1012191963 6:96290602-96290624 CAGCTATGCTCTAGAACAAATGG + Intergenic
1014909324 6:127071033-127071055 CAGCCATACCTTAGGACAGAAGG - Intergenic
1015048727 6:128812871-128812893 CAGCTATACCCTAGAACAAATGG - Intergenic
1015348080 6:132182863-132182885 AAACTATACCTTAGAACAAATGG + Intergenic
1015954059 6:138582309-138582331 CAGTTATTCCTCAGGGGAAAAGG - Intronic
1016060787 6:139627691-139627713 TAGATTTTCCTTAGGAAAAATGG + Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1018209477 6:161467145-161467167 CAACTATTCGTCAGCACAAATGG - Intronic
1019281207 7:201160-201182 CAGTTATTCCTGAAGACGAATGG - Intronic
1020632619 7:10657581-10657603 TAGCTATTTCTTAGGGCAATAGG - Intergenic
1022217655 7:28280276-28280298 AAGATATTCCTTAGGAAACATGG - Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1024838297 7:53551462-53551484 AAGTTATTCCTTAGAGCAAAAGG - Intergenic
1025800637 7:64783858-64783880 AAGCTATACCCTAGAACAAATGG + Intergenic
1027351916 7:77320873-77320895 AAGCCACTGCTTAGGACAAATGG - Intronic
1028764795 7:94541840-94541862 CACCTATGTCTTAGGAAAAAAGG - Intronic
1030426433 7:109384684-109384706 AAGGTATTCATTAGGAAAAAAGG + Intergenic
1033906249 7:146207764-146207786 CATCTATTATTTAGAACAAAGGG - Intronic
1035438489 7:158877549-158877571 CAGCTCCTGCTTAGGACATAAGG - Intronic
1038368071 8:26957394-26957416 CAGCTATTCCTTGGGCAACAGGG - Intergenic
1040706635 8:50136565-50136587 CAGGTGTTTCTCAGGACAAAAGG - Intronic
1041195940 8:55401423-55401445 CAGCTAAGGCTGAGGACAAAGGG + Intronic
1041216294 8:55604637-55604659 CATCTATTTCTGAAGACAAAAGG - Intergenic
1043756403 8:84009212-84009234 CACCTATTCATTAGGTCAAATGG - Intergenic
1046169971 8:110492576-110492598 CAGCTAATCCTCAGAACAACTGG - Intergenic
1046338062 8:112815618-112815640 CAAATATTCCTGAGAACAAAAGG + Intronic
1052177558 9:25482239-25482261 CAGTTATTGCTTATGAGAAAGGG - Intergenic
1055179170 9:73362010-73362032 CAGCAACTACTTAGGTCAAATGG + Intergenic
1055422504 9:76159219-76159241 CGGCTATTCCTTAGGTAGAAGGG + Intronic
1055611146 9:78026035-78026057 CAGCTCTACTTTAGGAGAAATGG - Intronic
1056972051 9:91213382-91213404 CAGGTGTTTGTTAGGACAAAGGG + Intergenic
1058028472 9:100168730-100168752 GAGCTATTCCTTTGTATAAAGGG - Intronic
1058271376 9:102975875-102975897 GAGCTATTCATTAAGACAATGGG - Intergenic
1058798747 9:108523996-108524018 CAGCTGGTCCCTAGGACAAGGGG + Intergenic
1188662154 X:32774114-32774136 CTGAAATTCCTTAGGAGAAATGG + Intronic
1188988251 X:36787287-36787309 CAGTTATTCCTCAGTACTAATGG - Intergenic
1189224904 X:39404334-39404356 CATCTCTTCCTTAGGACTAAAGG - Intergenic
1189743558 X:44146360-44146382 CAATTAGTTCTTAGGACAAAAGG + Intergenic
1191971870 X:66825675-66825697 AAGCTATTCATTAAGACAATGGG - Intergenic
1192142457 X:68657614-68657636 CACCTAGTCCTTAAGGCAAAGGG + Intronic
1193105539 X:77667956-77667978 TAGGTTTTCCTTTGGACAAAAGG - Intronic
1193690663 X:84637480-84637502 AAACTATTCCCTAGAACAAATGG + Intergenic
1193950747 X:87795268-87795290 AAGCTATACCCTAGAACAAATGG - Intergenic
1196161542 X:112489637-112489659 AAGCTATACCTTGGAACAAATGG + Intergenic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1196885673 X:120243252-120243274 CAGCTACTCCATAACACAAAGGG + Intergenic
1199424411 X:147684245-147684267 AAACTATTCCATAGAACAAATGG + Intergenic
1199521270 X:148739130-148739152 AAGCTATACCTTGGAACAAATGG - Intronic
1199542275 X:148969964-148969986 CAGCTACTCCTAGGGACGAAGGG + Intronic
1199564567 X:149200929-149200951 AAGCTATACCCTAGAACAAATGG - Intergenic