ID: 950943157

View in Genome Browser
Species Human (GRCh38)
Location 3:16915103-16915125
Sequence CTGTCTTAGTAGACGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950943157 Original CRISPR CTGTCTTAGTAGACGGATGT TGG Intronic
900773752 1:4565977-4565999 CTGTCTTCGTTTACGGCTGTGGG - Intergenic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
911118733 1:94273632-94273654 CAGTCATAATAGACGGAAGTAGG - Intronic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
916992519 1:170259580-170259602 CCCTCTTTGTAGACGGATGCAGG - Intergenic
919269172 1:195316591-195316613 CTTTCTTATTATACTGATGTGGG + Intergenic
921372400 1:214437808-214437830 TTCTGTTAGTAGATGGATGTTGG - Intronic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1067087094 10:43248522-43248544 CTGTCCTGGTAGTGGGATGTTGG - Intronic
1067227623 10:44386022-44386044 CTGTCCTAGGAGTCGGAGGTCGG - Intronic
1068508236 10:57930035-57930057 GTCTCCTAGTAGACAGATGTTGG + Intergenic
1072043291 10:91630028-91630050 CTGTCTTAGGAGACGTCTGGTGG + Exonic
1072228325 10:93390708-93390730 TTGTTTTAGTGGAGGGATGTTGG + Intronic
1075786967 10:125056712-125056734 CACTCTTAGTCGAGGGATGTTGG + Intronic
1077598435 11:3554820-3554842 CTGTCTTGGTCTCCGGATGTGGG - Intergenic
1079398013 11:20082722-20082744 CTGGCTCAGCAGATGGATGTTGG - Intronic
1086035093 11:82405322-82405344 CTATCTTAGTAGAGGAATGTAGG + Intergenic
1087105904 11:94406587-94406609 CTGTCTTAGTACTAGGCTGTAGG - Intergenic
1088018825 11:105094042-105094064 CTATCTTAGTTGAAGGAAGTAGG + Intronic
1090532873 11:127609474-127609496 CTGTCTGGGTAGATGGGTGTGGG + Intergenic
1092293830 12:7182499-7182521 CTCTCTTGGTAGATGGATTTTGG - Intergenic
1096645233 12:53030108-53030130 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1096645255 12:53030266-53030288 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1097454957 12:59787786-59787808 CAGTCTTAGCATACGGGTGTCGG - Exonic
1103802781 12:123550165-123550187 CTCTCTTGGTAGATGGATTTTGG - Intergenic
1105652042 13:22389632-22389654 CTGCCTTAGGAGAATGATGTTGG - Intergenic
1105802379 13:23918636-23918658 CTGTCTTTGTAGATTGATTTAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107271496 13:38623853-38623875 CTGACTTAGAAGACTGGTGTGGG - Intergenic
1133293932 16:4740798-4740820 CTGTCTCAGTAGAGGGGTGGAGG + Intronic
1141144823 16:81521673-81521695 GTGTATTTGTAGACAGATGTGGG + Intronic
1145897934 17:28471390-28471412 ATGTCTTAGAAGAGGGCTGTAGG + Intronic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1148423816 17:47572728-47572750 CTGTTTCACTAGATGGATGTTGG - Intronic
1159197070 18:65131022-65131044 ATGTCTTAGAAGTCAGATGTGGG + Intergenic
1164875039 19:31678728-31678750 CTCTCTTGGTGGAGGGATGTGGG + Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929119655 2:38473914-38473936 CTCTCATAGAAGACAGATGTTGG + Intergenic
933433194 2:82211550-82211572 CTGTCTTCATAGACTGATTTAGG + Intergenic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
938372861 2:130784128-130784150 CTGTTTTAGTAGACTGAGCTAGG - Intergenic
939493888 2:142906120-142906142 CTGTCTCTGTAGATGGATTTTGG + Intronic
943294947 2:186126365-186126387 CTGTCTTAGTCAAGGGATGTAGG + Intergenic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1178747448 21:35266638-35266660 ATGTCTTGGCAGATGGATGTAGG - Intronic
1181570000 22:23763346-23763368 CTGTCTTGGTAGGCGGATAGGGG + Intronic
950943157 3:16915103-16915125 CTGTCTTAGTAGACGGATGTTGG + Intronic
955574617 3:60346767-60346789 CTGCCTTAATAAAAGGATGTAGG - Intronic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959666199 3:108924645-108924667 CTGGCTTAATAGAAGGATTTAGG + Intronic
961778155 3:129304929-129304951 CTGTGTTAGTTGACAGTTGTGGG + Exonic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
979168626 4:117570382-117570404 CTGTCCTAGTAGACGTATTTAGG + Intergenic
980483664 4:133424739-133424761 TTGTCTTAGTAGTCAGATGAAGG + Intergenic
986301400 5:6481250-6481272 CTGTCTTAGGAGCAGGCTGTGGG - Intronic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
992637750 5:78741357-78741379 CTGTCTTAGGACCAGGATGTTGG + Intronic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1014666847 6:124248835-124248857 CTGTGTTAGCACACTGATGTCGG - Intronic
1028383288 7:90223377-90223399 CTGTCTTTGCAGACAGATGGGGG - Intronic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1038634614 8:29275567-29275589 GTGTCTTTGTATATGGATGTAGG - Intergenic
1039247626 8:35627042-35627064 ATTTCTTAGTAGATGGGTGTTGG - Intronic
1044416582 8:91947067-91947089 CTTTCTTAGAAGACTGATGGTGG - Intergenic
1046686633 8:117234939-117234961 ATGTGTTTGTAGTCGGATGTTGG - Intergenic
1047227050 8:122964649-122964671 CTGGCTTCGTAGAAGGATTTAGG + Intronic
1189619615 X:42821713-42821735 CTGTCTTAGTACCAGGATCTAGG + Intergenic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1198397595 X:136236268-136236290 CTTTATCAGTAGACGAATGTAGG + Exonic