ID: 950944540

View in Genome Browser
Species Human (GRCh38)
Location 3:16931067-16931089
Sequence CAGCCCAAATACTACATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950944533_950944540 24 Left 950944533 3:16931020-16931042 CCTTCTGCTTGGAAGATAATGCT 0: 1
1: 0
2: 2
3: 18
4: 375
Right 950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 125
950944532_950944540 30 Left 950944532 3:16931014-16931036 CCAATGCCTTCTGCTTGGAAGAT 0: 1
1: 0
2: 1
3: 25
4: 284
Right 950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 125
950944536_950944540 -8 Left 950944536 3:16931052-16931074 CCAGTTCCCATTCCTCAGCCCAA 0: 1
1: 0
2: 3
3: 20
4: 331
Right 950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 125
950944535_950944540 0 Left 950944535 3:16931044-16931066 CCTGCTGGCCAGTTCCCATTCCT 0: 1
1: 0
2: 2
3: 35
4: 243
Right 950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950944540 Original CRISPR CAGCCCAAATACTACATCCT TGG Intronic
903441960 1:23394887-23394909 CTGTCCAAACACTGCATCCTAGG + Intronic
905129565 1:35743315-35743337 CTGCCCAAATACCTCATTCTAGG + Intronic
906402919 1:45518811-45518833 CAACCTAAATACTTCTTCCTAGG + Intronic
906494668 1:46295999-46296021 CAGTTCAAATACTACTTCCTAGG + Intronic
908071702 1:60467553-60467575 CAGGTCAAATACTACCTCCTTGG - Intergenic
910557944 1:88557544-88557566 CAGCCCAAATGCTACCATCTCGG + Intergenic
912558661 1:110534614-110534636 CAGCTCAAATGCCACATCCTGGG - Intergenic
916605378 1:166337474-166337496 CAGCCCAAAGCCAACTTCCTAGG + Intergenic
917704619 1:177619649-177619671 CAGCCTTCATTCTACATCCTTGG - Intergenic
1063078032 10:2736028-2736050 CAGCCTGAATACCACAGCCTTGG - Intergenic
1063087161 10:2830422-2830444 CTGCCCTACTAGTACATCCTGGG - Intergenic
1064665810 10:17650058-17650080 CAGTCCACATCCTACATACTTGG + Intronic
1066482519 10:35810898-35810920 CAACCTAAATATTACATCCCTGG - Intergenic
1067854952 10:49784033-49784055 CAGCCCAAATGTGACTTCCTGGG - Intergenic
1068002879 10:51357038-51357060 CAGCCACTGTACTACATCCTGGG - Intronic
1068380414 10:56246867-56246889 CAGCACAAATGCACCATCCTAGG - Intergenic
1069112817 10:64468204-64468226 CACCCCAAATACTGGGTCCTTGG + Intergenic
1070717493 10:78733217-78733239 CAGCCCCACAACTAGATCCTAGG - Intergenic
1072768406 10:98115353-98115375 CAGCCCGATTGCCACATCCTTGG - Intergenic
1075424689 10:122332479-122332501 CAGCCCAAATCTCACAGCCTGGG - Exonic
1075553783 10:123414036-123414058 CACCCCAAATACTACTCCTTGGG - Intergenic
1075893791 10:125977707-125977729 CAGCACAAACCCTACATCTTGGG - Intronic
1079706433 11:23626382-23626404 CAGCCCAAATTGTCCACCCTTGG - Intergenic
1080289120 11:30651412-30651434 AAGCCCAAGTACCACCTCCTTGG - Intergenic
1081803516 11:45876183-45876205 CAGCCTGAAGGCTACATCCTGGG + Intronic
1081824445 11:46034797-46034819 CAGACCAATCACTATATCCTGGG - Intronic
1082893269 11:58163164-58163186 CAGCTCAAATGCCACTTCCTTGG + Intronic
1085285096 11:75354468-75354490 CAGCCCAAAGCCCACCTCCTCGG - Intergenic
1085635822 11:78158881-78158903 CAGCCCAGATACTGCATCCCTGG + Intergenic
1086077324 11:82868557-82868579 CAGCTCAGATATTACCTCCTTGG - Intronic
1086545393 11:87961756-87961778 CAGACCAAATACTACACTCTTGG + Intergenic
1087625752 11:100594337-100594359 CAGCTCAAATGCTACCTCTTGGG - Intergenic
1088603553 11:111506884-111506906 AAGCTCAAATTCTACTTCCTGGG - Intronic
1089689831 11:120180474-120180496 CAGCCCAGCTAATACACCCTCGG + Intronic
1091187715 11:133661484-133661506 TAGGCAAATTACTACATCCTTGG + Intergenic
1098164405 12:67678920-67678942 CAGCTCAAACACTGCTTCCTCGG - Intergenic
1098177820 12:67811270-67811292 CTGCACACATACTATATCCTAGG + Intergenic
1105553118 13:21417145-21417167 CAGCTTAAATACCACTTCCTCGG + Intronic
1106645538 13:31629933-31629955 CTGCCCAGGTACTACATCATGGG - Intergenic
1107605797 13:42055125-42055147 CAGCCCACAGACTATATCCATGG - Intronic
1108641065 13:52382698-52382720 CAGCTCAAATATCACCTCCTTGG + Intronic
1115393839 14:32884170-32884192 TAGCCCTAACACTACATCCTAGG + Intergenic
1116238911 14:42315318-42315340 CAGTGCAACCACTACATCCTGGG - Intergenic
1117376833 14:55125054-55125076 CAGCTCAAATACCACCTCCTTGG + Intronic
1117837917 14:59826961-59826983 CAGCCCAAATGCTGCCTCCCTGG - Intronic
1119228392 14:72961407-72961429 CAGCCCAACTCCACCATCCTGGG + Intergenic
1119343047 14:73897123-73897145 CATGCCAAATACTACATGATGGG + Intronic
1121506965 14:94485012-94485034 CCTCCTAAATATTACATCCTGGG + Intergenic
1127188591 15:56506291-56506313 CAGCACAGATCCTCCATCCTGGG + Intergenic
1129299543 15:74617638-74617660 CACGCCAAAGACTACCTCCTGGG - Intronic
1129966732 15:79742879-79742901 CAGCCCAACTCCACCATCCTGGG + Intergenic
1131503584 15:92995652-92995674 CAACCCAAATATTAAATACTAGG - Intronic
1133466825 16:6035338-6035360 CAGCCCATCTGCTCCATCCTTGG - Intronic
1133469763 16:6063564-6063586 CACCACCAAAACTACATCCTGGG + Intronic
1138023817 16:53506526-53506548 CAGCTCTAACACTACTTCCTTGG + Intergenic
1141435716 16:83998711-83998733 CTGAGCAAATACTACATTCTGGG - Intronic
1143839230 17:9718459-9718481 CAGCCCAAATGCCACACGCTGGG - Intronic
1144750100 17:17642624-17642646 CAGCTCAAATATTACCTCCTTGG + Intergenic
1145065162 17:19757134-19757156 CATCCCAAATGCTACAGCCAAGG - Intergenic
1146556746 17:33831426-33831448 CAGGCCAGATCCTACATTCTGGG + Intronic
1150786884 17:68170252-68170274 CAGCCCAAACACACCATCCATGG + Intergenic
1151300679 17:73222902-73222924 CAGCCCAACAACCACACCCTGGG + Intronic
1152092844 17:78256628-78256650 GAGCCCAAAAGCTACATCCGGGG + Intergenic
1152780529 17:82225769-82225791 CAGCCCACATCCTGCGTCCTTGG - Intergenic
1153419499 18:4888442-4888464 GAGCCTAAACACTACTTCCTGGG + Intergenic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1163843665 19:19627070-19627092 CAGCCCATCTACTACCTGCTCGG - Exonic
925160836 2:1682302-1682324 CAAACTAAAAACTACATCCTGGG - Intronic
928189525 2:29150111-29150133 AAGCCAACATGCTACATCCTAGG + Intronic
932254486 2:70272523-70272545 CAGCCAATATACTCCAGCCTGGG - Intronic
933527719 2:83464671-83464693 AACCTCAAATACTAAATCCTGGG + Intergenic
933689627 2:85169681-85169703 CAGACCAAAAAATACAGCCTTGG - Intronic
938654631 2:133418419-133418441 CAGTCTAATTACTACATACTTGG - Intronic
940220785 2:151349182-151349204 CAGCTTAATTACTACCTCCTAGG - Intergenic
940674690 2:156714137-156714159 CAGCACAAACCCTCCATCCTGGG - Intergenic
941079323 2:161041830-161041852 CATCCCAAATGCTAAATCCCAGG - Intergenic
942917991 2:181335748-181335770 GAGCCCAAATATTACATATTTGG + Intergenic
948687183 2:239676745-239676767 CAGCCCCAATCCTCCAACCTCGG + Intergenic
1169884454 20:10383035-10383057 CAGCCCAAATACTATTTCCTGGG + Intergenic
1170358153 20:15515440-15515462 CTGCTCAAATACTGCATCTTTGG + Intronic
1170442549 20:16393762-16393784 CAGTCCAAATTTTACCTCCTGGG - Intronic
1172400759 20:34649341-34649363 CAGCCCAAATTATACATCAGTGG - Intronic
1172758122 20:37301802-37301824 CAGCTCAAACACTGCCTCCTCGG - Intronic
1181580604 22:23825985-23826007 CAGCCCAAATGCTACAGGCAGGG - Intronic
1182326388 22:29516503-29516525 CGGCCCAAACACAACATCCCAGG + Intronic
949341063 3:3031483-3031505 CAGCTCATTTACTACATCCCAGG - Intronic
950398821 3:12754624-12754646 CATCCCCAATCCTCCATCCTGGG + Intronic
950944540 3:16931067-16931089 CAGCCCAAATACTACATCCTTGG + Intronic
952862920 3:37829896-37829918 CAGCTCAAATTCTACATTTTTGG + Intergenic
958110459 3:89136133-89136155 CAGTCCAAATTCTACTTCATAGG + Intronic
960400835 3:117196134-117196156 CAGACCAATTAAGACATCCTCGG - Intergenic
961506491 3:127374083-127374105 CAGGCCAAATAAAACATCCAGGG + Intergenic
964723232 3:159788675-159788697 GAGCCTAACTACTACATACTAGG + Intronic
965836877 3:172862686-172862708 CAATCCAAACACTACCTCCTAGG - Intergenic
967488978 3:190066904-190066926 CAGCTCAAATGCCACTTCCTGGG + Intronic
967503012 3:190222222-190222244 CAGCACAAACCCTCCATCCTGGG - Intergenic
972337049 4:38116368-38116390 CAGCTCAAATATCACATCCTGGG + Intronic
976360402 4:84171612-84171634 CAGCTCCAATATTACCTCCTGGG - Intergenic
977813726 4:101389073-101389095 CAGCAGAAATACTACAAGCTGGG - Intergenic
980991965 4:139745842-139745864 AAGCCCTAACAATACATCCTGGG + Intronic
984774736 4:183471613-183471635 TAGCACAAATACTGGATCCTGGG - Intergenic
987964527 5:24854460-24854482 CATACCAGATACTACTTCCTTGG + Intergenic
990500357 5:56390208-56390230 CAGCACAAACCCTCCATCCTGGG + Intergenic
994569369 5:101495080-101495102 CAGCTCAAATACTACATCCATGG + Intergenic
996694042 5:126373755-126373777 CAGCCTAAATATCACTTCCTTGG - Intronic
998201421 5:140126431-140126453 TAGCCCAAATACAACAGCTTTGG + Exonic
998677746 5:144428654-144428676 AAGCCCTACTACTACATCGTTGG + Intronic
1002552829 5:180009700-180009722 CAGCCCAAAAACTTCACTCTTGG + Intronic
1006303379 6:33205674-33205696 CAGCCCAATCACTCCAGCCTTGG - Exonic
1010234933 6:73567381-73567403 CAGTCTAAATCCTAAATCCTTGG - Intergenic
1015430651 6:133127246-133127268 CAGACCAAAAACTCCTTCCTGGG + Intergenic
1018168006 6:161117781-161117803 CAGCCCAAATTATACATCATTGG + Intergenic
1020886450 7:13824069-13824091 CAGCCCAAAGACAACCTTCTGGG + Intergenic
1021665248 7:22970603-22970625 CAGCTCAAATGATACCTCCTTGG - Intronic
1026167722 7:67925140-67925162 CAGAGCTAATACCACATCCTGGG + Intergenic
1031991551 7:128202224-128202246 CAGCTCAAATATTACCTCTTTGG + Intergenic
1034094234 7:148391955-148391977 CAGACCAAAAGCCACATCCTAGG + Intronic
1034535395 7:151722910-151722932 CAGCCCCACAACCACATCCTTGG + Intronic
1036814021 8:11887891-11887913 CAGCCCCCATTCTACTTCCTGGG - Intergenic
1037469224 8:19191064-19191086 CAGCCCAAATACCACCTTTTAGG + Intergenic
1037930488 8:22877447-22877469 CGACCCAAGTACTACATTCTTGG + Intronic
1039683033 8:39763332-39763354 CAGTGCAAAAACTGCATCCTGGG + Intronic
1040087882 8:43364792-43364814 CAGCACAGACACTCCATCCTGGG + Intergenic
1044762471 8:95536041-95536063 CAGCTCAAATGTCACATCCTCGG + Intergenic
1045756069 8:105543789-105543811 CAGGCGTAATACTACATCTTAGG + Intronic
1047885408 8:129244953-129244975 CACCCCAAATAGTACATCAATGG - Intergenic
1048204943 8:132407857-132407879 CAGCCCCCAGACCACATCCTGGG + Intronic
1054964320 9:71004993-71005015 CAGACCAACTTCTACATACTAGG + Intronic
1055602066 9:77930122-77930144 CTGCACAAAGATTACATCCTTGG - Intronic
1056038394 9:82634314-82634336 CAGCCTAAATAATACAACATAGG - Intergenic
1056182500 9:84099394-84099416 CACCTCAAATGTTACATCCTAGG - Intergenic
1059853220 9:118366614-118366636 CAGCCCAAAGACCACAACCAAGG - Intergenic
1060476043 9:123987477-123987499 CAGCTCAAATGCTACCTCCTTGG + Intergenic
1061243035 9:129385295-129385317 CACCCCACATACTCCCTCCTGGG + Intergenic
1188715041 X:33449810-33449832 CAGCACAGACACTTCATCCTGGG + Intergenic
1192926453 X:75759514-75759536 CAGCACAAACCCTCCATCCTAGG + Intergenic
1194593930 X:95835513-95835535 CAGCACAAACCCTCCATCCTGGG - Intergenic
1195346322 X:103954020-103954042 CAGCACAAAAACTCTATCCTGGG + Intronic
1196410486 X:115413167-115413189 AAACCAAAATTCTACATCCTAGG - Intergenic