ID: 950949715

View in Genome Browser
Species Human (GRCh38)
Location 3:16985767-16985789
Sequence CACCTTTAGTAAGAGCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950949711_950949715 30 Left 950949711 3:16985714-16985736 CCTTTCACTTTATATTAACTTAT 0: 1
1: 0
2: 4
3: 46
4: 540
Right 950949715 3:16985767-16985789 CACCTTTAGTAAGAGCACATGGG 0: 1
1: 0
2: 1
3: 10
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950949715 Original CRISPR CACCTTTAGTAAGAGCACAT GGG Intronic
901372132 1:8808016-8808038 TACCTGTAGTAACAGCACTTTGG + Intronic
901395613 1:8979216-8979238 CACCTTTAATCACAGCACTTTGG + Intergenic
901858862 1:12061852-12061874 CACCCTTAATTAGAGCACCTAGG + Intergenic
904026989 1:27510239-27510261 CACCTGTAGTCATAGCACTTTGG + Intergenic
905698078 1:39990631-39990653 CACCTGTAGTCACAGCACTTTGG - Intergenic
906014305 1:42560626-42560648 CACCTGTAATAACAGCACTTGGG - Intronic
906271944 1:44486273-44486295 CACCTTTAACAGGAGCACATAGG + Intronic
906408394 1:45560244-45560266 CACCTGTAATACAAGCACATAGG - Intronic
908211913 1:61909238-61909260 CACCTGTAATAACAGCACTTTGG - Intronic
908506617 1:64808720-64808742 CACCTGTAATACCAGCACATTGG - Intronic
911267339 1:95757858-95757880 CATGTTCAGTGAGAGCACATTGG - Intergenic
913154887 1:116086158-116086180 CACCTTTAAACAGAGCACTTTGG - Intergenic
913308803 1:117464103-117464125 CACCTGTAGTACCAGCACTTTGG + Intronic
915986141 1:160466864-160466886 CACCTATAGTTACAGCACTTTGG - Intergenic
916754690 1:167757887-167757909 CACCTTTAGTCCCAGCACTTTGG + Intronic
917389309 1:174516477-174516499 CACCTGTAATACCAGCACATTGG - Intronic
917539087 1:175896270-175896292 CACCTGTAGTAATAGCACTTTGG + Intergenic
917847723 1:179035867-179035889 CACCTGTAATCACAGCACATTGG + Intronic
919009789 1:191945446-191945468 CACCTTTGGTGAGAGTAAATGGG + Intergenic
919120086 1:193328673-193328695 CACCTGTAATCATAGCACATTGG - Intergenic
921653054 1:217701645-217701667 CACCTCTAGTCACAGCACTTTGG - Intronic
921803612 1:219430031-219430053 CACCTGTAATCAGAGCACTTCGG + Intergenic
922782176 1:228261434-228261456 CACCTGTAATCAGAGCACTTTGG - Intronic
923575575 1:235155763-235155785 CACCTTTAGTCCCAGCACTTTGG - Intronic
924641994 1:245842834-245842856 CACCTTTAGTCCCAGCTCATCGG - Intronic
1064165591 10:12982850-12982872 CGCCTTTAATAACAGCACTTTGG + Intronic
1064477593 10:15707560-15707582 CACCTTTAATCCCAGCACATTGG + Intronic
1064615386 10:17149207-17149229 ATCCTTTAGTAAGGGCACAGCGG + Intronic
1064631182 10:17312967-17312989 CACCTATAGTACCAGCACTTTGG - Intergenic
1065555441 10:26910858-26910880 CACCTGTAATACGAGCACTTTGG - Intergenic
1069037738 10:63663229-63663251 CACCTGTAATAACAGCACTTTGG + Intergenic
1069215924 10:65821048-65821070 CATATTCAGTAAGAGGACATAGG - Intergenic
1069245419 10:66199188-66199210 CTGATTTAGTAAGAGCACCTAGG - Intronic
1070849966 10:79555652-79555674 CACCATTTGGAAGAACACATGGG - Intergenic
1070854225 10:79593742-79593764 CACCATTTGGAAGAACACATGGG - Intergenic
1071687637 10:87777222-87777244 CAACATAACTAAGAGCACATAGG - Intronic
1072558976 10:96552189-96552211 CACCTATAATAACAGCACTTTGG + Intronic
1072649199 10:97280714-97280736 CACCTTTAGTCTTAGCACTTTGG - Intronic
1073373220 10:103009429-103009451 CGCCTTTAGTCACAGCACTTTGG + Intronic
1073635908 10:105198744-105198766 CTCCTTTAGTAAAACTACATGGG - Intronic
1075506946 10:123032237-123032259 CACCTGTAGTCCGAGCACTTTGG - Intronic
1078170867 11:8928166-8928188 CACCTGTAATAACAGCACTTTGG - Intronic
1079741678 11:24070032-24070054 CACCTGTATTAACAGCACTTTGG - Intergenic
1079796937 11:24815630-24815652 CTCTTTTAGTAAGAACAGATGGG + Intronic
1079980621 11:27148024-27148046 CACATTTACTAAAAGAACATTGG + Intergenic
1083249672 11:61458003-61458025 CACCTGTAGTCCGAGCACTTTGG + Intronic
1084395978 11:68910621-68910643 CACCTTTAGTCCCAGCACTTTGG + Intronic
1085289174 11:75385248-75385270 CACCTATAGTCACAGCACTTTGG + Intergenic
1087466377 11:98511766-98511788 AACCTTTAGTAAGTGTACAGTGG + Intergenic
1088176983 11:107064727-107064749 CATCTTCAGTTAGAGCAGATGGG - Intergenic
1089999583 11:122943943-122943965 CACCTGTAATAACAGCACTTTGG + Intronic
1090388625 11:126372674-126372696 CACCTTTAATCCCAGCACATTGG - Intronic
1091317114 11:134622349-134622371 CACCTCTAGTAAGAACTCTTGGG + Intergenic
1091697305 12:2636570-2636592 CACCTTTAGCATCAGCAAATTGG - Intronic
1093882373 12:24419398-24419420 CACCTGTAATCACAGCACATTGG - Intergenic
1094181030 12:27592877-27592899 CACCTGTAGTATCAGCACTTTGG + Intronic
1095309868 12:40685894-40685916 CATTTTTTTTAAGAGCACATGGG + Intergenic
1098271010 12:68770298-68770320 CATCTTTAGTAAGAGCAAGGGGG + Exonic
1099480655 12:83161681-83161703 CACTTTTAGAAAGAAAACATTGG - Intergenic
1100060519 12:90569457-90569479 CACCTGTAATACCAGCACATTGG - Intergenic
1100223068 12:92527272-92527294 CACCTTTAAAAAGAGAATATAGG - Intergenic
1101366860 12:104080140-104080162 CACTTTAAGTAAGAGTACACTGG - Intronic
1102006436 12:109591981-109592003 CACCTGTAGTATTAGCACTTTGG + Intronic
1102151636 12:110692457-110692479 CACCTGTAGTCTGAGCACTTTGG + Intronic
1102481723 12:113228344-113228366 CACCTTTAATCACAGCACTTTGG + Intronic
1104099840 12:125596947-125596969 CACTTTCAATAAAAGCACATGGG - Intronic
1104253675 12:127121093-127121115 CACCTTTCTTAAGGACACATTGG - Intergenic
1106010029 13:25811588-25811610 CACCTTTAATCACAGCACTTTGG + Intronic
1107333118 13:39323079-39323101 CACTTTTAGCAAAAGCTCATGGG + Intergenic
1108677348 13:52748563-52748585 CACCTATGGTAAGAGTACTTAGG + Intergenic
1109341511 13:61066745-61066767 CACCTTTAGTCTTAGCACTTTGG + Intergenic
1110127455 13:71964032-71964054 CACCTGTAATTAGAGCACTTTGG - Intergenic
1110678533 13:78279616-78279638 TACCTTTAGGAAGAAAACATGGG + Intergenic
1110785493 13:79520059-79520081 CACCTGTAATACCAGCACATTGG - Intronic
1112147941 13:96722518-96722540 CAACTGTAGAAAGAACACATGGG + Intronic
1113072341 13:106434022-106434044 CACCTTTAGTCCCAGCACTTTGG + Intergenic
1113157121 13:107336089-107336111 CACCTGTAATAACAGCACTTTGG + Intronic
1113438573 13:110311308-110311330 CACCTTTAGAAAGGGCACCTTGG - Intronic
1115093346 14:29605207-29605229 CACCTTTGGGAAGATCACAGTGG - Intronic
1115655721 14:35441807-35441829 CACCTGTAATACCAGCACATTGG - Intergenic
1115676496 14:35681299-35681321 TACCATTAGTAACAGCACAGAGG - Intronic
1116080011 14:40159634-40159656 CACCTTTAGTAAAAGAAGACAGG + Intergenic
1116212099 14:41961694-41961716 CACCTGTAGTCATAGCACTTTGG + Intergenic
1116814635 14:49572208-49572230 CACCTGTAATCTGAGCACATTGG - Exonic
1117482212 14:56158613-56158635 CACCTGTAGTCCCAGCACATTGG - Intronic
1118363174 14:65072681-65072703 CACTTTGAGTAACACCACATGGG + Intronic
1119372570 14:74159830-74159852 CACCTGTAGTCACAGCACTTTGG - Intronic
1120712281 14:87805362-87805384 CACCTGTAGTCAGACAACATTGG + Intergenic
1122095324 14:99366359-99366381 CACCTTTAATACCAGCACGTTGG - Intergenic
1122322022 14:100860985-100861007 CACATTTATTGAGAGCACAGTGG - Intergenic
1126373650 15:47972790-47972812 CCCCTTTTGTAAGGACACATAGG - Intergenic
1126804476 15:52332701-52332723 CACCTATAATCAGAGCACTTTGG + Intronic
1131357191 15:91756056-91756078 CACTGTTGGTTAGAGCACATTGG + Intergenic
1131390747 15:92046252-92046274 CACCTGTAATAACAGCACTTTGG + Intronic
1131604688 15:93888945-93888967 CACGTTGAAGAAGAGCACATAGG + Intergenic
1135838346 16:25849765-25849787 CACCTGTAGTTCCAGCACATTGG - Intronic
1136404789 16:30038324-30038346 CACCTGTAGTACCAGCACTTTGG + Intronic
1136504868 16:30696664-30696686 CACCTGTAGTCACAGCACTTTGG + Intergenic
1136584651 16:31176399-31176421 CACCTTTAATCACAGCACTTTGG + Intergenic
1136631974 16:31494122-31494144 CACCTGTAGTACCAGCACTTTGG + Intronic
1136712241 16:32248572-32248594 CACCTTTAATACCAGCACTTTGG - Intergenic
1136755674 16:32680832-32680854 CACCTTTAATACCAGCACTTTGG + Intergenic
1136812439 16:33189540-33189562 CACCTTTAATACCAGCACTTTGG - Intergenic
1136818915 16:33299620-33299642 CACCTTTAATACCAGCACTTTGG - Intronic
1136825478 16:33356153-33356175 CACCTTTAATACCAGCACTTTGG - Intergenic
1136830544 16:33454924-33454946 CACCTTTAATACCAGCACTTTGG - Intergenic
1137313282 16:47287661-47287683 CACCTGTAGTCACAGCACTTTGG - Intronic
1137543819 16:49384086-49384108 CACCTTTAATACCAGCACTTTGG + Intronic
1138415045 16:56866866-56866888 CGCCTGTAGTAAAAGCACTTTGG - Intronic
1138541542 16:57690611-57690633 CACCTGTAGTCATAGCACTTTGG + Intergenic
1140086867 16:71804754-71804776 CACCTTTAATACCAGCACTTTGG + Intronic
1141344359 16:83231525-83231547 CACCTTCAGGAAGAGCACAGAGG + Intronic
1202991016 16_KI270728v1_random:12510-12532 CACCTTTAATACCAGCACTTTGG - Intergenic
1203057816 16_KI270728v1_random:941188-941210 CACCTTTAATACCAGCACTTTGG + Intergenic
1142758813 17:2031158-2031180 CACCTTTAGTCTGAGCACTTTGG + Intronic
1144647326 17:16984268-16984290 CAACTTTAAGAAGAGCAGATTGG + Intergenic
1144785429 17:17828653-17828675 CACCTGTAATAACAGCACTTTGG + Intronic
1146404673 17:32527074-32527096 CACTTTTCGTAAGACCACAGTGG + Intronic
1147022695 17:37549850-37549872 CACCTGTAGTACCAGCACTTTGG - Intronic
1147719361 17:42529150-42529172 CACCTGTAGTCACAGCACTTAGG - Intergenic
1148016709 17:44526992-44527014 CACCTGTAATAACAGCACTTTGG - Intergenic
1148339674 17:46865870-46865892 CACCTGTAGTACCAGCACTTTGG - Intronic
1149143497 17:53461880-53461902 CACCTTTAATCACAGCACTTTGG + Intergenic
1151851364 17:76692087-76692109 CACCTGTAATCACAGCACATTGG + Intronic
1156321046 18:36022700-36022722 CACCTGTAGTCACAGCACTTTGG + Intronic
1157841142 18:50960047-50960069 CACCTTTAGTCCCAGCACTTTGG + Intergenic
1158161124 18:54484692-54484714 CACCTGTAGTCCCAGCACATTGG - Intergenic
1158486125 18:57867348-57867370 CACCTGTAGTCCGAGCACTTTGG - Intergenic
1159388731 18:67760410-67760432 CACCTGTAATCAGAGCACTTTGG + Intergenic
1161192680 19:2967585-2967607 CACCTTTAATCACAGCACTTTGG - Intergenic
1162338310 19:10075417-10075439 CACCTGTAGTCACAGCACTTTGG + Intergenic
1162649138 19:12072501-12072523 ATCCTTTGGTCAGAGCACATGGG + Intronic
1162803957 19:13126972-13126994 CACCTGTAGTCCGAGCACTTTGG + Intronic
1163578637 19:18124843-18124865 CACCTTTAATACCAGCACTTTGG + Intronic
1163937250 19:20458505-20458527 CACCTATAATCACAGCACATTGG - Intergenic
1164344989 19:27241884-27241906 TTCCTTTAGACAGAGCACATCGG + Intergenic
1164874893 19:31677210-31677232 CACCTGTAATAACAGCACTTTGG - Intergenic
1166324275 19:42039547-42039569 CCCACTCAGTAAGAGCACATCGG + Intronic
1166572721 19:43808404-43808426 CACCTTAAATAAGAGCAGTTAGG - Intronic
925074991 2:1009021-1009043 CACCTTTTTTTAGAGCACCTAGG + Intronic
928062867 2:28132574-28132596 CAGCTTTAGCAAAAGCACAGAGG - Intronic
929103328 2:38338952-38338974 CACCTTTAATACCAGCACTTTGG + Intronic
929563912 2:42973096-42973118 CACCTTTAGTCCTAGCACTTTGG + Intergenic
934744046 2:96746709-96746731 CACCTGCAGTACGAGCACTTTGG + Intergenic
939556544 2:143681067-143681089 CACCTTTCGAAGGAGCAAATGGG + Intronic
941014206 2:160336169-160336191 CACATCTGGTAAGAGCAAATTGG + Intronic
941366761 2:164619817-164619839 CTCCTACAGTAAGAGAACATAGG + Exonic
943471603 2:188301282-188301304 CACCTGTAATACCAGCACATTGG - Intronic
945648430 2:212530754-212530776 CACCTATACTAGAAGCACATGGG + Intronic
947215969 2:227750162-227750184 CACCTGTAGTTACAGCACTTTGG - Intergenic
1169721158 20:8677876-8677898 TAATTTTAGTTAGAGCACATTGG - Intronic
1170027867 20:11910094-11910116 CACCTTTTCCAAGAACACATGGG - Intronic
1170195547 20:13685401-13685423 CACCTTTAATACCAGCACATTGG + Intergenic
1170376809 20:15709134-15709156 CACCTATAGGAAAAGCACCTAGG + Intronic
1171098673 20:22359870-22359892 CACCTTTAGATAGAACACACTGG + Intergenic
1172555687 20:35839128-35839150 CACCTGTAGTACCAGCACTTTGG + Intronic
1173582282 20:44155773-44155795 CACCTGTAATACGAGCACTTTGG + Intronic
1174250866 20:49218648-49218670 CACCTTTAGTCACGGCACTTTGG - Intergenic
1176871827 21:14089323-14089345 CACCTATAGTACCAGCACCTTGG - Intergenic
1177152969 21:17473227-17473249 CACCTGTAATCAGAGCACTTTGG + Intergenic
1177607134 21:23395427-23395449 CACCTGTAGTACAAGCACTTTGG + Intergenic
1178694143 21:34778731-34778753 CACCTTTATTTAGATAACATTGG + Intergenic
1179682692 21:43035612-43035634 CACCTTTAGTCCCAGCACTTTGG + Intergenic
1180393463 22:12306244-12306266 CACCTCTAGTAATAACACTTTGG - Intergenic
1180406285 22:12558524-12558546 CACCTCTAGTAATAACACTTTGG + Intergenic
1180655559 22:17417879-17417901 CACCTGTAGTATCAGCACTTTGG - Intronic
1181611685 22:24018113-24018135 CACCTTTAGTCCCAGCACTTTGG - Intronic
1182191212 22:28462703-28462725 TACCTGTAGTAAGAGAAGATTGG + Intronic
1182347832 22:29679231-29679253 CACCCATGGTAAAAGCACATGGG - Intronic
1183221385 22:36515864-36515886 CACCTGTTGAAAGAGCACACTGG - Intronic
950508456 3:13410959-13410981 CACCTTTAGTCCCAGCACTTTGG + Intronic
950777112 3:15359773-15359795 CACCTGTAATATGAGCACTTCGG + Intergenic
950783838 3:15415882-15415904 CATCTTTAGTCAGATCACACTGG + Exonic
950855959 3:16105447-16105469 CACCTTTAAAAAGGTCACATTGG - Intergenic
950949715 3:16985767-16985789 CACCTTTAGTAAGAGCACATGGG + Intronic
951894156 3:27595160-27595182 CACCTTTAATACTAGCACTTTGG - Intergenic
954238137 3:49272811-49272833 CACCTTTAGTCCTAGCACTTTGG - Intronic
955776845 3:62442627-62442649 CGCCTTCAATGAGAGCACATTGG - Intronic
956090110 3:65657332-65657354 CACCTGTAGTCCAAGCACATTGG + Intronic
958273544 3:91541778-91541800 TTCCTTTAGAAAGAGCAGATTGG - Intergenic
958300786 3:91987676-91987698 CTCCTTTAGACAGAGCGCATTGG + Intergenic
958370091 3:93123974-93123996 TTCCTTTAGTCAGAGCAGATTGG + Intergenic
958402333 3:93651544-93651566 CTCCTTTAGACAGAGCGCATTGG + Intergenic
958714279 3:97760900-97760922 CCCCTTTTGTAAGAGCAGATGGG - Intergenic
959841929 3:110986441-110986463 CACCTTTAGTAAGAGGAAGATGG + Intergenic
962335863 3:134529599-134529621 CACCTGTAGTCACAGCACTTTGG - Intronic
963574377 3:147041461-147041483 CACCTTTACTAAGAGCTGCTGGG + Intergenic
963937896 3:151073452-151073474 CACCTGTAATACCAGCACATTGG + Intergenic
964005431 3:151821372-151821394 CACCTATGGAAAGAGCACTTAGG + Intronic
965028371 3:163331008-163331030 CACCATTAATCAGAGGACATGGG + Intergenic
966562008 3:181332213-181332235 CACCCTTAGTCATAGAACATTGG - Intergenic
967692189 3:192488498-192488520 CACCTTTATCAATACCACATTGG + Intronic
968015198 3:195324491-195324513 CACCTGTAATCCGAGCACATTGG + Intronic
968674316 4:1869610-1869632 CACCTTTAATACAAGCACTTTGG - Intergenic
968850864 4:3076915-3076937 CACCTTTAATCCGAGCACTTTGG + Intronic
969116845 4:4875612-4875634 CACCTTTTCCAAGATCACATGGG + Intergenic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
969493068 4:7510851-7510873 CTCCTTTATTCACAGCACATTGG + Intronic
969683956 4:8659020-8659042 CACCTGTAATAACAGCACTTTGG + Intergenic
970883819 4:20963520-20963542 CACCTTTCCTAAGAGCATGTAGG - Intronic
973210323 4:47608058-47608080 CACCTGTAATAACAGCACTTTGG + Intronic
973743117 4:53937360-53937382 CACCTGTAATACCAGCACATTGG - Intronic
974195079 4:58563628-58563650 CACCTGTAGTCACAGCACTTTGG + Intergenic
974503945 4:62743442-62743464 CACGTTTAGTGACATCACATTGG - Intergenic
975054991 4:69918953-69918975 CACCTGTAGTACCAGCACTTTGG - Intergenic
976413259 4:84741573-84741595 CACCTGTAGTATCAGCACTTTGG - Intronic
977911837 4:102546259-102546281 CACCTTGAGTAGCAGAACATTGG + Intronic
980579892 4:134735519-134735541 CACCTGTAATCACAGCACATTGG - Intergenic
980939470 4:139259906-139259928 CACCTGTAGTTACAGCACTTTGG - Intergenic
982160492 4:152563982-152564004 CACCTATAGTACCAGCACTTTGG - Intergenic
982553103 4:156827115-156827137 TGCCTTTAGTAAGAACAGATTGG + Intronic
982950728 4:161692481-161692503 CACCTTTTGTAAAAGCACTAAGG - Intronic
983419003 4:167494669-167494691 CACCTGTAGTCATAGCACTTTGG - Intergenic
984077764 4:175204999-175205021 CACCTGTAATAACAGCACTTTGG - Intergenic
986186520 5:5446254-5446276 CACCTGTAGTATCAGCACTTTGG - Intronic
986208872 5:5651588-5651610 CACCTTTAGTCCCAGCACTTTGG - Intergenic
986225040 5:5804472-5804494 CACCTGTAGTTACAGCACTTGGG + Intergenic
986271860 5:6238258-6238280 CACCTTTAATCCGAGCACTTTGG - Intergenic
987247231 5:16061035-16061057 GAACTTAAGGAAGAGCACATGGG - Intergenic
987353962 5:17045981-17046003 CACCTGTAGTCACAGCACTTTGG + Intergenic
987396413 5:17428881-17428903 CAACTTGAGGAATAGCACATGGG - Intergenic
987751349 5:22042623-22042645 CACCTATAATTACAGCACATTGG + Intronic
988959562 5:36356213-36356235 CACCTATAATCACAGCACATTGG + Intergenic
989141709 5:38207933-38207955 CACCTGTAGAAGGAACACATTGG + Intergenic
989497723 5:42128670-42128692 CACTTTTAGCAAGTGAACATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991112940 5:62922327-62922349 CACGTTTAGTAAGGGGAAATGGG - Intergenic
991340629 5:65604353-65604375 CACCTGTAATAACAGCACTTTGG - Intronic
993835360 5:92813354-92813376 CACTTGTCGTGAGAGCACATAGG - Intergenic
994198285 5:96943545-96943567 CACCTATAGTACCAGCACTTGGG - Intronic
995679562 5:114701855-114701877 CACCTTTATTAAGAGAACCATGG - Intergenic
995799854 5:115982225-115982247 CAGCTTTAGGAAGGACACATAGG - Intronic
995805041 5:116042089-116042111 CACCTGTAATCACAGCACATTGG - Intronic
998474704 5:142410668-142410690 TACCTTTCTTAAGATCACATAGG + Intergenic
999527327 5:152421865-152421887 CAGCTGTAGTATGAACACATTGG + Intronic
1001387459 5:171351779-171351801 CAAATTTCGTATGAGCACATTGG + Intergenic
1002483339 5:179517572-179517594 CACCTGTAGTACCAGCACTTCGG + Intergenic
1004383457 6:15151982-15152004 CACCTGTAATCAGAGCACTTTGG + Intergenic
1004409429 6:15366770-15366792 CACCTTCCGTAAGTGCACCTAGG + Intronic
1004889849 6:20090049-20090071 CACCTTTAGTAACAGCACTTTGG - Intergenic
1005432136 6:25769353-25769375 CACCTTTAGTCCCAGCACTTTGG + Intronic
1005889364 6:30124069-30124091 CACCTTTAATCAGAGAACAATGG + Intergenic
1006231236 6:32588837-32588859 CATGTCTAGTTAGAGCACATAGG + Intronic
1008942787 6:57065321-57065343 CCTCTTTGGTATGAGCACATTGG - Intergenic
1010298336 6:74227746-74227768 CACCTGTAATACGAGCACTTTGG - Intergenic
1012356390 6:98319393-98319415 CACCTTTAGTATTAGCAGAATGG - Intergenic
1012992552 6:105940666-105940688 TAACTTTATTAACAGCACATTGG - Intergenic
1013422184 6:109977523-109977545 CACCTGTAATAACAGCACTTTGG + Intergenic
1016185517 6:141193586-141193608 CACCTTTGCTAAAAGCAGATAGG - Intergenic
1016722945 6:147323650-147323672 CACCTATAATCAGAGCACTTTGG - Intronic
1017554828 6:155551754-155551776 AACATTTAGAAAGAGGACATAGG + Intergenic
1017926588 6:158915934-158915956 CACCTGTAGTCACAGCACTTTGG + Intergenic
1020134161 7:5577013-5577035 CACCTGTAATAACAGCACTTTGG + Intergenic
1021171725 7:17405533-17405555 CACCTATAGTCACAGCACTTTGG + Intergenic
1021181301 7:17508903-17508925 CACCTTTAATACCAGCACTTTGG + Intergenic
1022515496 7:30972456-30972478 CTCCTTCAGGAAGAGCCCATGGG + Intronic
1023274315 7:38501443-38501465 CACCTTTAATCCGAGCACTTTGG - Intronic
1026223550 7:68421255-68421277 CACCTATAATACCAGCACATTGG + Intergenic
1027429904 7:78100610-78100632 CACCTTTAGTCCCAGCACTTTGG - Intronic
1029265958 7:99340566-99340588 CACCTTTAGTACCAGCTCCTGGG - Intronic
1030572101 7:111239830-111239852 TACCTTTAGCAAGAACACTTAGG - Intronic
1033162563 7:139010536-139010558 CACCTGTAATAATAGCAGATTGG - Intergenic
1038077669 8:24095380-24095402 CACCTTTAATCCCAGCACATTGG + Intergenic
1038800064 8:30741575-30741597 CACCTGTAGTAACAGCTCCTCGG - Intronic
1040633843 8:49248796-49248818 AACCTGTAGGAAGAGCACAGAGG + Intergenic
1040997135 8:53413573-53413595 CGCCTGTAGTAACAGCACTTTGG + Intergenic
1041246740 8:55895527-55895549 CACCTGTAGTCACAGCACTTGGG + Intronic
1042339935 8:67667830-67667852 CACCCTTAGGAAGAGCTCAAGGG + Intronic
1043542303 8:81278206-81278228 TATTTTTAGTAACAGCACATAGG - Intergenic
1046438290 8:114224558-114224580 CACCTCTAGGAAAAGTACATAGG + Intergenic
1046994900 8:120508173-120508195 AACATTTAATAAGAGCATATAGG - Intronic
1050231733 9:3532953-3532975 CACCTTTAGTCTCAGCACTTTGG + Intergenic
1051618160 9:19026768-19026790 CACCTGTAGTCTGAGCACTTTGG + Intronic
1052177924 9:25486880-25486902 CACCTATAGTACCAGCACTTTGG - Intergenic
1052541903 9:29822434-29822456 CACCTGTAGTCACAGCACTTTGG + Intergenic
1055016126 9:71620003-71620025 CACCTGTAGTACCAGCACTTTGG + Intergenic
1055494972 9:76844901-76844923 CACCTTTAATTACAGCACTTTGG + Intronic
1056228059 9:84515993-84516015 CACCTGTAATACCAGCACATTGG - Intergenic
1056751421 9:89354404-89354426 CACTTTTAGTGACATCACATAGG + Intronic
1059583551 9:115579377-115579399 CACCTGTAATCACAGCACATTGG + Intergenic
1060427129 9:123515774-123515796 CACCTATAGTAACAGCACTTTGG + Intronic
1060844921 9:126828441-126828463 CACCTGTAGTCACAGCACTTTGG - Intronic
1060967162 9:127717753-127717775 CACCTGTAGGTAGAGCACAAAGG - Exonic
1061313752 9:129780970-129780992 CACCTGTAATACGAGCACTTTGG + Intergenic
1203454514 Un_GL000219v1:152575-152597 CACCTGTAGTAATAACACTTTGG - Intergenic
1203653720 Un_KI270752v1:3514-3536 CACCTTTAGTCCCAGCACTTGGG + Intergenic
1186093706 X:6077547-6077569 CACCTGTAGTCATAGCACTTTGG - Intronic
1186564896 X:10651886-10651908 CACCTGTAATCCGAGCACATTGG - Intronic
1188830161 X:34886672-34886694 CTCCTTTAGTAATATCACATTGG + Intergenic
1190000962 X:46686178-46686200 CATCTTTAATATGAGCGCATTGG - Intronic
1190577057 X:51850636-51850658 CACCTTTAATACCAGCACTTTGG + Intronic
1192094777 X:68199239-68199261 CACCTGTAATATGAGCACTTTGG + Intronic
1195322849 X:103734666-103734688 CACCTTAAGCAAAAGCACTTGGG + Intergenic
1196922610 X:120600239-120600261 CACCTATAATCTGAGCACATTGG + Intronic
1197077421 X:122369014-122369036 CACCTGTAGTCAAAGCACTTTGG - Intergenic
1197538992 X:127730474-127730496 CACCTGTAATAACAGCACTTTGG - Intergenic
1198496545 X:137199076-137199098 CACCTATAATCAGAGCACTTTGG - Intergenic
1198875201 X:141217243-141217265 CACCTGTAATCCGAGCACATTGG + Intergenic
1200307090 X:155037964-155037986 CACCTTTAATACCAGCACTTTGG + Intronic
1201323905 Y:12733177-12733199 CACCTTTAATCACAGCACTTTGG - Intronic