ID: 950949862

View in Genome Browser
Species Human (GRCh38)
Location 3:16986741-16986763
Sequence AACTGCTTTTAAAACTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 374}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950949850_950949862 30 Left 950949850 3:16986688-16986710 CCATCTCACCTGGCCCCCTAGGG 0: 1
1: 0
2: 0
3: 31
4: 275
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949855_950949862 16 Left 950949855 3:16986702-16986724 CCCCTAGGGGTTCTTTAGCTCCT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949857_950949862 14 Left 950949857 3:16986704-16986726 CCTAGGGGTTCTTTAGCTCCTGC 0: 1
1: 0
2: 1
3: 15
4: 153
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949861_950949862 -4 Left 950949861 3:16986722-16986744 CCTGCATTAGGGATGGTAGAACT 0: 1
1: 0
2: 2
3: 2
4: 61
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949853_950949862 22 Left 950949853 3:16986696-16986718 CCTGGCCCCCTAGGGGTTCTTTA 0: 1
1: 0
2: 1
3: 17
4: 174
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949856_950949862 15 Left 950949856 3:16986703-16986725 CCCTAGGGGTTCTTTAGCTCCTG 0: 1
1: 0
2: 1
3: 8
4: 128
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374
950949854_950949862 17 Left 950949854 3:16986701-16986723 CCCCCTAGGGGTTCTTTAGCTCC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG 0: 1
1: 0
2: 5
3: 43
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950949862 Original CRISPR AACTGCTTTTAAAACTCTAA TGG Intronic
902356104 1:15901751-15901773 AACTGTTTTTAAAACTTTCTAGG + Intronic
904895616 1:33815372-33815394 AACTGCTTTTAAAAAGTTAGTGG - Intronic
906485020 1:46227789-46227811 AACTACTTTGAAAACGGTAAGGG - Intergenic
907930526 1:58995053-58995075 AACTGGTATAAAAACTTTAAAGG + Intergenic
908646707 1:66286355-66286377 AAATGCTATTAAAACTCAAAAGG + Intronic
909722070 1:78784665-78784687 AATTGCTTTAAAAACTGTGATGG + Intergenic
910147757 1:84102602-84102624 AATTTCTTTTAAAACTCTGTGGG - Intronic
910358092 1:86384516-86384538 AACTACTTATGAAACACTAAAGG + Intronic
910581609 1:88832920-88832942 AACAGCTTTTAAAGTTCTACTGG - Intronic
910753244 1:90657343-90657365 CACTGCTTTTCAAATTTTAAGGG - Intergenic
910814073 1:91271037-91271059 AACTGCTTCTACAATTCTACTGG + Intronic
911563409 1:99434040-99434062 AAATTCTTTTAAAAACCTAATGG + Intergenic
911906753 1:103578958-103578980 AATTACTTTTAAAAATTTAAAGG - Intronic
911950480 1:104167552-104167574 ACCTCCTTTTAACACTTTAAAGG - Intergenic
913564644 1:120060482-120060504 AACAGCTTTTCTAAATCTAAGGG + Intronic
913633486 1:120733081-120733103 AACAGCTTTTCTAAATCTAAGGG - Intergenic
914285231 1:146219832-146219854 AACAGCTTTTCTAAATCTAAGGG + Intronic
914546262 1:148670587-148670609 AACAGCTTTTCTAAATCTAAGGG + Intronic
914620303 1:149400082-149400104 AACAGCTTTTCTAAATCTAAGGG - Intergenic
915264943 1:154709995-154710017 AAATGCTTTGTAAACTATAAAGG - Intronic
915481698 1:156190805-156190827 AACTGCCTTAAAATATCTAATGG - Intergenic
915844554 1:159250761-159250783 AACTGCTTTTAAAATTATTTTGG - Intergenic
915862418 1:159459060-159459082 AACTGCTTCTAAAGCTTTTATGG + Intergenic
916629486 1:166596295-166596317 AATTGCTGTTAAAAATCTGAAGG + Intergenic
917879318 1:179318254-179318276 CACTGCTTTTAAAATTATAATGG + Intronic
918438469 1:184541674-184541696 CACTGCTTTTAAAGTTTTAATGG - Intronic
919138186 1:193536895-193536917 AGCTGCTTTTTAAATTTTAAAGG - Intergenic
919271345 1:195351591-195351613 AACTGCATTTAAAATTCAATTGG - Intergenic
919499483 1:198317985-198318007 AACAGCATTTAAAACCCTTAAGG - Intronic
919999356 1:202785057-202785079 AACTGATTTTACAAATATAAAGG + Intronic
921247105 1:213256127-213256149 AACTGCTTTTGAAACTATGAAGG - Intronic
922569027 1:226622077-226622099 AACTGTTTTTAAAATTCACATGG - Intergenic
1063862785 10:10330017-10330039 AATTGCTTTAAAAAATCCAAGGG - Intergenic
1064588776 10:16866544-16866566 AACAGCTTTTTAAACTTTATAGG + Intronic
1067964951 10:50901004-50901026 AAGTTTTTTTAAAAATCTAAGGG + Intergenic
1068323174 10:55447284-55447306 AAATGATTTAAAAACTCTATGGG + Intronic
1068724950 10:60290509-60290531 AAATGCTTCTAAATTTCTAAAGG + Intronic
1068994797 10:63190503-63190525 AATTTCTTTTAAAACTATATGGG - Intronic
1071011790 10:80948919-80948941 AACTGCTTTTGTAATGCTAATGG + Intergenic
1071207990 10:83305591-83305613 CATTGCTTTACAAACTCTAATGG + Intergenic
1071322922 10:84482525-84482547 AAATGCTTTTAAAACAGTATTGG - Intronic
1071479187 10:86050837-86050859 AGCTGATTTTAAAACTCTAAAGG + Intronic
1071767002 10:88678245-88678267 AAGTGCTTGTCAAATTCTAATGG - Intronic
1072749071 10:97963606-97963628 CTCTGCTTTTAAAACTCTGATGG + Intronic
1073182617 10:101594213-101594235 AAATGCTTTTAAAAGTATCATGG + Intronic
1075971894 10:126662161-126662183 AACTGGTTTTAAAATTATTATGG + Intronic
1076191876 10:128488887-128488909 AAGTGCTTTGTAAACTCAAAAGG - Intergenic
1077381706 11:2245475-2245497 AACTGATTTTAAAATTCCTATGG + Intergenic
1077986601 11:7357765-7357787 ACCTGATTCTAAAATTCTAAGGG - Intronic
1078270895 11:9793694-9793716 AACAGCTTTTAAAACTCCCCAGG - Intronic
1078740332 11:14060049-14060071 AATTACTTTTAAAAATGTAAAGG - Intronic
1079358350 11:19749026-19749048 ATCTGCTGGTAAAACTTTAAAGG - Intronic
1079800863 11:24866969-24866991 AACAGCTTTTAAGACTGGAATGG - Intronic
1079892713 11:26077652-26077674 ATTTGTTTTAAAAACTCTAATGG + Intergenic
1080381671 11:31778060-31778082 ATATGCTTTTAAAACTCGAGTGG + Intronic
1080486090 11:32708401-32708423 AACTAATTTTAAAACTCATATGG - Intronic
1080967794 11:37233895-37233917 AACTGCCTTTATAAAGCTAATGG - Intergenic
1080974604 11:37323153-37323175 ACCTGCTTTTAGAACCCTAATGG + Intergenic
1081942678 11:46957501-46957523 AAATGCTTTAAAAATTCTAAGGG - Intronic
1082700210 11:56420237-56420259 AACTGCTTTTAAAAACTTAGAGG - Intergenic
1083143783 11:60742540-60742562 AAATGCTTCTAAGAATCTAAAGG - Intronic
1083873491 11:65507080-65507102 AACTGGTTTAAAAACTTAAAAGG - Intergenic
1085775209 11:79359290-79359312 AACTGGTTGTAAAACTCTACAGG + Intronic
1086139302 11:83476891-83476913 AACTGCTTTATAAAGACTAAAGG + Intronic
1086771271 11:90770337-90770359 ACCTGCTTCTAAAACCCTAAGGG + Intergenic
1087979690 11:104596130-104596152 AATTGATTTTAAAACTCACAAGG + Intergenic
1090445858 11:126764096-126764118 AATGTCTTTTAAAACTCAAATGG - Intronic
1090540451 11:127697507-127697529 ACCTGGTTTTAAAACTAAAAAGG + Intergenic
1090632170 11:128659144-128659166 AACTGCTGTTAACACTTTAAAGG - Intergenic
1091522467 12:1260227-1260249 TAATGGTTTCAAAACTCTAAGGG - Intronic
1091646861 12:2279419-2279441 AACTGATTTTAAAATTCATATGG - Intronic
1092141754 12:6188799-6188821 AAGTGCTTTGTAAACTATAAGGG - Intergenic
1092819789 12:12342536-12342558 TACAGCTTCTAGAACTCTAATGG - Intronic
1093524128 12:20087717-20087739 AAGTGCCTTTAAAATTTTAAGGG + Intergenic
1095368558 12:41438753-41438775 AAATTCTGTTAAAACTATAAAGG - Intronic
1097797729 12:63881724-63881746 AACTGCTATTGGTACTCTAAAGG - Intronic
1098072029 12:66686017-66686039 TACTGTTTGTAAAACTCTTATGG + Intronic
1098525691 12:71484278-71484300 TAGTGCTTTATAAACTCTAAAGG - Intronic
1098641517 12:72843974-72843996 AACCTCTTTTAAAACTCATATGG + Intergenic
1098689264 12:73466108-73466130 TATTGCTTGTAAAACGCTAAAGG + Intergenic
1098754549 12:74343003-74343025 AAAAGCTTTAAAAACTTTAATGG + Intergenic
1099546176 12:83983200-83983222 CTCTGCTTTTAAAAATTTAATGG - Intergenic
1100197494 12:92263778-92263800 AATTGTTTTCAAAATTCTAATGG + Intergenic
1100525102 12:95411601-95411623 CACTGCTTTTAAAAAGGTAATGG - Intergenic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1101493394 12:105231245-105231267 TATTGCATTTAATACTCTAAGGG + Intronic
1102001901 12:109562692-109562714 CAGTGCTTTCTAAACTCTAAAGG + Intronic
1102686377 12:114727960-114727982 AAATACTTTTTAAACACTAATGG - Intergenic
1102833518 12:116031080-116031102 AATTATTTTTAAAACTCTTAGGG + Intronic
1103141313 12:118550809-118550831 AACTGCTTCTCAAACTTCAATGG + Intergenic
1103399750 12:120635589-120635611 AAGTGCTTTTAAAGCTGTAAAGG + Intergenic
1105801687 13:23909311-23909333 AGTTGTTTTTAAAAATCTAATGG - Intergenic
1105986017 13:25567858-25567880 AACTGCTTAAAAACCTCCAATGG - Intronic
1106192409 13:27465129-27465151 AACTCTTTTGAAAACTATAAAGG + Intergenic
1106393374 13:29357382-29357404 CACTTCTTTTAGAAATCTAAAGG - Intronic
1106732751 13:32558905-32558927 AATTGATTTTAAAATTCTTATGG - Intergenic
1107037791 13:35919191-35919213 AACTTGTTTTAAAACTCTTGGGG - Intronic
1107526115 13:41233350-41233372 ATATGGTTTTAAAAGTCTAATGG - Intronic
1107791408 13:44005853-44005875 AACTGAATTAAAATCTCTAAGGG - Intergenic
1107953953 13:45491307-45491329 AACCTCTTTTAAAGCTATAACGG - Intronic
1108274921 13:48798162-48798184 AAATGCTTTCAAAATTCTGAAGG + Intergenic
1108667481 13:52647339-52647361 AACTGATTCTAAAATTCAAATGG - Intergenic
1109280988 13:60355275-60355297 AGCTGATTTTAAATTTCTAAAGG + Intergenic
1110179697 13:72600804-72600826 ATTTGCTTTTAGAACTATAATGG + Intergenic
1110391272 13:74977408-74977430 ACCTGTTTTTAAATCACTAATGG - Intergenic
1110734644 13:78921853-78921875 AATTACTGTTAAAACTTTAATGG - Intergenic
1110766719 13:79288287-79288309 AACTGATTTAAAACTTCTAAGGG + Intergenic
1111127540 13:83930745-83930767 AACAGCTTTTATAAAACTAATGG - Intergenic
1111644652 13:91016433-91016455 AACTGTTGTTAAAAATGTAAAGG - Intergenic
1111730603 13:92071796-92071818 ATGTGCCTTTAAATCTCTAACGG + Intronic
1112691029 13:101894120-101894142 AATCACCTTTAAAACTCTAAAGG - Intronic
1113242884 13:108359424-108359446 AACTGTTTTTATAACTATGAAGG + Intergenic
1114508969 14:23240859-23240881 AACTGCTTTTTAAGCTGCAAAGG - Intronic
1114731355 14:24995940-24995962 CACTGCTTTCAGAACTCAAATGG + Intronic
1114856690 14:26455067-26455089 AACTGCTTTTTAAATTCTTTTGG - Intronic
1115665225 14:35537485-35537507 AAGTGCTATAAAAAATCTAATGG - Intergenic
1115921821 14:38382771-38382793 AAGTGCTTTTAAAACCATAGAGG + Intergenic
1116089536 14:40287294-40287316 AATTCCTTTTAAAACTCTGTGGG + Intergenic
1116310876 14:43325628-43325650 AACTCCTATCAAAATTCTAATGG - Intergenic
1116666993 14:47790166-47790188 AACAGCTTTTTCAACTGTAAAGG + Intergenic
1117013778 14:51497381-51497403 AACTCCTTTAAAAACTTTATCGG + Intronic
1118109115 14:62696181-62696203 AAATGCTTTGAAAAATATAATGG - Intergenic
1118116840 14:62787622-62787644 AACTGGCTTCAAAACTTTAAAGG + Intronic
1119066064 14:71528062-71528084 AATTGCTTTTAATATTCAAAAGG - Intronic
1120035489 14:79692151-79692173 AGCTGTTTTTTAAACTTTAAAGG + Intronic
1120212816 14:81650952-81650974 AACTTATTTTAAAATCCTAATGG - Intergenic
1120411811 14:84166836-84166858 AGCTGCTTTTATCACTCAAAAGG - Intergenic
1120981950 14:90298080-90298102 CACTGCTTTAAAACTTCTAAGGG + Intronic
1121422558 14:93825379-93825401 AACTGCTTTTCAGACTCCAGAGG - Intergenic
1123889648 15:24764028-24764050 AACTGCTTTTGTAAAGCTAATGG + Intergenic
1124106502 15:26742708-26742730 AACTGCTTTTTAAATGCTTAAGG + Intronic
1125039422 15:35166610-35166632 AACTGCCTATAAAACATTAATGG - Intergenic
1125203904 15:37129314-37129336 AAGTGCTTTGGAAGCTCTAAGGG + Intergenic
1126248886 15:46543168-46543190 AACTGATTTTAACATTGTAATGG - Intergenic
1127913124 15:63434813-63434835 AACTGCTTTTGTAAAGCTAATGG + Intergenic
1127923649 15:63516601-63516623 CAATGCCTTTAAAACTCTAAAGG - Intronic
1127948715 15:63783141-63783163 AACTTCTTTCAAAATTCAAAAGG - Intronic
1127964027 15:63910496-63910518 AACTGCATTTTAAAGTCTACAGG + Intronic
1128918209 15:71586957-71586979 AAGTGCTTTGAAAACTGTAAAGG - Intronic
1129047956 15:72753611-72753633 AAATGGTTTTAAAAATTTAATGG + Intronic
1129136645 15:73558488-73558510 AACTGGTTTTAAAACACTGCAGG + Intronic
1130189784 15:81722761-81722783 AACTGTCTTTAAAGATCTAAGGG + Intergenic
1130665450 15:85865467-85865489 AACTGCTTATAAAGGTCTTAGGG + Intergenic
1131413229 15:92228679-92228701 CACTGCTTTGAAAACTTTAATGG + Intergenic
1131725040 15:95212562-95212584 AACTGCTATTCAAAATTTAATGG - Intergenic
1131896137 15:97031915-97031937 AAATTATTTTAAAACTCAAATGG - Intergenic
1133522438 16:6572348-6572370 TTCTGCTTTTAAAACATTAAAGG + Intronic
1134463703 16:14453032-14453054 AACTGATTTTAAAAGTCAAAAGG + Intronic
1135130512 16:19850254-19850276 TGCTGCTCTTAAAACTCTACAGG - Intronic
1135834868 16:25816033-25816055 GCTTGCTTTTAAAAATCTAAAGG + Intronic
1136504939 16:30697209-30697231 AATTGCTTTGAAAGATCTAAAGG - Intergenic
1137476854 16:48816963-48816985 ATCTGCTTTGAAAGCTCTGAAGG - Intergenic
1138368570 16:56504650-56504672 AAATGCTTTTGAAATTTTAAGGG - Intronic
1138435047 16:56993776-56993798 AAGTGCTTTTACAACTCAACAGG - Intronic
1139726919 16:68907630-68907652 AAATGCTTTGAAAATTCTAAGGG - Intronic
1140565140 16:76032963-76032985 AAATGCTTTTTAAAATCTATTGG - Intergenic
1141829085 16:86499528-86499550 AAGTGGTTTTCAAACCCTAAGGG + Intergenic
1141909469 16:87048651-87048673 AATTGTTTTTAAAAATCCAATGG - Intergenic
1143424878 17:6827591-6827613 AACTGCTTCTAAAATTCATATGG - Intronic
1143969930 17:10788072-10788094 AAATGTTTCAAAAACTCTAATGG + Intergenic
1146200900 17:30857564-30857586 AAATGTTTTTAAAGCTCTATGGG - Intronic
1146395645 17:32463591-32463613 AGTTGCTTTTAAGACTCAAAAGG - Intronic
1149190311 17:54053417-54053439 CATTGCATTTAAAAATCTAATGG - Intergenic
1149642802 17:58215035-58215057 AACTCCTTTTTAAAATCCAAAGG - Intronic
1149712897 17:58758773-58758795 AACTGTTTTTAAACCTGTTAAGG - Intronic
1149745907 17:59097944-59097966 AACTGCATTTAAAATTCACATGG + Intronic
1150348658 17:64424324-64424346 AACTGCAGTTAAGACTGTAACGG - Intergenic
1151639790 17:75383014-75383036 AACAACTTTTAAAAATCTTAAGG - Intronic
1151678829 17:75613608-75613630 TCCTGCTTTTGAAACTCTCATGG + Intergenic
1153900252 18:9612391-9612413 AACTGCTTGTAAACCACTAGAGG + Intronic
1154180303 18:12131950-12131972 AATTGATTTTAAGACTCTCATGG - Intergenic
1154931332 18:20999986-21000008 AATTGCTATCAAAATTCTAAAGG + Intronic
1155016499 18:21846166-21846188 AAATGATTTTAAAATTCTTATGG - Intronic
1155063137 18:22246321-22246343 AACTGTTTTTAACACTCTCCTGG + Intergenic
1155901018 18:31390444-31390466 AAGTACTTTTAAAACAGTAAAGG + Intronic
1156169624 18:34466427-34466449 AACTGATTCTAAAACTCATATGG + Intergenic
1157431597 18:47632422-47632444 AACTGTTTTTAAATAACTAAAGG - Intergenic
1158073215 18:53497674-53497696 AATTTCTTTTAAGACTGTAAAGG - Intronic
1158307569 18:56123641-56123663 AACTGTTTTAAAAACTGTGATGG + Intergenic
1158347881 18:56534105-56534127 AACTCCTTATAAAAATCAAAGGG + Intergenic
1158924396 18:62238908-62238930 AACTACTTTAAAAACTTTTAGGG - Intronic
1159200657 18:65179733-65179755 TGCTGCTGTTAAAACTGTAATGG + Intergenic
1163431183 19:17268735-17268757 AAATGTTTTTAAAACTCCAAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164763365 19:30744683-30744705 CACATCTTTTAAAACTCTTAAGG - Intergenic
1165123053 19:33574972-33574994 CAATGCTTTTAAAATTCTGAGGG + Intergenic
1168509037 19:56959963-56959985 AACTGCTTTTGTAAAGCTAATGG + Intergenic
925496146 2:4451781-4451803 AATTGCTTTTAAAATCCTTAGGG + Intergenic
926339294 2:11891617-11891639 AACTGAATTTAAACCTCAAAAGG - Intergenic
926881067 2:17543682-17543704 AAATGCTTTAAAAGCTTTAAAGG - Intronic
927295071 2:21444567-21444589 CAGTACTTTTAAAACTCTCAAGG - Intergenic
927304823 2:21558792-21558814 AACTGCTTTTTAAAATCCTATGG - Intergenic
928350041 2:30542592-30542614 AACTTATTTTAAAATTTTAATGG - Intronic
928352144 2:30568244-30568266 AAATCCTTTACAAACTCTAAAGG - Intronic
929662515 2:43802343-43802365 GTTTGCTTTTAAAACTCTAATGG + Intronic
930612347 2:53557050-53557072 AAAGGCTTTTAAATCTATAAAGG - Intronic
931653131 2:64486620-64486642 AAGTGCTTTTGAACCTATAAGGG + Intergenic
933061927 2:77748710-77748732 AACTGTGTGTAAAACTCTAAAGG + Intergenic
933137428 2:78755282-78755304 AAATGTTTTTAAAACTCTTAGGG - Intergenic
933283025 2:80353758-80353780 AAGTGCTTTATAAACTCTAATGG + Intronic
935026278 2:99279989-99280011 CAATGCTTTAAAAACTCCAAAGG + Intronic
936043114 2:109164870-109164892 AAGTGCCTTTGAAACCCTAAAGG - Intronic
937260497 2:120583340-120583362 AACTGCCTTCAGAACTCTGAGGG - Intergenic
937763939 2:125637638-125637660 AACTGATTTTAAAATTCATATGG - Intergenic
938111397 2:128568441-128568463 ACCTGCTTTTCAAAATCTATGGG - Intergenic
939217461 2:139257584-139257606 AACTGCTCTTAAAAGTCAATGGG + Intergenic
939780759 2:146444833-146444855 AACCTCTTTTAAGGCTCTAATGG + Intergenic
941022217 2:160421017-160421039 AACTTCTGTTGAAACTCCAATGG + Intronic
941289284 2:163655197-163655219 AACTGCTTCCAAAAGTCAAACGG - Intronic
941633194 2:167906832-167906854 AATTGCTTTTAAAATTCCAAAGG - Intergenic
941800478 2:169653732-169653754 AACTCCATTTAAAAGTCAAATGG - Intronic
943288601 2:186039296-186039318 AAATTCTTTTACAACTTTAATGG - Intergenic
944619153 2:201495631-201495653 AACTGGTTTTCAAATTCTAGTGG + Intronic
945183763 2:207118804-207118826 AACTGTATTTCAAACTTTAAAGG + Intronic
945618265 2:212100845-212100867 ATCTGCTTTAATGACTCTAAAGG - Intronic
946548215 2:220769821-220769843 AATTTCTTTTTAAACTCTGATGG - Intergenic
946721632 2:222615185-222615207 CACTGCTTATAAAACTCTTCTGG - Intronic
947253608 2:228136717-228136739 AAGTGTTTCTCAAACTCTAATGG - Intronic
947885934 2:233571248-233571270 AACTGATTCTAAAATTCTTATGG + Intergenic
948140300 2:235668077-235668099 ACCTGCTACTCAAACTCTAAGGG - Intronic
948417891 2:237829094-237829116 AACTGCTTTTAAAAATAAAAAGG - Intronic
1169086459 20:2827921-2827943 AGCTGATTTTAAAACTCATATGG + Intergenic
1169323805 20:4658270-4658292 AATTTCTTTTAACACTTTAAGGG - Intergenic
1169462419 20:5807250-5807272 AACTGCTTTGAAAACTGGGATGG - Intronic
1169536553 20:6549379-6549401 AACTGATTGTAAAATTCAAATGG + Intergenic
1170654486 20:18273341-18273363 CACTGCTTATAAACCTCTAGTGG - Intergenic
1170690783 20:18613377-18613399 AACTGTTGCTAAAACTCTCAGGG + Intronic
1170765690 20:19288549-19288571 AAATGCTTTGAAATGTCTAAAGG - Intronic
1171443815 20:25188629-25188651 AATTGCTTTTGAAACTGTACTGG + Intergenic
1174227809 20:49018166-49018188 AAATGCTTTTTAAAATCTAATGG - Intronic
1175356235 20:58370708-58370730 ATCTGCTTCTTAAATTCTAATGG - Intergenic
1178006788 21:28230381-28230403 AACTCCTTTTAAAACTTCTAAGG - Intergenic
1179359599 21:40693555-40693577 AACTGCTATTAGTCCTCTAAGGG + Intronic
1179402806 21:41099677-41099699 CATAGCTTTTAAAACTATAAAGG - Intergenic
1179554110 21:42161857-42161879 AACTATTTTGAAAACTCAAAGGG - Intergenic
1181344140 22:22205272-22205294 ATTAGCTTTTAAAACTCTTAGGG - Intergenic
1181910801 22:26236689-26236711 AAGTGTTTTGAAAACTCTAATGG + Intronic
1182463587 22:30500170-30500192 AACTGGTATTAAAACTCTGGCGG + Intronic
1182635677 22:31724904-31724926 AACTGCCTTGAAAACTCTCAGGG + Intronic
1183105555 22:35612615-35612637 AACTGATTTTAAAATCCTGATGG + Intronic
1183130348 22:35828664-35828686 GACTCTTTTTAAAACTCTAATGG - Intronic
1183442458 22:37830880-37830902 GGCTGATTTTAGAACTCTAAGGG - Exonic
1183885157 22:40873935-40873957 AGCTGATTTTGAAACTCTTAAGG - Intronic
1184589094 22:45469294-45469316 ATATGTTTTTAAAACTTTAATGG - Intergenic
1184896834 22:47413266-47413288 AACTACTTTTAAAATTCCTATGG + Intergenic
1185253751 22:49820189-49820211 GACTGCTTTTATAATTCTAGTGG - Intronic
949291057 3:2466209-2466231 AAATTCTCTTAAAATTCTAATGG - Intronic
950072883 3:10166145-10166167 ATCTGATTTTAAAACTATAATGG - Intronic
950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG + Intronic
951686217 3:25347497-25347519 AACTTCATTTAAAAATCTAAGGG - Intronic
952363672 3:32655617-32655639 AACTACATGTAAATCTCTAATGG - Intergenic
953490919 3:43349852-43349874 CACTGCTTTTAAGACTCCCAGGG - Exonic
954902170 3:54029244-54029266 AACTGTTTTTAAAAATTTAGTGG - Intergenic
955108517 3:55924505-55924527 AAATGGCTTTAAAAATCTAAAGG - Intronic
955259655 3:57374055-57374077 CACTGCCTTTAAAACCATAATGG - Intronic
956159094 3:66329566-66329588 AATTTCTTTTAAAACTCTAATGG - Intronic
956970696 3:74521708-74521730 AACAGATTTTAAAATGCTAATGG + Intergenic
958454478 3:94312744-94312766 AAATCCATTTAAAACTCCAAAGG - Intergenic
959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG + Intergenic
959511426 3:107217102-107217124 AACTGCTTTTAAAACATCAAAGG + Intergenic
960199878 3:114819439-114819461 AACTTATTTTGAAGCTCTAATGG + Intronic
960665955 3:120108936-120108958 AAATTGTTTGAAAACTCTAAAGG + Intergenic
960892719 3:122467243-122467265 AACCTTTTTTAAAACTCAAAAGG + Intronic
961944890 3:130675634-130675656 AAGTGTTTTGAAAAGTCTAATGG + Exonic
962009987 3:131382930-131382952 ATCTGCTTCTAAACCTCTAGTGG - Exonic
962089847 3:132231382-132231404 AACAGGTTCTAAAACTCTATAGG + Intronic
962617274 3:137139203-137139225 CACTGCCTTTAAAATTCTGAAGG - Intergenic
962803809 3:138912872-138912894 ACCTGCTTTGATAACTTTAAAGG + Intergenic
963137336 3:141918737-141918759 AAATGCATTTAAAACCTTAAGGG - Intronic
963322601 3:143825485-143825507 AATTACTTTTAAAAGTCTTATGG + Intronic
963537117 3:146543281-146543303 AACTGCCTTTAGATCTGTAAAGG - Intronic
965163280 3:165163473-165163495 AACTGCCTTTATTACTCTGAAGG + Intergenic
965324210 3:167281846-167281868 CACTGCTTTAAAAGATCTAATGG + Intronic
965788877 3:172366257-172366279 AAATGTTTTTAACATTCTAAAGG + Intronic
966024856 3:175265408-175265430 TAATTCTTTTAAAACTCTATTGG - Intronic
966225981 3:177598570-177598592 ACCTGCTTTCAAAAATCTCAAGG - Intergenic
966728121 3:183126952-183126974 ATCTCTTTTTAGAACTCTAAAGG - Intronic
967245041 3:187477921-187477943 AACTGCTTTTGTAAAGCTAATGG - Intergenic
967449287 3:189604780-189604802 AACAGCTTTACAAACTGTAAAGG - Intergenic
967807036 3:193723879-193723901 AACTGATTCTAAAACTCATATGG + Intergenic
968019217 3:195369161-195369183 AAATGTTTTTGAATCTCTAAAGG - Intronic
969654696 4:8489819-8489841 AACTGCTTTTGTAAAGCTAATGG + Intronic
970678594 4:18481305-18481327 AACTTCTTTGAAAACCATAATGG - Intergenic
971529500 4:27667417-27667439 AAATGTTTTTAAAATTATAAAGG - Intergenic
972234352 4:37113403-37113425 AGCTGCTTTTAATACTGTAAAGG - Intergenic
973743666 4:53942814-53942836 AACTGCTTTTGAAACTCTTTGGG - Intronic
974688026 4:65257126-65257148 AACTATTTTTAAAAGTCTAAAGG + Intergenic
974693502 4:65333633-65333655 TCCTGACTTTAAAACTCTAAGGG + Intronic
975502579 4:75102980-75103002 GACTGCTTTTAAAACAGTACTGG + Intergenic
975830754 4:78366181-78366203 AACTGAATTAAAAAATCTAAGGG + Intronic
976994015 4:91407075-91407097 AACTGCTCTGAAAACTCAATAGG - Intronic
977008592 4:91605783-91605805 ACCAGTTTTTAAAACTCCAAGGG - Intergenic
977095770 4:92741876-92741898 AACCGCTTATAAAAGTGTAAGGG - Intronic
978192193 4:105926742-105926764 AACTGCTTTTCAATCTATAATGG - Intronic
978478372 4:109158789-109158811 ACCTGCTTCAAAAACTCAAAAGG + Intronic
978480183 4:109180359-109180381 TAGTTATTTTAAAACTCTAAAGG + Intronic
978508504 4:109488083-109488105 AACTGCTATTAAAAATATCATGG - Intronic
981592565 4:146380502-146380524 AATCGCTTTTAAAACTAAAAAGG - Intronic
981657637 4:147130131-147130153 AGCTGCCTCTAAAATTCTAAAGG - Intergenic
981803639 4:148687294-148687316 AACAGCTTTTAAAATCATAATGG - Intergenic
983184291 4:164683456-164683478 AACTGTTTTTTAAAATGTAAAGG + Intergenic
983614579 4:169687844-169687866 AAATGCTTTTTAAAATCCAATGG - Intronic
984750999 4:183274218-183274240 AACTGATACTAAAACTCTTATGG - Intronic
987984425 5:25127712-25127734 GACTGCTTTTTTCACTCTAATGG + Intergenic
988111040 5:26820107-26820129 AACTGGTTTTGAAACTTAAATGG - Intergenic
988673374 5:33406209-33406231 AAGTGCATTCAAAACTTTAATGG - Intergenic
989842487 5:46096865-46096887 AATTGCTATTAAAACCTTAAAGG + Intergenic
990804496 5:59643574-59643596 AATTGTTTTTAAAACTCCACTGG - Intronic
990920304 5:60957539-60957561 AACAGCTTTTAAAAAGATAAAGG - Intronic
991286711 5:64985267-64985289 AACTGATTCTAAAACTTTTATGG - Intronic
992393917 5:76354622-76354644 TAGTCCTTTTAAAACACTAATGG + Intergenic
992865706 5:80955195-80955217 AACAGCTATAGAAACTCTAAAGG + Intergenic
994147587 5:96412180-96412202 AAGTGCATTTAAAATTGTAAAGG + Intronic
994251683 5:97543250-97543272 AACTGCTGTTAAAACTGACACGG + Intergenic
994722910 5:103401239-103401261 TACTGCTTAGGAAACTCTAAGGG - Intergenic
994892584 5:105656725-105656747 AACTGCTTTTAAAATTTTTGTGG + Intergenic
995766389 5:115624542-115624564 AACTGCTTATAACCCTCTGATGG + Intronic
996620323 5:125493570-125493592 TACTGCTCTTCAAACTCTCATGG - Intergenic
996793115 5:127314488-127314510 AACTGCATAGAAATCTCTAACGG - Intronic
996808766 5:127489538-127489560 AAATGCTTTTAAGATTCTAAGGG + Intergenic
996854195 5:127986903-127986925 AATGGCATTTAAAACGCTAAAGG + Intergenic
996965651 5:129304830-129304852 AACTTCCTTTAAAATTCAAAAGG - Intergenic
998491170 5:142547859-142547881 AGCTGCTTTTTAAACTCAGATGG + Intergenic
999631813 5:153579111-153579133 AAATGCTTTATAAACTGTAAAGG + Intronic
999881118 5:155865018-155865040 AATAGGTTTTAAAAGTCTAAAGG - Intergenic
1000287645 5:159840712-159840734 AACTGCCTTTGAATATCTAAAGG - Intergenic
1000955893 5:167543068-167543090 TACTGATTTTAAAACTTTAGAGG + Intronic
1001596945 5:172904636-172904658 AACTGATTTTAAAAGGCCAACGG - Intronic
1002069101 5:176668281-176668303 AACAGCTTTTAGAACTCCAAGGG - Intergenic
1003027587 6:2570012-2570034 AACTGCTTCTAAAATTCATATGG - Intergenic
1003037410 6:2655809-2655831 AGATGTTTTTAAAACTATAATGG - Intergenic
1003704081 6:8504648-8504670 AACTGTTTTTAAAACTAAAATGG - Intergenic
1005594175 6:27362993-27363015 AAAGGTTTTTAAAACCCTAAGGG + Intergenic
1006118274 6:31787337-31787359 TACTTCTTATAAAACTCTTAAGG - Intronic
1006961828 6:37939585-37939607 AACTACTTTTAAAACAGAAATGG + Intronic
1007147923 6:39655918-39655940 AACTGATTTTAAAATTCACAAGG - Intronic
1007156224 6:39746988-39747010 AACTGCTTTTAGAACTGCTACGG - Intergenic
1007541381 6:42648590-42648612 AACTGCTTTAATATCTTTAAGGG - Intronic
1009221875 6:60993042-60993064 AAATGCTTTTAAAATTATAGAGG + Intergenic
1009281777 6:61761429-61761451 ATCAGCTTATAAAATTCTAATGG + Intronic
1009292425 6:61900393-61900415 ATTGGCTTTTAAATCTCTAAAGG - Intronic
1009408996 6:63343804-63343826 AACTGCTTTTAAAAGGCTCATGG - Intergenic
1010147704 6:72690660-72690682 AACTGCATACAGAACTCTAATGG + Intronic
1011882626 6:92049634-92049656 AACTATTTTTAAAACTCTAAAGG - Intergenic
1012004620 6:93697020-93697042 AACTATTTTTAAAACTCTAAGGG - Intergenic
1012310153 6:97713984-97714006 AAATTCTTTTAAAAATCTATTGG - Intergenic
1012419644 6:99050083-99050105 AACTATTTTTAAAAATCAAAGGG + Intergenic
1012896988 6:104960420-104960442 AAATGCTTATAAAACTAAAAAGG - Intronic
1013350832 6:109304241-109304263 AACTGATTTTAAATCGCAAACGG - Intergenic
1014350368 6:120335458-120335480 ATGTGCATTTTAAACTCTAAAGG + Intergenic
1014533776 6:122592785-122592807 CAGTGCTTTTCAAACTTTAATGG + Intronic
1017685345 6:156907999-156908021 AACTGTTTATAAAGCTATAAAGG + Intronic
1018229870 6:161665090-161665112 AACTGACTTTAAAACTCAAAAGG + Intronic
1018402922 6:163443928-163443950 AATTCCTTTTAAAGCCCTAAGGG + Intronic
1019053725 6:169205000-169205022 AATTGCTTTCAAAATTCTGATGG - Intergenic
1020865635 7:13557657-13557679 AACTACTTCTCAAACTCTACTGG - Intergenic
1021209930 7:17836748-17836770 AACTTTTTTTAAAACTCTATTGG + Intronic
1021555014 7:21910226-21910248 AGATGCTTCTAAAACCCTAATGG - Intronic
1021997104 7:26190027-26190049 AACTGCTTTTAAAAATTTAGGGG + Exonic
1022906224 7:34860061-34860083 AAATGCATTTAAATCTCTAGTGG - Intronic
1023412199 7:39899313-39899335 AACTTTTTTTAAACCTTTAAAGG - Intergenic
1023607352 7:41942655-41942677 AACTGCTTTCAAAAGACAAACGG + Intergenic
1024776775 7:52797073-52797095 CAATGCTTTTAAAATTCTGAGGG - Intergenic
1027567391 7:79813634-79813656 AAGGGCTTTTTAAACTATAAGGG - Intergenic
1028239653 7:88404186-88404208 AGCTGAATTTAAAACTTTAAAGG + Intergenic
1028367946 7:90056404-90056426 GACTCCTTATGAAACTCTAAGGG - Intergenic
1028679910 7:93514897-93514919 AAATACTTTTAGAAATCTAATGG + Intronic
1028941628 7:96528068-96528090 AACTGCTTTTTAATCTCTCAGGG + Intronic
1030479160 7:110080687-110080709 AACTTCTTTTTAAACACTGAAGG + Intergenic
1030535826 7:110765863-110765885 AACAGTTTTTAAAAATCTAATGG - Intronic
1030640621 7:112002167-112002189 GACTGATTTTAAAACTGTTAGGG - Intronic
1032369886 7:131338127-131338149 AGGAGCTTTTAAAACTCTCATGG - Intronic
1032892774 7:136217032-136217054 AACTGTTTTTTAAACTCTTTGGG - Intergenic
1033821796 7:145143280-145143302 AGCTGCTTTCAAAACTGCAATGG - Intergenic
1033869341 7:145731304-145731326 AACTGCTAATAAAACTGTTATGG - Intergenic
1035418793 7:158710077-158710099 AGCTGCTTTAAAAATACTAAAGG + Intergenic
1039016093 8:33150630-33150652 TACTGCTTTTTAAAATGTAAAGG - Intergenic
1039036875 8:33369340-33369362 AAATGCTTGAAAAACTCAAAGGG - Intergenic
1039201604 8:35100105-35100127 TACTTCTTTTAAATCTCTATAGG + Intergenic
1039893559 8:41700431-41700453 AACTGCTCATATAACTATAATGG - Exonic
1041055268 8:53979275-53979297 TAATGCTTTTAAAACCTTAAAGG - Intronic
1041139457 8:54800767-54800789 AAATGTGTTTAAACCTCTAATGG - Intergenic
1043004976 8:74808088-74808110 AACTGCTTTTGTAAAGCTAATGG + Intronic
1043458588 8:80437038-80437060 AACTGTTTTTAAAAATATAAAGG - Intergenic
1043640817 8:82447969-82447991 AACTGTTTTTAAAATTCACATGG - Intergenic
1043698762 8:83256474-83256496 TAGTGCTTTTAAAAATCTTATGG + Intergenic
1043877044 8:85497194-85497216 AAGTGCTTTTTGAACTCTACAGG - Intergenic
1044041931 8:87380559-87380581 AACTTCTATTAAAATCCTAATGG - Intronic
1044069622 8:87741045-87741067 AATCCCTTTTAAAAGTCTAAAGG + Intergenic
1044403601 8:91800063-91800085 AATTGCTATTAAAAACCTAAAGG + Intergenic
1045215847 8:100147571-100147593 AAATGCTCTTCAAACTCTGAAGG - Intergenic
1046427355 8:114072388-114072410 AAGTACCTTTAAAACTCTCAAGG - Intergenic
1046996292 8:120527496-120527518 AAGAGCTTTTAAGAATCTAAAGG + Intronic
1047010728 8:120669754-120669776 AAATGCTTGTTAAACTGTAATGG + Intronic
1052686887 9:31768388-31768410 AACTTCTTTAAGAACCCTAAAGG + Intergenic
1052694664 9:31861367-31861389 CATTGTTTTTAAAACTATAAAGG - Intergenic
1053599443 9:39595414-39595436 AACTGTTTTTAACATTCAAAAGG - Intergenic
1053857147 9:42349599-42349621 AACTGTTTTTAACATTCAAAAGG - Intergenic
1053896723 9:42748818-42748840 AACTGTTTTGAAAAATCAAAGGG + Intergenic
1054254082 9:62746973-62746995 AACTGTTTTTAACATTCAAAAGG + Intergenic
1054568142 9:66781135-66781157 AACTGTTTTTAACATTCAAAAGG + Intergenic
1055210880 9:73789328-73789350 AACTGATTTTAAATCTATGAAGG + Intergenic
1055998866 9:82193263-82193285 AACTGCTTTTGTAAAGCTAATGG + Intergenic
1057660003 9:96992443-96992465 AACGGCTTTTCACTCTCTAAGGG + Intronic
1059379705 9:113913504-113913526 AACTGCTTTCATACCTCCAAGGG - Intronic
1060678563 9:125540112-125540134 AAATGATTTTGAAACCCTAAGGG + Intronic
1061845986 9:133388636-133388658 AAATGCTTCTTAAACTCCAAAGG - Intronic
1062017462 9:134297959-134297981 AACTACTTTTGAAAATCCAAAGG + Intergenic
1186055901 X:5649388-5649410 AACCGCTTTTATAAAGCTAATGG - Intergenic
1186658261 X:11639866-11639888 ATCTACTTTTAAAAATCCAATGG - Intronic
1187599439 X:20811470-20811492 AAATGTTTTTAAAAATCTGATGG - Intergenic
1189238343 X:39506210-39506232 CACTGTTTTTAAAACTATGAAGG + Intergenic
1193782034 X:85714853-85714875 AAATGCTTTTAGAATACTAATGG + Intergenic
1194071998 X:89337486-89337508 AAATGCACTTAAAACCCTAATGG + Intergenic
1194220980 X:91191097-91191119 AACTGATTTTAAAACTTAGATGG + Intergenic
1194889032 X:99354545-99354567 AAATACTTCTAAAACTCTCATGG - Intergenic
1194981652 X:100447455-100447477 AAGTGCTTTGCAAACTCCAAAGG + Intergenic
1195062634 X:101211148-101211170 AACTGCTTCTAAGACTAGAAAGG + Intergenic
1196515908 X:116610389-116610411 AACTGCTGTGAAAACTCCACTGG - Intergenic
1197179121 X:123515276-123515298 TACTGATTTAAACACTCTAAAGG - Intergenic
1200557486 Y:4654850-4654872 AACTGAATTTAAAACTTCAATGG + Intergenic
1200726241 Y:6673223-6673245 AAATGCACTTAAAACCCTAATGG + Intergenic
1201697510 Y:16841985-16842007 AACTGCTTTTGTAAAGCTAATGG - Intergenic