ID: 950953821

View in Genome Browser
Species Human (GRCh38)
Location 3:17029620-17029642
Sequence TACCCAAGGCTTCCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950953821 Original CRISPR TACCCAAGGCTTCCCTTTTC TGG (reversed) Intronic
901212903 1:7536563-7536585 TAGCCCAGGGTTCCCTATTCTGG + Intronic
902812708 1:18897939-18897961 TCCCCAAACCTTCCCTTTCCTGG - Intronic
903340701 1:22652622-22652644 TGTCCCAGGCTTCCCCTTTCTGG - Intergenic
904352323 1:29916627-29916649 TACTCAATGCTTCCCTGTGCTGG - Intergenic
904478050 1:30777209-30777231 CACCCAATGCTTCCATTTCCAGG + Intergenic
904773581 1:32893998-32894020 TACCGCAGGGTTCCCTTTTCCGG - Exonic
907932037 1:59009514-59009536 AAGCCAGGGCTTCCCTTTCCTGG - Intergenic
911072271 1:93841682-93841704 CTCCCAAGCCTTCCCCTTTCGGG + Intronic
911552998 1:99306672-99306694 TGGCGAAGGCTGCCCTTTTCAGG - Exonic
911991735 1:104706842-104706864 GACCCAAGGGTTGCCATTTCTGG + Intergenic
912795746 1:112692577-112692599 GAGCCAAGGCTTCCTTCTTCAGG + Intronic
919516158 1:198526804-198526826 TGCCCAAGGCAACCATTTTCAGG + Intronic
921284192 1:213594163-213594185 TACCCATTGCTTCCATTTTTAGG - Intergenic
921606933 1:217167002-217167024 TAGCCAAAGCTGGCCTTTTCTGG + Intergenic
923692447 1:236208135-236208157 TACCCAAGGCTTGGTTTGTCAGG - Exonic
1063926059 10:10979016-10979038 TTCCCCAGGCTTCCAGTTTCAGG + Intergenic
1064364512 10:14695094-14695116 TTCCCCCGGTTTCCCTTTTCAGG + Intronic
1064403595 10:15041156-15041178 TACCCGAAGCTTCTCTTTCCTGG + Intronic
1069282257 10:66669622-66669644 TACCCACAGCTCCTCTTTTCTGG + Intronic
1070408361 10:76116458-76116480 AACCCCAGGCTTCCTATTTCCGG + Intronic
1070506952 10:77122099-77122121 TGCCCTAGGCTGCCCTTTACTGG - Intronic
1074597201 10:114878479-114878501 CAGCCAAGGCTTCTCTTTTCTGG - Intronic
1075684934 10:124357214-124357236 GAGCGAAGGCTTCCCCTTTCTGG - Intergenic
1080739156 11:35047879-35047901 TACTCAGGGATTCTCTTTTCTGG + Intergenic
1081219435 11:40441790-40441812 TACCCAACACTTTCCATTTCTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082794481 11:57369571-57369593 TGGCCAAGCCTTCCCTTGTCTGG - Intronic
1083438100 11:62656902-62656924 GACCCAACACTTCCCTTCTCAGG + Intronic
1085172721 11:74462813-74462835 GACATAAGACTTCCCTTTTCTGG + Intronic
1087589947 11:100174337-100174359 TACTCTAGGCTTTCCTTCTCTGG + Intronic
1087621374 11:100546890-100546912 GAGCCAAGGCTTTCCTTTTATGG - Intergenic
1089217945 11:116847067-116847089 GTCCCAAGGCTGTCCTTTTCAGG - Intronic
1089831808 11:121335647-121335669 TAGCCAAGGGTTCCTTTTTATGG + Intergenic
1090372994 11:126269461-126269483 CTCCCAAGGCGGCCCTTTTCAGG + Intronic
1090877014 11:130799251-130799273 TAGGCGAGGCTTCCCTTTTCTGG + Intergenic
1091321819 11:134657253-134657275 TACGCAAGGCTTCCCATCCCTGG + Intergenic
1093132161 12:15404578-15404600 TACCCAATGCTCTCCTTTTACGG + Intronic
1096265652 12:50120494-50120516 TAGTCAAGGCTCCCCTTTTGTGG - Intergenic
1097735995 12:63181235-63181257 TACCCATTGTCTCCCTTTTCTGG - Intergenic
1098290539 12:68953278-68953300 AACCCAAGGATTTCCTTTTGTGG + Intronic
1098524019 12:71465736-71465758 TACCTCAGGATTCCTTTTTCAGG + Intronic
1099783974 12:87237058-87237080 GACCGACTGCTTCCCTTTTCTGG - Intergenic
1101604538 12:106238245-106238267 AACCCAAGGACTCCCCTTTCTGG + Exonic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1104553218 12:129776470-129776492 TTCCCAAGGCAACTCTTTTCTGG + Intronic
1105828429 13:24143152-24143174 TCCCCAGGGCATTCCTTTTCTGG + Intronic
1109160074 13:58961091-58961113 TAGCCAAGACTTCCCTCTTGTGG + Intergenic
1113760932 13:112846082-112846104 TTTCCACAGCTTCCCTTTTCTGG + Intronic
1115888003 14:37995109-37995131 CAGCCAAGGCTTCCCTTTCTAGG + Intronic
1117541343 14:56749536-56749558 TGGCCAATGCTTTCCTTTTCAGG - Intergenic
1120886564 14:89456352-89456374 GAGCCAAGGTCTCCCTTTTCTGG - Intronic
1121505673 14:94474746-94474768 TCCCCAGGGCTTGCCTCTTCTGG + Intronic
1121615298 14:95309999-95310021 AATCCAGGTCTTCCCTTTTCTGG + Intronic
1121919059 14:97863739-97863761 TACCCAGGGCCTGCCTTTGCTGG - Intergenic
1125637392 15:41200608-41200630 TCCCCATGACCTCCCTTTTCTGG - Intronic
1127983874 15:64053275-64053297 TACGCCAGGCTTCCCTTCCCCGG - Intronic
1128377458 15:67087622-67087644 TGGCCAAGGCTTTCCTTTCCCGG + Intronic
1130022957 15:80246453-80246475 TAGCCAAAGCTTCCCTGTCCAGG - Intergenic
1135888230 16:26333078-26333100 TACCAATGGCATCCCTTATCAGG - Intergenic
1138053450 16:53807685-53807707 TATTCAAGGCTTACCTTTTTTGG + Intronic
1139038208 16:62973589-62973611 TAGCCAAAGCTGCTCTTTTCTGG - Intergenic
1139102592 16:63786627-63786649 TACCCCAGGCCTTTCTTTTCTGG + Intergenic
1140852032 16:78943921-78943943 TACCCAAGGCCTCCATTGCCTGG + Intronic
1144394216 17:14827893-14827915 GACCCAAGGCTTCCTTCTGCTGG + Intergenic
1144437847 17:15257478-15257500 CACCAAAGCCTGCCCTTTTCGGG + Intronic
1144656235 17:17038924-17038946 TAACCTTGGCTTCCCTTTCCAGG - Intergenic
1145203092 17:20964558-20964580 TACCCAATGGTTAGCTTTTCAGG + Intergenic
1145223688 17:21109887-21109909 CAGCCAGGGCTTCCCTTTCCAGG + Intergenic
1146279747 17:31537446-31537468 TACACAAAGTTGCCCTTTTCTGG - Exonic
1146473565 17:33144003-33144025 TAGGAAAGGCTTCCATTTTCTGG + Intronic
1151952831 17:77364655-77364677 CACCCATGGCCTCCCTGTTCAGG + Intronic
1152109545 17:78350107-78350129 TCCCCAAAGTTTCCCTTTTCCGG + Intergenic
1153868980 18:9298846-9298868 GACACAAGGCCTCCATTTTCAGG + Intergenic
1155702336 18:28762327-28762349 TTCCCAATTCTTCCCTTTGCTGG - Intergenic
1156588039 18:38454341-38454363 TACCGAAGGCTTATCTTTTGAGG + Intergenic
1158321746 18:56270802-56270824 TCCCCTAGCCTTCCCTTTCCTGG - Intergenic
1159052542 18:63434783-63434805 TGCCCAATGCTTCCCTTTTAGGG - Intergenic
1160355761 18:78227030-78227052 TACTCCAGGATGCCCTTTTCAGG + Intergenic
1165956131 19:39503189-39503211 TACCCCAGGCACCCCTCTTCAGG + Intronic
925419309 2:3698479-3698501 TTCCCCAGGCTTCACTTTTAAGG + Intronic
925516604 2:4690327-4690349 TGCCCATGGCTTCACTATTCTGG + Intergenic
927345858 2:22038697-22038719 TCCCCAAGACTCCCCTTCTCTGG - Intergenic
927713189 2:25338394-25338416 CCCCCAAGGCTTCTCTTTTTGGG - Intronic
929203544 2:39263798-39263820 CATCCATGGCTTCTCTTTTCCGG - Intronic
932616945 2:73238242-73238264 TTCCCAGGGCTTTCCTTTTTAGG + Intronic
932891512 2:75600975-75600997 TCCTCAAGGCTTCTCTTCTCAGG + Intergenic
935836681 2:107062679-107062701 TACCCAAGTCTTAATTTTTCTGG + Intergenic
937430400 2:121833049-121833071 TTCCCAAGGCTTCCCAGCTCAGG - Intergenic
938406683 2:131036729-131036751 TTCCCACTGCTTCCCTTCTCAGG - Intronic
938562817 2:132489584-132489606 TACCCAAGGTTTTCCTTACCCGG - Intronic
941391200 2:164917128-164917150 TACTCAAGCCTTCCCTTCCCAGG - Intronic
941955486 2:171199989-171200011 GACTCAAGAATTCCCTTTTCTGG + Intronic
947170466 2:227305715-227305737 TACTTAAGAGTTCCCTTTTCAGG - Intronic
947847276 2:233254772-233254794 TACCCAGGAGTTCTCTTTTCAGG + Intronic
948053903 2:234997318-234997340 TACCCAGGGTTTCCATTTCCAGG + Intronic
1169934135 20:10864844-10864866 TACCCATGGCTTCCCCTTTGGGG - Intergenic
1172227179 20:33312850-33312872 TGCCTAGGGCTTCCCTTTTGTGG + Intergenic
1172518919 20:35554870-35554892 GGCCCAAGGCTTGCCCTTTCTGG + Intronic
1179680238 21:43015096-43015118 TACCCAAGCATTTCCTTTCCTGG + Intronic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1182481992 22:30615115-30615137 TGCCCAAGACTTTCCTTGTCTGG - Intronic
1183477383 22:38042980-38043002 TCCCCAAGGCTTCCTTCTTCTGG - Intergenic
949106981 3:211146-211168 TACTCAAGGCTTCACTCTTGAGG + Intronic
949858133 3:8480972-8480994 TACTGAAGCCTTTCCTTTTCAGG + Intergenic
950763980 3:15259696-15259718 CACTCAAAGCTTCACTTTTCTGG - Intronic
950953821 3:17029620-17029642 TACCCAAGGCTTCCCTTTTCTGG - Intronic
951217082 3:20035649-20035671 TACTAAAGGCTTCCCTTATAAGG + Intergenic
952227689 3:31395784-31395806 TACACAATGCTTCTCTTTTCTGG + Intergenic
953651661 3:44810906-44810928 GAGCCAAAGCTTCCCATTTCAGG - Exonic
956612016 3:71133979-71134001 CACCCAAGCCTTCCCGTTTAAGG - Intronic
961441983 3:126958719-126958741 TACCCAGGGCTTCCCTCTCTTGG - Intronic
962339295 3:134568494-134568516 TCCCCAAGGATCCCCTTTTCTGG + Intronic
962538331 3:136351718-136351740 CACCCAAGGCTGCCTTTCTCAGG + Intronic
964260911 3:154835595-154835617 TAGCCAGGCCTTCCCTTTCCAGG - Intergenic
964870751 3:161311585-161311607 CACCCATGGCTTCCTTTATCTGG + Intergenic
967137827 3:186527501-186527523 TAGCCAAGGCTTCCTCTTTCAGG + Intergenic
968077696 3:195825389-195825411 CCCCCAAGGCTTCCTTCTTCAGG + Intergenic
971450397 4:26795110-26795132 TCCCCAAGGCCTCACTTATCTGG + Intergenic
972127639 4:35789369-35789391 TGCCCAAGAATTTCCTTTTCAGG + Intergenic
973194938 4:47428756-47428778 TAGCCAAGTCCTCCCCTTTCAGG + Intergenic
976875266 4:89846935-89846957 TACCCAAGGGATCCCTGTTAGGG + Intergenic
982229567 4:153196108-153196130 TTCTCAAAGTTTCCCTTTTCTGG - Intronic
986031523 5:3898399-3898421 TCCCAAAGGCTTCCCTTATTTGG - Intergenic
989384006 5:40836653-40836675 TATCCAAGGTTTCCCTTTGCAGG - Intergenic
990264918 5:54064588-54064610 CTCCCAAGTCTTCCATTTTCTGG + Intronic
993637960 5:90368700-90368722 TGGCCAAAGCTTCTCTTTTCAGG + Intergenic
996149214 5:120015026-120015048 TACCCACTGCTTTCCTTATCTGG - Intergenic
997910963 5:137872873-137872895 TACCCAGTGCTTCAATTTTCTGG + Intronic
998166478 5:139847305-139847327 TAGCCAGGGCTTCCCCATTCGGG + Intronic
998453771 5:142254550-142254572 TACCCAAGGCTGACATTTTCTGG - Intergenic
999214544 5:149921133-149921155 TACTCAAGGCTTCACCTTGCAGG - Intronic
1001125853 5:169018622-169018644 TACCCAAAGATTTCTTTTTCTGG - Intronic
1006300783 6:33192654-33192676 TACCCTAAGATTCTCTTTTCGGG + Intergenic
1007283228 6:40728125-40728147 TGCCCTAGGCTTCCCTCTTTGGG - Intergenic
1007819496 6:44550584-44550606 TGCCCCAGGCTGCCCTTTTGTGG + Intergenic
1009795121 6:68456465-68456487 TTCCTAAGGCTTCCCTTGGCTGG + Intergenic
1009977369 6:70685858-70685880 CTCCCAAGGCTTCTCTGTTCTGG - Intronic
1013000285 6:106015069-106015091 CAACCAAGGGTTCCCTTTGCTGG + Intergenic
1013806323 6:113999843-113999865 TGCCCAAGGCTTGCCTCTGCAGG - Intronic
1014820907 6:125987450-125987472 TACTCAAGGTTTTCATTTTCTGG - Intronic
1021770500 7:23996102-23996124 TAGCCCAGTCTTCCCTCTTCTGG - Intergenic
1022272789 7:28826524-28826546 AAACCAAGGCTTACCTTTTCAGG + Intergenic
1023230384 7:38021867-38021889 GGCCAAAGGCTTCCCTCTTCTGG + Intronic
1027135033 7:75617907-75617929 TACCCAAGGCTGCGCTTTCTAGG - Intronic
1027778293 7:82492929-82492951 TTCTCAAGGCTTCCCTTGGCTGG + Intergenic
1029096117 7:98086260-98086282 TCCCCAAGGACTCCCTTTGCTGG + Intergenic
1029633532 7:101768516-101768538 CACCCAAGGCTTTCCTTTTCAGG + Intergenic
1029707861 7:102285179-102285201 TGCCCATGGCTTCCCATCTCAGG + Exonic
1032735794 7:134691747-134691769 AATCCAAGACTTCCCGTTTCTGG + Intergenic
1033493386 7:141867373-141867395 TACCCAGTACTTCCCTTTTTTGG - Intergenic
1035097340 7:156366121-156366143 AACTCAAGCCTTCCATTTTCTGG + Intergenic
1042824235 8:72964014-72964036 TAGCCAGGCCTTCCCTTGTCTGG - Intergenic
1046675241 8:117100844-117100866 TACCCAGAGCTGCCATTTTCTGG + Intronic
1047560082 8:125977722-125977744 TAGCCGAGGCTTCTCTTTACAGG + Intergenic
1048948957 8:139476983-139477005 TATCTAAGTCTTCCCTTTTGAGG - Intergenic
1050755943 9:9003372-9003394 TACCCAAAGCCTCCCTCTGCTGG + Intronic
1051902857 9:22061229-22061251 TTCCCCAGGCCTCCCATTTCTGG + Intergenic
1051975183 9:22940588-22940610 CAGCCAGGGATTCCCTTTTCAGG + Intergenic
1051983516 9:23053856-23053878 TGTCCTAGGCTTCCCTTTTTTGG + Intergenic
1052357484 9:27519981-27520003 GACACAAGGCTTCCTTTTCCTGG + Intronic
1053199841 9:36144861-36144883 GACCCAGGGCTTGCCTTTGCGGG - Intronic
1056949601 9:91031635-91031657 AACCTAAGACTTCCCTTTCCAGG + Intergenic
1058323907 9:103671558-103671580 TACCCAATGTTTTCCTTTTCAGG - Intergenic
1058954475 9:109932484-109932506 TTCCTAAGTCTTCCCATTTCTGG + Intronic
1060807646 9:126587783-126587805 TTCCCAGGGCTTCCCTGTCCGGG + Intergenic
1060929545 9:127480077-127480099 TGCCCCGGGCTTCCCTTGTCAGG + Intronic
1190493436 X:51005029-51005051 TAACCATGGCTTGGCTTTTCTGG - Intergenic
1190510490 X:51169392-51169414 CAGCCAAGCCTTCCCTTGTCTGG + Intergenic
1192341938 X:70269914-70269936 TTCCCCAGGCTTCCCTTTTTTGG - Intronic
1196536139 X:116846753-116846775 AACCCAAGACTTGTCTTTTCTGG + Intergenic
1196864596 X:120059336-120059358 TTCCCCAGCCTTCCCTGTTCAGG - Intergenic
1196878505 X:120176995-120177017 TTCCCCAGCCTTCCCTGTTCAGG + Intergenic
1199565316 X:149209487-149209509 TCCTCATGGCTTCCTTTTTCAGG - Intergenic