ID: 950957611

View in Genome Browser
Species Human (GRCh38)
Location 3:17071133-17071155
Sequence CATTTGAACCATAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950957607_950957611 -4 Left 950957607 3:17071114-17071136 CCTGATGCATCACCATAGTCATT 0: 1
1: 0
2: 0
3: 6
4: 113
Right 950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 144
950957606_950957611 14 Left 950957606 3:17071096-17071118 CCTAGAATCAAAAGCTTTCCTGA 0: 1
1: 0
2: 3
3: 18
4: 248
Right 950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 144
950957605_950957611 29 Left 950957605 3:17071081-17071103 CCTTATTATTGTTGTCCTAGAAT 0: 1
1: 0
2: 0
3: 13
4: 211
Right 950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950957611 Original CRISPR CATTTGAACCATAAGGAGGT AGG Intronic
902453013 1:16510522-16510544 CATTTCAAGCATAAGGAGCCTGG + Intergenic
902473070 1:16663193-16663215 CATTTCAAGCATAAGGAGCCTGG + Intergenic
902485733 1:16744247-16744269 CATTTCAAGCATAAGGAGCCTGG - Intronic
902499472 1:16899712-16899734 CATTTCAAGCATAAGGAGCCTGG - Intronic
903546228 1:24124961-24124983 CATTTCACCCATAGGGAGGCTGG + Intronic
904182663 1:28677660-28677682 AATTTGAACCATAAAAATGTAGG - Intronic
905135576 1:35796622-35796644 GATTTCACCCATCAGGAGGTAGG - Intergenic
910613489 1:89170464-89170486 CATTTGAGCAACAAGGAGGTTGG - Intronic
912702191 1:111886741-111886763 CATTTTAACCAAAAGGAGAAAGG + Intronic
914097538 1:144556666-144556688 CATTTCAAGCATAAGTAGGCTGG + Intergenic
914301456 1:146380952-146380974 CATTTCAAGCATAAGTAGGCTGG - Intergenic
914729243 1:150356052-150356074 CATTTGTACAATAAAGAGGTAGG + Intergenic
915525680 1:156474961-156474983 CCTGTTAACCATAAGTAGGTGGG + Intronic
917604017 1:176606969-176606991 GATTTGAACCATAAGCAATTAGG + Intronic
919515980 1:198523785-198523807 AATTTGTACCATGTGGAGGTTGG - Intronic
920249013 1:204610018-204610040 TATTTGAGCCATTAGAAGGTAGG + Intergenic
921887531 1:220321707-220321729 CTTGTGAACCCAAAGGAGGTGGG + Intergenic
922744357 1:228035912-228035934 TATTTAAGCCATGAGGAGGTAGG - Intronic
922794652 1:228334080-228334102 TTTTTGAACAATAAGGAAGTAGG - Intronic
1063443474 10:6091904-6091926 CACTTGAAAGATAAGTAGGTGGG + Intronic
1065058986 10:21877766-21877788 CCCTTGAACAATATGGAGGTTGG + Intronic
1066030639 10:31420027-31420049 CATTAGAACAAAGAGGAGGTAGG - Intronic
1069471768 10:68698872-68698894 CATTTTAACGATCAGGAGTTGGG - Intergenic
1070607692 10:77910600-77910622 CATTTGTAAAATAAGGAGTTTGG + Intronic
1070774844 10:79103546-79103568 CATTTGATCCAAAAGGAGGGCGG + Intronic
1071325136 10:84507467-84507489 CATTTTAACCATAAAAAGGAAGG - Intronic
1073586018 10:104710850-104710872 CATGTGAAGCATGAGGAGGAGGG + Intronic
1073919828 10:108445922-108445944 CATCTGTTCCATGAGGAGGTTGG + Intergenic
1074321993 10:112411939-112411961 CATATGAGCCAGAGGGAGGTAGG - Exonic
1074848914 10:117422810-117422832 AATTCGAACCATTTGGAGGTAGG + Intergenic
1075517415 10:123119732-123119754 CATTTGACAGATGAGGAGGTGGG + Intergenic
1077674022 11:4181777-4181799 CATTAGACCCATAAAGAGGCAGG - Intergenic
1079850142 11:25522545-25522567 CATTTAAACCATAATCAAGTAGG + Intergenic
1080772388 11:35353925-35353947 CATTTAAACTTTAAGGAGGGAGG + Intronic
1082834800 11:57643847-57643869 CATTTGAAAGATAAGAAGTTAGG - Intergenic
1084949239 11:72655577-72655599 GATGTGAGCCATAAGGATGTGGG + Intronic
1089100731 11:115959965-115959987 CCATTGAACAATACGGAGGTTGG + Intergenic
1089235125 11:117017680-117017702 CCTTTGCACCTAAAGGAGGTAGG + Intronic
1090285719 11:125497158-125497180 CATTTCAACCATGAGAAGGATGG + Exonic
1095456350 12:42389713-42389735 CATCTTGACCATAAGCAGGTTGG + Intronic
1095992704 12:48047718-48047740 CATCTGAAAAATTAGGAGGTTGG + Intronic
1101698464 12:107149209-107149231 CATTTGAACCATGATGAGATGGG + Intergenic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113446464 13:110371987-110372009 CATTTGCACCCTGAGGAGCTGGG + Intronic
1114189069 14:20427479-20427501 CATTTGAAACAGAAAGAAGTGGG - Intergenic
1115441404 14:33440193-33440215 CATTTGTAACATGAGGAGCTGGG - Intronic
1117949380 14:61066198-61066220 TATTTTTTCCATAAGGAGGTAGG + Intronic
1120278288 14:82406724-82406746 CATATGAACTATATGGAGATTGG + Intergenic
1121521596 14:94589802-94589824 CATTTGCAAAACAAGGAGGTTGG - Intronic
1123993990 15:25705582-25705604 CATGTGAACGCTAAGGTGGTGGG + Intronic
1124190975 15:27575984-27576006 CATTTAGACCCTTAGGAGGTTGG - Intergenic
1124552009 15:30690252-30690274 CACTTGAACTAAAAGGAGGGGGG + Intronic
1126518360 15:49559441-49559463 CAGTTGCAACATAAGCAGGTAGG - Intronic
1127264406 15:57349890-57349912 CATTTGCACCTGAAGTAGGTAGG + Intergenic
1128272687 15:66325308-66325330 CACTTGAACCAGGAAGAGGTAGG + Intronic
1129463452 15:75711363-75711385 CAGTTGAAGCCCAAGGAGGTGGG + Intronic
1129721435 15:77880039-77880061 CAGTTGAAGCCCAAGGAGGTGGG - Intergenic
1135478708 16:22802319-22802341 ATCTTCAACCATAAGGAGGTGGG + Intergenic
1136585737 16:31183472-31183494 CATGTGATACATAAGGAGGTGGG + Intronic
1137479382 16:48838941-48838963 CATTTGAAAAATAAGGAGGTTGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137999126 16:53255742-53255764 CAATTGAATCAGAAGGACGTGGG + Exonic
1138145560 16:54606783-54606805 TATTGGAACCATAAGCATGTGGG + Intergenic
1143961887 17:10728210-10728232 GATTTGAACCATTTGGAGGAGGG - Intronic
1145102248 17:20086796-20086818 CATTTGAACGATGAGGACCTGGG - Intronic
1147438414 17:40431938-40431960 CATTTGTACAATGGGGAGGTGGG - Intergenic
1150813779 17:68377181-68377203 CATTTGTCCAATAAGGTGGTTGG - Intronic
1152495737 17:80670071-80670093 CATCTGAAAGATAAGGTGGTGGG + Intronic
1154987872 18:21570647-21570669 CATTTTAACTATAGGGAGATGGG + Intronic
1157791175 18:50532470-50532492 CATTTTAACGATAAGGAGCCTGG + Intergenic
1202705255 1_KI270713v1_random:18252-18274 CATTTCAAGCATAAGGAGCCTGG + Intergenic
926385270 2:12329701-12329723 CATTTGAAACAAAAGTAGCTAGG - Intergenic
933205871 2:79507154-79507176 CATCTGAAAAATAAGGAGGCTGG + Intronic
933726009 2:85427669-85427691 CATTTGAACCATAAGGCAGGCGG - Intronic
942308170 2:174628894-174628916 CATTTAAATCTTAAAGAGGTAGG - Intronic
942816227 2:180057321-180057343 CATTTCAAACATGATGAGGTAGG + Intergenic
944044668 2:195395627-195395649 CATATGAACCAAAAGGATGATGG + Intergenic
945121428 2:206461509-206461531 AATTTTAAAAATAAGGAGGTTGG + Intronic
946475354 2:220001468-220001490 CATTTGCAGTATAAAGAGGTTGG + Intergenic
1170701824 20:18710897-18710919 CATTTGAGGGTTAAGGAGGTTGG + Intronic
1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG + Intergenic
1172429107 20:34875770-34875792 CATTTGTGCAATTAGGAGGTGGG + Intronic
1173960549 20:47068446-47068468 CATTTGGACCATAAAGAATTTGG + Intronic
1174868238 20:54159202-54159224 CATTTGCAGAATAAGGTGGTGGG - Intronic
1175471120 20:59229442-59229464 CATCAGGACCATCAGGAGGTGGG - Intronic
1176865155 21:14046306-14046328 CCTTTGACACATAAAGAGGTTGG + Intergenic
1177710662 21:24769307-24769329 CATTCTAACCATAAGGATTTTGG - Intergenic
1177874367 21:26612829-26612851 CATTTTAACCACAAGGATGGGGG - Intergenic
1178494895 21:33078221-33078243 CATTTAACCCCCAAGGAGGTGGG - Intergenic
1180006841 21:45026679-45026701 CATTTAAGCCATGAGGATGTTGG + Intergenic
1181763231 22:25072337-25072359 CATCTGGACCATGAAGAGGTAGG + Intronic
1182077381 22:27504390-27504412 CATCTGAACCATAAGAAGATAGG + Intergenic
1184297294 22:43532879-43532901 CATCTGAGTCATAAGGTGGTCGG + Intronic
949717754 3:6952859-6952881 CATTTTAACCACGAGGATGTTGG - Intronic
950090847 3:10293113-10293135 AATTTGAACCAAGAGGAGCTTGG + Intronic
950767055 3:15280677-15280699 CATTTGAAGAATTAAGAGGTGGG - Intronic
950957611 3:17071133-17071155 CATTTGAACCATAAGGAGGTAGG + Intronic
950966639 3:17151428-17151450 CATCTGAAAAATAAGGAGGCTGG - Intergenic
952815478 3:37443648-37443670 CATTTAAACCATGAGTGGGTGGG + Intergenic
954348011 3:50017119-50017141 AATTAAAACCATAAGGAGCTGGG - Intronic
955472637 3:59301831-59301853 CATTTGAATCAGGAGGAAGTGGG + Intergenic
959393274 3:105803468-105803490 CTTTTGAATCATGAGGAGGTAGG - Intronic
959619627 3:108385964-108385986 AATTTTAACCATCAGGAGGCAGG + Intronic
960301517 3:116008719-116008741 CATTTGAAGGGAAAGGAGGTGGG + Intronic
960520534 3:118649394-118649416 CATTTGTACCACAGTGAGGTAGG - Intergenic
967863831 3:194174118-194174140 CATTTGGAAAATAAAGAGGTTGG - Intergenic
973028015 4:45298366-45298388 CATTTCAAACATAATGATGTGGG - Intergenic
975171556 4:71237576-71237598 AACTTGAACCAGAAGGTGGTGGG + Intronic
976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG + Intergenic
977098745 4:92780534-92780556 CATTTAAACAATAAGGAAGGGGG + Intronic
977663839 4:99622187-99622209 CATTTCAACCATTAGAAGGTTGG - Intronic
978872237 4:113593406-113593428 CCTCTGAACCATCATGAGGTAGG + Intronic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982015602 4:151150506-151150528 GTTTTGAACTAGAAGGAGGTGGG + Intronic
982051593 4:151507739-151507761 TGTTTAAACCATAAGGAGGTGGG - Intronic
982858605 4:160418138-160418160 CATTTAAAAAATAAGGAGCTGGG - Intergenic
993319029 5:86449543-86449565 CATTTGAGAGATAATGAGGTTGG + Intergenic
993750496 5:91660497-91660519 TATTTAAACCAAAAGGATGTTGG + Intergenic
994054164 5:95396912-95396934 CATTTGAAAAACAAAGAGGTTGG + Intronic
995041508 5:107593462-107593484 CTTAGGAACCATAAGCAGGTTGG - Intronic
996186154 5:120477729-120477751 CATTAGAACCATAACAAGGAAGG - Intronic
997009053 5:129855375-129855397 CATATTAAGCATCAGGAGGTAGG - Intergenic
998660015 5:144226215-144226237 CATTAGAATGATTAGGAGGTAGG + Intronic
999198844 5:149801958-149801980 CATAAGAACCCTAAGCAGGTGGG + Intronic
999544675 5:152614248-152614270 CATTTGCAACATAAAGAGGTTGG + Intergenic
1001311403 5:170613545-170613567 GATTTGAACCTGAAGGAGATGGG + Intronic
1002069289 5:176669869-176669891 CATTTTATGCATAAGGAGCTGGG + Intergenic
1003241628 6:4350328-4350350 CCTGTGAAGCCTAAGGAGGTGGG - Intergenic
1007930239 6:45684288-45684310 CATTTGAAATATAAGGAAATGGG + Intergenic
1012209501 6:96502308-96502330 CATTTGAACATTAAAGAGGCAGG + Intergenic
1016013249 6:139159848-139159870 CAGCTGCACCATAAGCAGGTGGG - Intronic
1016056249 6:139580498-139580520 AACTTGAACCAGAAGGAGGGTGG - Intergenic
1017944136 6:159079715-159079737 TATTTGAACCATCAAGAGTTGGG + Intergenic
1020929299 7:14372999-14373021 CGTTTGATCCATAAGGTGTTAGG + Intronic
1021339169 7:19442022-19442044 CAGTTGAAGCATAGGGAAGTTGG + Intergenic
1022528127 7:31051480-31051502 CATTTGCACTAGGAGGAGGTTGG + Intergenic
1024939268 7:54745326-54745348 CAATAGAACTAGAAGGAGGTAGG - Intergenic
1027651252 7:80871621-80871643 TATTGGAACGATAAGCAGGTGGG - Intronic
1028269985 7:88776709-88776731 CATTTAAACAGTAATGAGGTTGG - Intronic
1031147240 7:118010365-118010387 CATTATAACCATAAGAAGGTAGG + Intergenic
1033404104 7:141055220-141055242 CGTTTGAACCATAATGTGGAGGG - Intergenic
1033739178 7:144256195-144256217 CACTTGAACCATCTGGAGATTGG - Intergenic
1035941797 8:3909542-3909564 TATTTCAACCCTAGGGAGGTGGG + Intronic
1039536006 8:38313444-38313466 CATTTGATCCATGATGAGATAGG - Intronic
1043520676 8:81041998-81042020 CATTTGAACAACAAGAAGTTTGG - Intronic
1045149651 8:99389902-99389924 CATCTAAAACATAAGGAGGGGGG - Intronic
1045631850 8:104133631-104133653 CAGTTGAAACATAAGCATGTAGG + Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1053333929 9:37246441-37246463 CATTTGAAACATAATGAATTAGG - Intronic
1058002626 9:99881640-99881662 CATATGAACTAGAAGGAAGTTGG + Intergenic
1059061806 9:111040904-111040926 CATTTGGAACATAATGAGCTAGG - Intergenic
1059523904 9:114971459-114971481 CAATTAATCCAAAAGGAGGTAGG + Intergenic
1186045328 X:5530456-5530478 ACTTTGAACCATTAGGAGTTGGG - Intergenic
1186892012 X:13968211-13968233 AATTTGAACCATCAGGATCTGGG + Intergenic
1189092685 X:38103658-38103680 CATTTGTAACATGAGTAGGTTGG + Intronic
1195750386 X:108157918-108157940 CATCTGGACCACAAGGAGATAGG + Intronic
1198068702 X:133126467-133126489 CACTTGAGCCCTGAGGAGGTTGG + Intergenic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic