ID: 950961099

View in Genome Browser
Species Human (GRCh38)
Location 3:17108916-17108938
Sequence TGCTTCATTCCCAGCCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950961099_950961102 1 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961102 3:17108940-17108962 TAAGATTCCTGTTCTTATGGAGG No data
950961099_950961107 18 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG No data
950961099_950961105 16 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961105 3:17108955-17108977 TATGGAGGTTACATTCTAATGGG No data
950961099_950961104 15 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961104 3:17108954-17108976 TTATGGAGGTTACATTCTAATGG No data
950961099_950961106 17 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961106 3:17108956-17108978 ATGGAGGTTACATTCTAATGGGG No data
950961099_950961101 -2 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961101 3:17108937-17108959 CAATAAGATTCCTGTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950961099 Original CRISPR TGCTTCATTCCCAGCCTCTA GGG (reversed) Intergenic
No off target data available for this crispr