ID: 950961100

View in Genome Browser
Species Human (GRCh38)
Location 3:17108917-17108939
Sequence TTGCTTCATTCCCAGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950961100_950961102 0 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961102 3:17108940-17108962 TAAGATTCCTGTTCTTATGGAGG No data
950961100_950961104 14 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961104 3:17108954-17108976 TTATGGAGGTTACATTCTAATGG No data
950961100_950961107 17 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG No data
950961100_950961101 -3 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961101 3:17108937-17108959 CAATAAGATTCCTGTTCTTATGG No data
950961100_950961106 16 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961106 3:17108956-17108978 ATGGAGGTTACATTCTAATGGGG No data
950961100_950961105 15 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961105 3:17108955-17108977 TATGGAGGTTACATTCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950961100 Original CRISPR TTGCTTCATTCCCAGCCTCT AGG (reversed) Intergenic