ID: 950961101

View in Genome Browser
Species Human (GRCh38)
Location 3:17108937-17108959
Sequence CAATAAGATTCCTGTTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950961100_950961101 -3 Left 950961100 3:17108917-17108939 CCTAGAGGCTGGGAATGAAGCAA No data
Right 950961101 3:17108937-17108959 CAATAAGATTCCTGTTCTTATGG No data
950961099_950961101 -2 Left 950961099 3:17108916-17108938 CCCTAGAGGCTGGGAATGAAGCA No data
Right 950961101 3:17108937-17108959 CAATAAGATTCCTGTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950961101 Original CRISPR CAATAAGATTCCTGTTCTTA TGG Intergenic
No off target data available for this crispr