ID: 950967965

View in Genome Browser
Species Human (GRCh38)
Location 3:17159538-17159560
Sequence GAGTGGGTGAGGATGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 9, 3: 73, 4: 711}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950967965_950967971 -2 Left 950967965 3:17159538-17159560 CCCTCTGCCATCCTCACCCACTC 0: 1
1: 0
2: 9
3: 73
4: 711
Right 950967971 3:17159559-17159581 TCCTGTTAGAATTCCTGCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 79
950967965_950967977 28 Left 950967965 3:17159538-17159560 CCCTCTGCCATCCTCACCCACTC 0: 1
1: 0
2: 9
3: 73
4: 711
Right 950967977 3:17159589-17159611 GAGGAAAAGCATCCTTTCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 281
950967965_950967976 27 Left 950967965 3:17159538-17159560 CCCTCTGCCATCCTCACCCACTC 0: 1
1: 0
2: 9
3: 73
4: 711
Right 950967976 3:17159588-17159610 AGAGGAAAAGCATCCTTTCCAGG 0: 1
1: 0
2: 5
3: 32
4: 366
950967965_950967974 9 Left 950967965 3:17159538-17159560 CCCTCTGCCATCCTCACCCACTC 0: 1
1: 0
2: 9
3: 73
4: 711
Right 950967974 3:17159570-17159592 TTCCTGCGCAGGCAAAGGAGAGG 0: 1
1: 0
2: 1
3: 12
4: 171
950967965_950967973 4 Left 950967965 3:17159538-17159560 CCCTCTGCCATCCTCACCCACTC 0: 1
1: 0
2: 9
3: 73
4: 711
Right 950967973 3:17159565-17159587 TAGAATTCCTGCGCAGGCAAAGG 0: 1
1: 0
2: 1
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950967965 Original CRISPR GAGTGGGTGAGGATGGCAGA GGG (reversed) Intronic
900117884 1:1036247-1036269 GAGTGGGGGATGATGGCTGGAGG + Intronic
900276384 1:1831817-1831839 GGGAGGCTGAGGCTGGCAGATGG + Intronic
900394278 1:2446750-2446772 GAGGGGTTGGGGCTGGCAGAGGG + Intronic
900602140 1:3507417-3507439 GGCTGGGTGAGGTTTGCAGAAGG - Intronic
901059240 1:6464491-6464513 GAGTGGGTCAGGCAGGGAGAAGG + Intronic
901229275 1:7633004-7633026 GAGGGGGTGAGGCAGGCAGAGGG - Intronic
901324271 1:8357600-8357622 GAGGGAGTGAGGATGCCAGCTGG + Intronic
901815212 1:11789814-11789836 GAGGGGATGAGGAAGGCAGCTGG + Exonic
901930959 1:12595857-12595879 GAGGGGGTGAGGAGGGGAGCCGG + Intronic
902160109 1:14523161-14523183 GGGTTGGTGAGGATGCCAGTGGG - Intergenic
902319884 1:15654272-15654294 GAATGGGTGTGGGTGGCAGATGG + Intronic
902505876 1:16938882-16938904 GGGTGGGGGAGGGAGGCAGAAGG - Intronic
902649847 1:17829898-17829920 GGCTGGGTGGGGCTGGCAGAGGG + Intergenic
902654741 1:17859544-17859566 GAGGGGGAGAGGAAGGGAGAGGG + Intergenic
902667893 1:17952364-17952386 GAGAGGGAGAGGCTGGCGGATGG + Intergenic
902673761 1:17994075-17994097 GAGTGAGTGAGGATGTCAGCCGG - Intergenic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
902831060 1:19012983-19013005 TATTGGGTCAGGATGACAGATGG - Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904089675 1:27935957-27935979 GTGGGGGTGAGGTTGGCAGATGG + Intronic
904288316 1:29468013-29468035 GAGTGGGAAAGGATGGGAGGAGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904612760 1:31734417-31734439 GACGGGGTGAGGGAGGCAGACGG + Intronic
904622917 1:31786124-31786146 TAGTGGGTGAGGGCGGCAGCAGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904919185 1:33993546-33993568 GAGAGGGAGAGGCTGGCTGAGGG - Intronic
905404334 1:37722989-37723011 GAGTGGGTGAGGCTTCCAGATGG + Intronic
906170930 1:43724456-43724478 GGGAGGCTGAGGAAGGCAGATGG - Intronic
906721208 1:48006143-48006165 GAGAGGGAGAGAATGGAAGAAGG + Intergenic
907497092 1:54852401-54852423 AAGTGGGTGAGGACGCCAGGAGG + Intronic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
907928785 1:58979663-58979685 GATTTGGTGAGAATGTCAGAAGG - Intergenic
908071406 1:60464427-60464449 GAGTGCATGAGGATGAAAGATGG + Intergenic
909285243 1:73808012-73808034 GAGACAGTCAGGATGGCAGAGGG - Intergenic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911600942 1:99847845-99847867 GAATGGATGAGGAAGGCTGAGGG + Intergenic
912123089 1:106497927-106497949 GAGATGGTGATGATGGCTGAAGG - Intergenic
912677769 1:111701180-111701202 TAGTGGGTGAGTATAGCAGTGGG - Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
915199947 1:154220247-154220269 GAGTGGGTGGAGAATGCAGACGG + Intronic
915974722 1:160377651-160377673 GTGTTGGTGAGGAAGGCAGCCGG + Intergenic
916335308 1:163664546-163664568 GAGTGGGTGAAGAAGGCCCAAGG - Intergenic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917788994 1:178487465-178487487 GGCTGGGTGAGGACTGCAGATGG - Intergenic
918006826 1:180549007-180549029 GATTGGGGGAGGAGGGCAGGAGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921056479 1:211546408-211546430 GGGAGGCTGAGGAAGGCAGATGG - Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922209889 1:223478954-223478976 GAGAGGGTGAGGAGGTGAGAGGG + Intergenic
922609994 1:226919461-226919483 GAATGGCTGAGTTTGGCAGAAGG + Intronic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
923141601 1:231164390-231164412 AAGTTGCTGAGGGTGGCAGAGGG - Intronic
923426883 1:233879457-233879479 AAGGGGGAGAGGATGGGAGAGGG - Intergenic
923558073 1:235017363-235017385 AAGAGGGTGAGGATGGAAGCAGG + Intergenic
923727144 1:236516251-236516273 GGGAGGCTGAGGAAGGCAGATGG + Intergenic
923989280 1:239416874-239416896 TAGTTGGTGAGGATGGAAGTGGG + Intronic
924799271 1:247315638-247315660 GAGTGGGTAAGGAAGAGAGAGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063565608 10:7170580-7170602 GAGTCGGTGGAGATGGCAGGGGG + Intronic
1064304178 10:14150533-14150555 GATTGGGGGAGGCTGGGAGAGGG - Intronic
1064767258 10:18687335-18687357 GGGTGGGAGGGAATGGCAGATGG - Intergenic
1064890082 10:20161518-20161540 GAGTGGGAGAGGACGACAGAGGG + Intronic
1065223000 10:23515011-23515033 GAGAGAGAGAGGATGGAAGAAGG - Intergenic
1065768078 10:29050629-29050651 AAGTGTGGGAGGATGGGAGAGGG - Intergenic
1065813116 10:29460667-29460689 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1067221717 10:44348658-44348680 GGGTGGGTGAGGCTGGCCCAGGG + Intergenic
1067797244 10:49329526-49329548 GAGGGCGTGAGGAAGGAAGAAGG - Intergenic
1069605374 10:69735602-69735624 GAGAGGCTGAGGAAGGGAGAAGG - Intergenic
1069833520 10:71294979-71295001 GAGGCGCTGAGGAGGGCAGATGG - Intronic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1072019629 10:91385296-91385318 GAGTGGGTGAGTAAGGAAGAGGG - Intergenic
1072438751 10:95436155-95436177 GTGTGGGGGAGGGTGGCAGGTGG - Intronic
1072637623 10:97187761-97187783 GAGCGAGTGAGGATGCCAGGGGG - Intronic
1072809283 10:98446756-98446778 GAGTGGGTGAGGCTAGGAGTGGG + Intronic
1073679427 10:105686279-105686301 GAGTGGGTGGTGGTAGCAGATGG - Intergenic
1074116479 10:110460562-110460584 CAGGGGGCGAGGGTGGCAGATGG - Intergenic
1074147056 10:110726095-110726117 GAGAGGGAGAGGCCGGCAGAGGG - Intronic
1074779331 10:116789923-116789945 AGGTGGGTGAGGATGACAGTGGG - Intergenic
1074789800 10:116875448-116875470 GAGAGGGTGAGGTAGGAAGATGG - Intronic
1075160439 10:120020046-120020068 GAGCGGGAGAGGGTGCCAGATGG + Intergenic
1075923816 10:126235046-126235068 GAGTTGGGGAAGCTGGCAGAGGG + Intronic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076174317 10:128355430-128355452 GAGTAGGTGAGGAGGAGAGAAGG + Intergenic
1076530780 10:131142950-131142972 GAGTGGGAGCGGGAGGCAGAAGG + Intronic
1076653435 10:132005556-132005578 CAGAGGCTGAGGATGGCAGTGGG + Intergenic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077032395 11:474391-474413 GGGTGGGTGAGGGCGCCAGATGG + Intronic
1077042714 11:531637-531659 GAGTGGACGAGGTTGGCAGCTGG - Intergenic
1077234661 11:1474190-1474212 GAGGGTGTAAGGATGGCAGCTGG - Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077481748 11:2818251-2818273 GAGTGGGTGACAAGGGCACAAGG - Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078208747 11:9253082-9253104 GAGTGGGGGAGGATGGCTTTAGG - Intronic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078545303 11:12242578-12242600 AAGTGGGTGAGGGAGGCAGCCGG - Intronic
1078660430 11:13281335-13281357 GAGTGGGGGAGGCTGGCAGGAGG - Intronic
1080644901 11:34181412-34181434 GAGTGAGTCAGGTTGGCAGATGG + Intronic
1080646637 11:34192689-34192711 GAGAGAGTGGGAATGGCAGAGGG - Intronic
1081631461 11:44692717-44692739 GGGTCGGGGAAGATGGCAGACGG - Intergenic
1081693007 11:45090800-45090822 GTGTGAATGAGGCTGGCAGAGGG + Intergenic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1084195538 11:67522195-67522217 GAGTAGGTGAGGACGGCCCAAGG - Intronic
1084421611 11:69063315-69063337 GAGTGGGAGGGGACGGCAGAGGG - Intronic
1084614462 11:70226473-70226495 GGGTGGGGGATGGTGGCAGAAGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1086281535 11:85195131-85195153 TAGTGGCTGAGGGTGGGAGATGG + Intronic
1087924689 11:103906130-103906152 TAGTGTGTGAGCATGGGAGAGGG - Intergenic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089065383 11:115658786-115658808 GTTTGGGTGAGGGTGGCAAAGGG - Intergenic
1089292980 11:117449697-117449719 TAGTGGAGGTGGATGGCAGAGGG - Intronic
1089588120 11:119522780-119522802 GAGTGGGTGAGGCTGGCTCCTGG + Intergenic
1089893978 11:121908847-121908869 GAGAGGGTGAGGATGGAACTTGG - Intergenic
1089972923 11:122709005-122709027 GGGAGGCTGAGGCTGGCAGATGG + Intronic
1090074640 11:123572713-123572735 GAGTGAGTGTGTATGGCAAAAGG + Intronic
1090075700 11:123578846-123578868 TGGTGAGTGAGGATGGCAGGAGG + Intronic
1090596533 11:128326934-128326956 GAGTTGGGGAGGGAGGCAGAAGG - Intergenic
1091569308 12:1670516-1670538 GAGGGGGAGAGGATGCCCGAGGG - Intergenic
1091773740 12:3170720-3170742 GAGTTGGGGAGGATGGCAGGAGG + Intronic
1091786260 12:3244941-3244963 GAGAGAGAGAGGTTGGCAGAAGG - Intronic
1091821652 12:3479950-3479972 GTGAGGGGGAGGATGGGAGAGGG + Intronic
1092162327 12:6322638-6322660 GAGAGGCTGAGGCAGGCAGATGG + Intronic
1092255428 12:6924552-6924574 GAGCTGGGCAGGATGGCAGAGGG - Intronic
1092570439 12:9715712-9715734 CAGTGGGTGGGGATGGCAACTGG - Intergenic
1092760462 12:11805736-11805758 GCTTTGGTGAGGATTGCAGATGG + Intronic
1094065701 12:26358796-26358818 GAGTCAGTGAGGGTGGCAGGTGG - Intronic
1094135548 12:27121578-27121600 GATTGGGTGAGGCTGGTAAAGGG + Intergenic
1094499190 12:31007596-31007618 GAGGGGATGAGGGTGGCAGAGGG - Intergenic
1095040583 12:37435964-37435986 GAAGGGGTGAGAATGGTAGATGG + Intergenic
1095550678 12:43435254-43435276 GTGTGGAGGAGAATGGCAGAGGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095889270 12:47220687-47220709 GAGTGGGATAGAATGGCACATGG + Intronic
1096241055 12:49960760-49960782 GAGAGGAAGAGGCTGGCAGAGGG + Intergenic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096570442 12:52520108-52520130 GAGTGGGTGGCTATGGCAGCCGG - Exonic
1096625903 12:52895905-52895927 GAGTGGGAGGGGTTGGCAGTGGG + Intergenic
1096690129 12:53315399-53315421 GAGTGGGTGAAGACGGCATCCGG - Exonic
1097655920 12:62363386-62363408 GTGAGGGTGAGGATGGAACAAGG - Intronic
1101725611 12:107385855-107385877 ATGTCGGTGAGGATGGCAGGAGG - Intronic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102139037 12:110599314-110599336 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
1102589426 12:113946292-113946314 GGCAGGGTGAGGGTGGCAGAGGG + Intronic
1102766450 12:115437572-115437594 GGGAGGGTGTGGATGGCAGGCGG + Intergenic
1102963294 12:117107594-117107616 GCGGGGCTGAGGAGGGCAGATGG + Intergenic
1103003555 12:117404567-117404589 CCATGGCTGAGGATGGCAGAAGG + Intronic
1104738274 12:131153384-131153406 GTGAGGGTGAGGGTGGCAGGTGG - Intergenic
1104768810 12:131347084-131347106 GAGCGTGTGAGGATGGTAAAGGG - Intergenic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106045288 13:26134182-26134204 GAGACGATGTGGATGGCAGAAGG - Intronic
1106202284 13:27549472-27549494 CAGTGGTAGAGGCTGGCAGAGGG + Intronic
1106901191 13:34356469-34356491 GACATGGTGAGGATGGGAGAGGG - Intergenic
1107119827 13:36784439-36784461 TTTTTGGTGAGGATGGCAGAAGG + Intergenic
1108441042 13:50453038-50453060 CAGTGGAGGAGGATGGCATAGGG + Intronic
1108618685 13:52159957-52159979 GAGGGGGTTAAGATTGCAGATGG + Intergenic
1108801924 13:54108571-54108593 GGGTGGGTGGGGGCGGCAGACGG - Intergenic
1110643919 13:77859084-77859106 GAGTTGATGAGGATGACTGAAGG - Intergenic
1111133944 13:84014139-84014161 GAGTGGGTGAGGAAAGGAGAAGG + Intergenic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1112703952 13:102044726-102044748 GAGTGGTGGAGGATGGTGGAAGG - Intronic
1112896304 13:104304341-104304363 GAGTGGGTGAGTGCTGCAGAAGG - Intergenic
1112931215 13:104740767-104740789 GAGTCAGCGAGGCTGGCAGATGG + Intergenic
1113055948 13:106268274-106268296 GAGTAGGTGTTGATGGGAGATGG - Intergenic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1114059445 14:19006277-19006299 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1114103101 14:19395474-19395496 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1114263354 14:21055711-21055733 GAGAGGGTGGGGATGGTAGCAGG - Intronic
1114275071 14:21135662-21135684 GAGTGGGAGAAGATGGGAGTGGG - Intergenic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1115217366 14:31026374-31026396 GAGTGAGTGAGACGGGCAGATGG - Exonic
1115343612 14:32318613-32318635 CAGTGGTTGTGGATGGCCGACGG + Intergenic
1115380871 14:32737600-32737622 GAGAGGCAGAGCATGGCAGAGGG - Intronic
1115739686 14:36375023-36375045 GACTTGGTGAGGGTGGCAGTGGG + Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117200448 14:53384703-53384725 GATTGGGGGAGGCCGGCAGATGG - Intergenic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1119104630 14:71912528-71912550 GAGCTGGGGAGGATGGCTGATGG + Intergenic
1119105606 14:71920436-71920458 GAGCTGGTGAGGAGGGCTGATGG + Intergenic
1119205170 14:72788641-72788663 GAGGTGGGGAGGAGGGCAGAGGG - Intronic
1119288473 14:73475342-73475364 GAGTTAATGAGTATGGCAGAAGG + Intergenic
1120852819 14:89186544-89186566 GAGAGGGTGGGGTAGGCAGATGG + Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121198469 14:92096711-92096733 GAGAGGATGAGAATGGCAGAAGG - Exonic
1121327746 14:93031318-93031340 GAGTGGGGGAAGCTGGCAAAAGG + Intronic
1122323971 14:100871722-100871744 GAGTGTCTGAGGATGACACATGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1202837166 14_GL000009v2_random:86833-86855 CAGTGAGTGAGGTTGGCAGCTGG + Intergenic
1202906558 14_GL000194v1_random:76963-76985 CAGTGAGTGAGGTTGGCAGCTGG + Intergenic
1123627880 15:22239855-22239877 GAGAGGGTGAGGAAGGGGGAGGG - Intergenic
1123986218 15:25648542-25648564 GAGATGGAGAGGATGACAGATGG + Intergenic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124096128 15:26650371-26650393 GAGTGGGTGATGCTGAGAGAGGG + Intronic
1124816637 15:33000539-33000561 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1125404123 15:39335255-39335277 GGGTAGATGAGGATGGCAGGTGG - Intergenic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1128834113 15:70795238-70795260 GGGAGGGTGGGGATGGGAGATGG + Intergenic
1129056965 15:72826866-72826888 GAGGGGATGAGGATGCCACAAGG + Intergenic
1129113126 15:73349836-73349858 AAGTCCTTGAGGATGGCAGATGG - Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129686974 15:77691899-77691921 GCGTGGGTGGGGGTGACAGATGG - Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1130193072 15:81754812-81754834 AATTGGGTGAGGGTGGCAGCGGG - Intergenic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1131470634 15:92693700-92693722 GAGAGGCTGAGGGTGGGAGAGGG + Intronic
1131524910 15:93145029-93145051 GAGTGGATGAAGATGTCAGCCGG + Intergenic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1132092585 15:98958087-98958109 GCATGGGTGAGCATGGCAGCTGG + Exonic
1132322775 15:100938553-100938575 GAAGGAGGGAGGATGGCAGAAGG - Intronic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132515517 16:364117-364139 TGATTGGTGAGGATGGCAGAAGG + Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132989794 16:2786840-2786862 GAGGGAGTGAGGATGACCGAGGG - Intronic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1132989812 16:2786889-2786911 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989848 16:2786994-2787016 GAGGGGGTGAGGATGAGAGAGGG - Intronic
1132989873 16:2787083-2787105 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989898 16:2787165-2787187 GAGGGGGTGAGGATAGAGGAGGG - Intronic
1132989916 16:2787217-2787239 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989929 16:2787252-2787274 GAGGGGGTGAGGATGAGACAGGG - Intronic
1132989961 16:2787353-2787375 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1133834900 16:9359119-9359141 GAGAGGCTGAGGTGGGCAGAGGG - Intergenic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1136344369 16:29665410-29665432 TGCTGGGTGAGGATGGCAGCAGG - Exonic
1136461294 16:30411917-30411939 GATTGGGTTTTGATGGCAGAGGG - Intronic
1136497062 16:30651227-30651249 GAGAGGAGGAGGATCGCAGAGGG + Exonic
1136777530 16:32879736-32879758 CAGTCAGGGAGGATGGCAGACGG + Intergenic
1136893093 16:33981778-33981800 CAGTCAGGGAGGATGGCAGACGG - Intergenic
1137240972 16:46654147-46654169 GAGAGGGAGAGGAAGGGAGAGGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137602557 16:49766481-49766503 GCGTGGGTGAGGATGTCTGAAGG - Intronic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1137751392 16:50863506-50863528 GGGTGGGAGAGGGTGGGAGAGGG + Intergenic
1137996510 16:53220743-53220765 GAATGGGTGAAGATCACAGAAGG - Intronic
1138166008 16:54802346-54802368 TGGAGGGTGTGGATGGCAGATGG + Intergenic
1138197207 16:55060485-55060507 GAGTGGGTGAGGCAGGCAGCAGG - Intergenic
1138621584 16:58215675-58215697 CAGTGGGTGGGGATGACAGCAGG - Intergenic
1139527612 16:67526435-67526457 GAGTGGGTGGGCATGGTAGGGGG + Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140772588 16:78218457-78218479 GGGTGTGTGAGGATGCCAGGAGG + Intronic
1141051932 16:80774392-80774414 GGGTGGGGGAGGATGGGGGAAGG + Intronic
1141119257 16:81338751-81338773 AAGTGGCTGTGAATGGCAGAAGG + Intronic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141316042 16:82963480-82963502 GAGTGTGTGAGGATGTGATACGG - Intronic
1141570417 16:84930516-84930538 GAGTGGGTGTGGGTGTCAGTGGG + Intergenic
1141651794 16:85396752-85396774 GAGTGGGTGAGGGTGGCGGCAGG + Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1141895894 16:86958671-86958693 GAGTTGGTGAGGAGGGGAGGTGG - Intergenic
1141976072 16:87517484-87517506 GAGAGGGTGAGGAAGGGCGAGGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142281730 16:89152213-89152235 GAGTGGCTCAGGCAGGCAGAGGG + Intronic
1142399521 16:89852041-89852063 GGTTGGGGGAGGATGGAAGATGG - Intronic
1203079944 16_KI270728v1_random:1141845-1141867 CAGTCAGGGAGGATGGCAGACGG + Intergenic
1142658265 17:1409299-1409321 GGGAGGCTGAGGCTGGCAGATGG - Intergenic
1142740200 17:1927410-1927432 GAGTGAGTGAGGAAGGAAGGAGG + Intergenic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142959475 17:3543449-3543471 GAGTGTCTGAGCCTGGCAGAGGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143208934 17:5168885-5168907 GAGTGGTTTATGCTGGCAGAGGG - Exonic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143624962 17:8104387-8104409 AAGTGGGTCAGGATAGGAGATGG + Intronic
1143836749 17:9699101-9699123 GGGTGGGGGAGAATGGCAGGTGG + Intronic
1143852327 17:9822153-9822175 GGCTGTGTGAGGATGCCAGATGG - Intergenic
1144322135 17:14137073-14137095 GAGTTGGTGAGGATGCTAGAAGG + Intronic
1144889622 17:18487087-18487109 GGGAGGGTGAGGAGGACAGATGG + Intronic
1145142589 17:20457209-20457231 GGGAGGGTGAGGAGGACAGATGG - Intronic
1145230981 17:21172959-21172981 GAGTAAGCGTGGATGGCAGATGG - Intronic
1145721493 17:27077262-27077284 GGGAGGCTGAGGCTGGCAGATGG + Intergenic
1145831668 17:27921290-27921312 GAGGTGGTGAGCATGGCAGAGGG - Intergenic
1145935915 17:28714760-28714782 GCCTGGTTGAGGGTGGCAGAGGG - Intronic
1146001138 17:29131221-29131243 GAGTAGGTGGGGATTGCAGGGGG - Intronic
1146084770 17:29817470-29817492 GACTCCCTGAGGATGGCAGAAGG - Intronic
1146554446 17:33811726-33811748 AAGTAGCTGAGGCTGGCAGAGGG + Intronic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147910105 17:43850715-43850737 GAGAGGCTGAGGCAGGCAGATGG - Intronic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1148746346 17:49920365-49920387 GCCTGGGTGAGGATGGGACAGGG - Intergenic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1150569957 17:66376770-66376792 GAGGGGGTGAGGATGGGTGGGGG + Intronic
1150686182 17:67322715-67322737 GGGAGGCTGAGGCTGGCAGATGG - Intergenic
1150793051 17:68215021-68215043 GAGAGGCCGAGGAGGGCAGATGG - Intergenic
1150993017 17:70282684-70282706 TTGGGGGTGAGAATGGCAGAGGG + Intergenic
1151153617 17:72109055-72109077 GAGTGGGTTAGAAAGGAAGAGGG - Intergenic
1151435760 17:74096111-74096133 GAGAGTGTGAGGAAGGAAGAGGG - Intergenic
1151671604 17:75574274-75574296 GAGAGGGTGGGGCTGGCAGGAGG + Intronic
1151996101 17:77610016-77610038 AAGGGGGTGAGGAAGGAAGAGGG + Intergenic
1152217162 17:79040358-79040380 GAGAGGTTGAGGTGGGCAGATGG + Intronic
1152374947 17:79914196-79914218 GGGTGGCAGGGGATGGCAGAGGG - Intergenic
1152410606 17:80120681-80120703 GAGGAGGTGAGGAGGGGAGAGGG - Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1153576257 18:6524661-6524683 TAGTGGGTGAGGATGCAAGTAGG + Intronic
1154430453 18:14304204-14304226 GTGTGGGTGAGGATGAAACATGG + Intergenic
1155537312 18:26830784-26830806 GAGTGGAGGAGTAGGGCAGAAGG + Intergenic
1156104865 18:33647860-33647882 GAGTGGGGGAGTAGGGGAGAGGG + Intronic
1157007464 18:43601621-43601643 GAGAGGGAGAGAGTGGCAGAGGG + Intergenic
1157181863 18:45505428-45505450 GAGTGGGTGAGGAGCCCACAGGG + Intronic
1157531322 18:48423264-48423286 GAGTGGGTGGGGAAGGGAGGAGG - Intergenic
1158542335 18:58368547-58368569 GAGTGGTTGAGGATGGGAAGAGG + Intronic
1158811282 18:61039319-61039341 GAGTGGGAGGGTAAGGCAGAGGG - Intergenic
1159914073 18:74173327-74173349 GACTGGGTGAGGAAGGGAGGAGG - Intergenic
1159918277 18:74204735-74204757 GGATGGGTGAGGGTGGGAGAAGG + Intergenic
1159918288 18:74204762-74204784 GGATGGGTGAGGGTGGGAGAAGG + Intergenic
1160237533 18:77097868-77097890 GAGTGGGAGAGGTTTGCAGCAGG + Intronic
1160439127 18:78875692-78875714 GAGGGCGTGCTGATGGCAGACGG + Intergenic
1160575186 18:79849122-79849144 GACAGGGTGGGGCTGGCAGAGGG - Intergenic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1161035249 19:2080899-2080921 GAGAGGGTGAGGTAGGTAGATGG + Intronic
1161322252 19:3646690-3646712 GAGCGGGTCAGGATGGCAGCTGG - Intronic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161629351 19:5344479-5344501 GAGTGAGCGAGGGTGACAGAGGG - Intergenic
1162220555 19:9172787-9172809 AAGAGGCTGAGGTTGGCAGATGG - Intergenic
1162549302 19:11349770-11349792 GAATGGGTGACCATGGCAGGGGG - Intronic
1162839571 19:13346239-13346261 GAGTGAGTGAGGATGAAGGAAGG - Intronic
1162875286 19:13616841-13616863 GAGTGAGTGAGGGGGCCAGAAGG + Intronic
1163680841 19:18681458-18681480 GAGTGGGTGGGGTTGAGAGAAGG + Intergenic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164799220 19:31062222-31062244 GTGGTGGTGTGGATGGCAGAGGG + Intergenic
1164820875 19:31250351-31250373 GAGCGGGTGAGGATTAGAGATGG - Intergenic
1164881824 19:31739213-31739235 GAGTTGGGGAGGTTGTCAGAGGG + Intergenic
1165773935 19:38394223-38394245 GAGTGAGAGAGGAAGGCAGCTGG + Intronic
1165833741 19:38742546-38742568 GATTAGGTGAGGATGGAAGGAGG + Intronic
1165845088 19:38812932-38812954 GAGTGGGAGATGGTGGCGGATGG + Exonic
1166343711 19:42152701-42152723 GAGGGGGTGAGTATGGGAGTGGG + Intronic
1166422940 19:42652673-42652695 GAGTTGATGAGGATGGAAGGAGG - Intronic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167428678 19:49442448-49442470 GGGCGGGTGAGGATGCCAGGGGG - Intergenic
1167571534 19:50292071-50292093 GAGTGGGAGAGGCTGGCTCAGGG + Intronic
1167712188 19:51119172-51119194 TAGTGGGGGATGATGGAAGAGGG + Intergenic
1168062428 19:53900386-53900408 GGGTGGGTGGGGACGTCAGAAGG - Intronic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168267330 19:55230019-55230041 GCGTGGGTGGGGGTGCCAGAGGG - Exonic
1168676481 19:58281583-58281605 GAATGGGTGATGATGGGAGGTGG + Intronic
924994129 2:341334-341356 GAGTGGGTGTAGGTGGGAGAGGG - Intergenic
925405363 2:3602543-3602565 CAGCGGGCGAGGATGGCAGCTGG - Intronic
926308873 2:11660026-11660048 GACTGAGTGAGTGTGGCAGAAGG - Exonic
926957138 2:18313912-18313934 GAGTTGGTCAGGATGTCACAAGG + Intronic
927477666 2:23426157-23426179 GAGGGGATGAGTAGGGCAGAGGG + Intronic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
927690816 2:25206934-25206956 TGGTGGGCCAGGATGGCAGAAGG + Intergenic
927800901 2:26098375-26098397 GAGAGGCTGAGGTGGGCAGATGG - Intronic
928273584 2:29878883-29878905 GAGAAGGTGAGGCTGGTAGATGG + Intronic
928277190 2:29913561-29913583 GTGTGGGTGAGGATGGTTGTAGG - Intronic
928716458 2:34066579-34066601 GAGTGAGTGGGAATGGTAGATGG + Intergenic
928948917 2:36797507-36797529 GAGTCAGAGAGGAAGGCAGATGG + Intronic
929045460 2:37784770-37784792 GAGAGGGTGAGGCTGCCAGCTGG - Intergenic
929512509 2:42575857-42575879 GAGGAGGTGAGGATGGATGAGGG - Intronic
929792172 2:45031428-45031450 AGGCTGGTGAGGATGGCAGAAGG - Intergenic
930088285 2:47513910-47513932 GAGTGGAGGAGGAAAGCAGATGG - Intronic
930654956 2:53998709-53998731 GAGAGGCTGAGGATGGAGGATGG + Intronic
932471728 2:71963551-71963573 GAGTTGTTGTGGATGGGAGAGGG - Intergenic
934494747 2:94787634-94787656 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
934614433 2:95762537-95762559 GGGTGGGGCAGGGTGGCAGAGGG + Intergenic
934646472 2:96061962-96061984 GGGTGGGGCAGGGTGGCAGAGGG - Intergenic
935012550 2:99149319-99149341 GAGTTGACCAGGATGGCAGAAGG - Intronic
935133726 2:100280282-100280304 GAGGGGGTGATGCTGGCAAAGGG + Exonic
935308461 2:101759765-101759787 GAGGGGGAGAGGATGGGGGAAGG - Intronic
935717624 2:105952958-105952980 GAAGGGGTGAGGAAGGCAGGAGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936090313 2:109497947-109497969 AAGAGGTGGAGGATGGCAGAAGG + Intronic
936233023 2:110720583-110720605 GGGTGGGGGTGGGTGGCAGATGG - Intergenic
936376553 2:111946090-111946112 GAGTGAGTGGGGAAGACAGAGGG + Intronic
936391928 2:112082886-112082908 GATTCCCTGAGGATGGCAGATGG - Intronic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937062474 2:118990850-118990872 CAGGGGCTGAGGATGGCAAAGGG + Intronic
937062479 2:118990868-118990890 AAGGGGCTGAGGATGGCAAAGGG + Intronic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938281766 2:130068373-130068395 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
938332387 2:130456922-130456944 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
938357420 2:130663746-130663768 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
938402501 2:131005050-131005072 GGGTGGCTGAGTATGGCTGAGGG + Intronic
938433856 2:131270533-131270555 GAGTGGGTGAGGTTGGTGGCTGG + Intronic
938477892 2:131633179-131633201 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
938701650 2:133885158-133885180 GAGTGGGTGATGAGGACACACGG + Intergenic
938727446 2:134120651-134120673 GAGCGGCGGGGGATGGCAGATGG + Intronic
939940692 2:148347483-148347505 GTGTAGGAGAGGATGGCATAAGG - Intronic
940112744 2:150171729-150171751 GAGTGTGTTAGGGTGGCAGTGGG - Intergenic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941195373 2:162444184-162444206 GAGGGGTAGGGGATGGCAGAGGG - Intronic
941918541 2:170828034-170828056 GGAGGGGTGAGGATGGCAGAAGG - Intronic
941918603 2:170828301-170828323 AAGAGGGTGAGGACAGCAGAGGG - Intronic
942393457 2:175521054-175521076 GTGTGTGTGAGAATGACAGATGG - Intergenic
942693536 2:178612910-178612932 GAGTGGGTCAGAGTGGCGGAAGG - Exonic
942958030 2:181797259-181797281 GAGTGGGTGTGCATGTCAGGAGG + Intergenic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944897276 2:204177963-204177985 GAGTGGTTGAGGATGCAAGGAGG - Intergenic
945852105 2:215021086-215021108 GAGAGGCTGAGGCCGGCAGATGG - Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946754598 2:222931608-222931630 TATTGGGAGAGGGTGGCAGAAGG - Intronic
947511003 2:230754367-230754389 GAGGGGAAGAGGAAGGCAGAAGG - Intronic
947549429 2:231036181-231036203 GTGTGTGTGAGGGTGGCACATGG - Intergenic
947665118 2:231900620-231900642 GAATGGGCGTGGACGGCAGAAGG - Intergenic
947927658 2:233935769-233935791 AAGTGGGTGGGGCAGGCAGAAGG + Intronic
948780549 2:240319113-240319135 GAGGGGGTGAGACTGGAAGAGGG + Intergenic
1168856701 20:1013787-1013809 GAGTGGATGAGGATGGGAGTTGG + Intergenic
1169002376 20:2177373-2177395 GAGTGGGGCAGGAGGGCACAGGG - Intergenic
1169046622 20:2538353-2538375 GAGTGGATGAGGCAGGCAGGTGG - Intronic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1169915670 20:10680828-10680850 GGGTGGGTGAGGAAGGTAAATGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170952153 20:20946887-20946909 GCGTCGATGAGGATGGCAGTGGG - Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171201580 20:23246204-23246226 TAGTGGGTCAGGATGAAAGAGGG - Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1172142293 20:32731798-32731820 GGGTGGGTGAGCATTCCAGAGGG - Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173736810 20:45367643-45367665 GTCAGGGAGAGGATGGCAGATGG + Exonic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1173823399 20:46032315-46032337 GAGGGGGTGTGAAAGGCAGAGGG + Intronic
1173881541 20:46416751-46416773 GATTGGGTCAAGATGGCAGATGG + Intronic
1174177334 20:48653297-48653319 GAGTGGGGGTGGGTGGCTGAGGG - Intronic
1174414824 20:50359794-50359816 GAGTGGGTGAGGCTGGAAGCAGG + Intergenic
1174548405 20:51343654-51343676 AGGTGGGAGAGGATGGCAGTGGG + Intergenic
1174698460 20:52583706-52583728 GAGTGGGTGGTGATGGCTGGAGG + Intergenic
1175230658 20:57471410-57471432 GGGTGGGTGAGGTTGGGGGATGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175984187 20:62755803-62755825 GAGGGAGGGAGGATGGCTGAAGG - Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176372316 21:6069482-6069504 GAGTGGGCAAGGATGACACACGG + Intergenic
1176521636 21:7829314-7829336 AAGTAAGTGAGAATGGCAGAAGG + Intronic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1178655656 21:34459326-34459348 AAGTAAGTGAGAATGGCAGAAGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179426438 21:41283020-41283042 GTGTGGTTCAGGATGGCGGATGG - Intergenic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179751202 21:43469057-43469079 GAGTGGGCAAGGATGACACACGG - Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180477925 22:15728892-15728914 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1180881035 22:19203664-19203686 GTGTGGGAGAGCATGGCAGTGGG - Intronic
1181114180 22:20620937-20620959 GAGGTGGTGAGCATGGCAGAAGG - Intergenic
1181387874 22:22558288-22558310 GGAGGGGTGAGGATGGCGGAAGG + Intronic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1181639617 22:24189743-24189765 GAGAGGGTGAGGCTGGAAGTTGG + Intergenic
1181726350 22:24813750-24813772 GATGTGGTGAGGATGGCAGGAGG + Intronic
1181829285 22:25546500-25546522 GAGGGGGAGAGGATGGGAGGAGG - Intergenic
1181852993 22:25763251-25763273 GAGGGGGCGAGGATGGTGGAGGG - Exonic
1182069641 22:27454609-27454631 GAATGGGTGTGCATGGCAGGTGG - Intergenic
1182271985 22:29159775-29159797 GTGATGTTGAGGATGGCAGATGG + Intronic
1182541420 22:31044744-31044766 AAGTGTGTGAAAATGGCAGATGG + Intergenic
1182617257 22:31595737-31595759 GAGAGGGTGAGGATGGTGGCTGG + Intronic
1182960671 22:34471637-34471659 GAGTGGGGGGTGCTGGCAGAAGG + Intergenic
1183217268 22:36489168-36489190 GCATGGTTCAGGATGGCAGAGGG + Exonic
1183263048 22:36808392-36808414 GTGTGAGGCAGGATGGCAGAGGG + Intronic
1183580965 22:38726497-38726519 GAGTGGGTGAGCAGGGCATCTGG - Intronic
1183666548 22:39249428-39249450 GTGAGGGTGAGGCAGGCAGAGGG - Intergenic
1184045640 22:41970860-41970882 GAGAAGGTGAGGATGGGAAATGG - Intergenic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1184885889 22:47344200-47344222 GTGTGTGTGAGGCTGGGAGAGGG + Intergenic
1185118080 22:48949309-48949331 GAGAGGGTGAGGTTGGAGGAGGG - Intergenic
1185118099 22:48949379-48949401 GAGGGGGTGAGGCTGGAGGAAGG - Intergenic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950503704 3:13380160-13380182 AAGCTGGTGAGGATGGCAGCAGG - Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951345042 3:21537704-21537726 GAGTGAGTGAGGTGGGCAGTGGG + Intronic
951623165 3:24628970-24628992 GAGTGGTTGGGGAAGGCTGAGGG - Intergenic
951873217 3:27390276-27390298 GGGTGGGGGAGGGTGGCAGGTGG + Intronic
952136342 3:30426353-30426375 GAATGGGGGTGGATGGAAGAAGG + Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952877597 3:37959962-37959984 GAGAGGCCGAGGAGGGCAGATGG + Intronic
952878770 3:37969969-37969991 GAGCAGGTGAGAATGGCAGGAGG - Intronic
953224100 3:41000522-41000544 GAGTGGGTGAGCAGGATAGACGG + Intergenic
954787329 3:53103617-53103639 GGGTGAGGGAGGAAGGCAGAGGG - Intronic
955955121 3:64280845-64280867 GAGAGGTTGAGGATGGCATTTGG - Intronic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
958182869 3:90083186-90083208 GAGTGGGTGGGGGTGTCACAAGG - Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960633334 3:119755480-119755502 GAGAGAGGGAGAATGGCAGAGGG - Intronic
960961690 3:123075313-123075335 GAGTGGGTGAAGTTGGCTGGGGG + Intronic
961150848 3:124636626-124636648 GAGCGGGAGAGGAAGACAGAGGG + Intronic
961392148 3:126558511-126558533 GACAGGGTCATGATGGCAGAGGG - Intronic
961428138 3:126862801-126862823 GAGTTGGTGATGGTGGTAGAGGG - Intronic
961428178 3:126862939-126862961 GAGTTGGTGATGGTGGTAGAGGG - Intronic
961441862 3:126958144-126958166 GGGTGGGGGAGGAAGGCAGTAGG - Intronic
962069352 3:132017283-132017305 GAGTGAGAGAAGATGGGAGAAGG + Intronic
962490637 3:135890756-135890778 GGGTGGGTGTGGATGGTAGTGGG - Intergenic
962613391 3:137100698-137100720 GAGAGGGTGGGGGTGGGAGAGGG + Intergenic
963417782 3:145020545-145020567 GGGTGGAGGAGGATGGCACAGGG - Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967592350 3:191293690-191293712 TAGTGGATGAGCATGGCAGCAGG + Intronic
967788117 3:193519356-193519378 GAGTTGGAGAGGAAGGCAGGTGG - Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968925673 4:3546209-3546231 GAGAGGCTGAGGCGGGCAGATGG + Intergenic
969220061 4:5753463-5753485 GAGTGGGTGAGGGTGGGCCATGG + Intronic
969226956 4:5804957-5804979 CAGCGGGTGAGGAAGGCCGATGG - Intronic
969240587 4:5894456-5894478 GACTGGGTGGGGACTGCAGAGGG + Intergenic
969318283 4:6395198-6395220 GAGAGGGTGAGCCAGGCAGATGG - Intronic
969607860 4:8211359-8211381 GAGGGGGAGAGGAAGGAAGAGGG - Intronic
969607871 4:8211392-8211414 GAGGGGGAGAGGAAGGAAGAGGG - Intronic
970681840 4:18517730-18517752 GAGTGGGTGAGAAAGCCACAGGG + Intergenic
971344933 4:25803115-25803137 GAGAGTGTGAGGATGGGACATGG - Intronic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
972466879 4:39366133-39366155 GGGTGGGGGAGGATGGCGGTGGG - Intronic
973041280 4:45472682-45472704 GAGTGAGTGAGTATGGCATCTGG - Intergenic
973683640 4:53347244-53347266 GAGAGGGTGAAGCTGGAAGAGGG - Intronic
975123041 4:70749893-70749915 GGGAGGCTGAGGCTGGCAGATGG - Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975658251 4:76662909-76662931 GAGAGGGAGAGGAAGGGAGAGGG + Intronic
976190647 4:82483573-82483595 GAGTGAGAGAGCATGGAAGATGG - Exonic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
978354431 4:107856572-107856594 GAGTGAGTGGGGATGGTAGGTGG + Intronic
978403938 4:108360434-108360456 GAGATGGTGATGATGGCAGTGGG + Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
980531452 4:134060937-134060959 GAGTGAGGGAGGATGTCAGATGG + Intergenic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982001592 4:151025812-151025834 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
982148675 4:152427427-152427449 GAGTTCATGAGGATGGCATATGG - Intronic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983850153 4:172570278-172570300 GAGAGGTGGAGGATGGGAGAAGG + Intronic
984494301 4:180475268-180475290 GTGTGGGTGAGGGTGGGTGAAGG + Intergenic
985272420 4:188206817-188206839 GAGTGAGTGTGGATGGGTGAGGG + Intergenic
985344833 4:188993155-188993177 GAGTGGGTGAGGATGGGGAGAGG - Intergenic
985500828 5:243953-243975 CAGTGAGTGAGGGTGCCAGATGG + Intronic
985658097 5:1142406-1142428 GAGAGAGTGAGGAGGGGAGAGGG - Intergenic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
986680505 5:10228867-10228889 GAGAGGCTGAGGTGGGCAGATGG - Intronic
986766555 5:10933285-10933307 GCGAGTGTGAGGATGCCAGATGG + Intergenic
986891698 5:12317001-12317023 GAGTGGTTGAGGCAGACAGAAGG - Intergenic
987069168 5:14319801-14319823 GAATGGGGAAGGATGACAGAGGG + Intronic
987258537 5:16180409-16180431 GAGCGGGTGAGGAGGACACAGGG - Intronic
987292030 5:16518366-16518388 GAGGGGGAGAGGATGGGTGAAGG + Intronic
987621539 5:20342640-20342662 GAGTGTGGGATAATGGCAGAAGG + Intronic
987797006 5:22640978-22641000 AAGTGGGGGAAGTTGGCAGAAGG - Intronic
987954397 5:24719287-24719309 GAGTGGGTGAGGTTGGGAAGGGG - Intergenic
988469801 5:31527331-31527353 GAGAGGTGGAGGATTGCAGAGGG - Intronic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
992069791 5:73137927-73137949 AAATGGGCGAGGATGGGAGAGGG - Intergenic
992074163 5:73175705-73175727 GGGTGGGTGAAAATGGCAGGGGG - Intergenic
993064129 5:83077389-83077411 GAGAGGGCGAGAAGGGCAGACGG - Exonic
994134584 5:96270706-96270728 GAGGGGGTGAGGTTGGGGGAAGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994303400 5:98173809-98173831 GAGTGTGTGAGGAAGGAAGGAGG - Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995706880 5:114995972-114995994 GAGTGGTTGGCGATGGAAGAAGG + Intergenic
995882749 5:116861068-116861090 AAGTGGGTGAGAATGGGAAAGGG + Intergenic
998032402 5:138882349-138882371 GGGTGGGTCAGCATGGAAGATGG + Intronic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998383757 5:141744085-141744107 GAGGGAGTGGGGATGTCAGAGGG - Intergenic
998531628 5:142890426-142890448 CAGTGGGTTAGGATGGGAGGAGG + Intronic
998536914 5:142941450-142941472 GGGTGGGTGAGCATGGGAGACGG - Intronic
999185363 5:149703385-149703407 GGCTGGGTGATGATAGCAGAGGG - Intergenic
999728699 5:154459095-154459117 GGGAGGGAGAGGATGGAAGAAGG + Exonic
999869172 5:155731339-155731361 GAATGGGTGGGGAAGTCAGATGG + Intergenic
1000129244 5:158279273-158279295 GAGATGCTGAGGATGGAAGAAGG + Intergenic
1001293724 5:170484495-170484517 GAGGGAGAGAGGATGCCAGAGGG - Intronic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001827801 5:174760081-174760103 TATTGGGTGATGGTGGCAGAGGG + Intergenic
1001886855 5:175300081-175300103 GAGTGGGTGAGTATAGGATATGG - Intergenic
1002026868 5:176401654-176401676 GAGTGAGTGACGATTGCAGGAGG - Intronic
1002089818 5:176797906-176797928 GAGTGGGTCAGGGTGACAGCAGG - Intergenic
1002668653 5:180846782-180846804 GGGTGGGAGAGGATGGCAGCAGG - Intergenic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1003215813 6:4110121-4110143 GAGTGGGTTAGTATGTCAGAAGG + Intronic
1003685722 6:8300063-8300085 CTGTGGGGGAGTATGGCAGAGGG - Intergenic
1004119053 6:12801548-12801570 GACGGGGTATGGATGGCAGAAGG + Intronic
1004556033 6:16699405-16699427 GAGTAGGTGAGGATGGGAAAAGG + Intronic
1005190095 6:23211254-23211276 GGGTGGGTGAGTTTTGCAGATGG - Intergenic
1006034185 6:31198806-31198828 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1006112939 6:31759759-31759781 GAGTGGGTGAGGAAGGGAGCTGG - Intronic
1006379066 6:33687383-33687405 GACTGGGGGATGATGGCAGCTGG - Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006442204 6:34059685-34059707 GAGTGGGTGATGGAGGGAGATGG + Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006982843 6:38159482-38159504 GAGTGAGTGAGGTTGGGTGAGGG + Intergenic
1007091580 6:39188005-39188027 GAGGGAGTGATGTTGGCAGAGGG + Intergenic
1007248300 6:40478124-40478146 GAGAGGAAGAGGATGGCAGCAGG - Intronic
1007345119 6:41223318-41223340 GAGGGAGTGAGGAAGGCAGTGGG - Intergenic
1007922540 6:45623863-45623885 GAATGAGTGAGGATGGAGGATGG - Intronic
1011112972 6:83859127-83859149 GAGTGGGTGAATAGAGCAGAAGG + Intergenic
1011746126 6:90409545-90409567 AACTAGGTGAAGATGGCAGAGGG + Intergenic
1011755468 6:90494338-90494360 GAGAGTGTGAGGTGGGCAGAGGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013340307 6:109207689-109207711 GAGAGGGTGAGGGTGGGATAGGG - Intergenic
1014804837 6:125817979-125818001 GAGGAGGTGAGGAAGGGAGACGG - Intronic
1015364460 6:132381910-132381932 GAGTGGGTGAGGATGTCATTTGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018989561 6:168663144-168663166 GAGTGGGTGAAGATAGGAAAGGG + Intronic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019860270 7:3652316-3652338 GAGAGAGTGAGGATGCCAGGGGG + Intronic
1019982246 7:4630155-4630177 GAGTGGGTGGGCAAGGCTGATGG - Intergenic
1020402859 7:7797596-7797618 TACTGGGTGAGGATGGTTGAGGG - Intronic
1021614238 7:22486526-22486548 GAGTGGGTGAGGCCTGGAGAAGG - Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021955266 7:25818124-25818146 GAGTGGGCCAGGATTGCTGAGGG - Intergenic
1022057327 7:26751889-26751911 GGGAGGGGGAGGATGGAAGATGG + Intronic
1022211602 7:28215652-28215674 GGGAGGCTGAGGAAGGCAGATGG + Intergenic
1022350276 7:29561537-29561559 GAGTGGGTGAGCATTTCAGATGG - Intergenic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1023931844 7:44711053-44711075 GGGTGGGTGAGGGTGAAAGAGGG + Intergenic
1023965650 7:44962002-44962024 GAGGGGCTGAGGGAGGCAGAGGG + Intergenic
1023966288 7:44964728-44964750 GGGTGGGTGTGGATGACAGGAGG - Intronic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1026849001 7:73713308-73713330 GAGGAGGTGAGGGTGGCAGTGGG - Intronic
1026871307 7:73853841-73853863 GAGTGGATGAGGATGGGGCAGGG + Intergenic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028150718 7:87368266-87368288 GAAAGGGTGAGGGTGGCAGAAGG - Intronic
1029548115 7:101222058-101222080 GAGGGGTTGAAGATGGGAGAGGG + Intronic
1030243742 7:107359326-107359348 GAGTGGGCCAAGGTGGCAGAGGG - Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030689440 7:112517455-112517477 ATGCTGGTGAGGATGGCAGAGGG - Intergenic
1032425634 7:131820207-131820229 GAGTGGGAGGGGCAGGCAGAGGG - Intergenic
1032509226 7:132458846-132458868 GAGTGGATGGGCTTGGCAGAGGG - Intronic
1032839583 7:135703498-135703520 GAGAGGGAGAGGGTGGCGGAGGG + Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033555652 7:142486766-142486788 GATGGGTTTAGGATGGCAGAGGG - Intergenic
1034117480 7:148596807-148596829 GAGTGGGGGAGGAAGGGAGTGGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1035159437 7:156940508-156940530 GCGTGGGTGAGGGTGAGAGAGGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036546189 8:9771798-9771820 AAGTGGGGGAGGAAGGGAGAAGG + Intronic
1036597071 8:10223605-10223627 GATTGGGAGAGAATGGCAGGTGG + Intronic
1036915679 8:12801378-12801400 GGGTGAGAGAGGATAGCAGAAGG + Intergenic
1036989939 8:13580894-13580916 GAGGGGGTGAGGATGGGTGAGGG + Intergenic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037825631 8:22159028-22159050 GAGAGGCTGAGGATTTCAGAGGG + Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1038259375 8:25979708-25979730 GAGTGGCTAAGGACGTCAGAAGG - Intronic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1039059319 8:33560963-33560985 AAATGGCTGAGGATGGCAGAAGG + Intronic
1040101916 8:43513243-43513265 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1040315158 8:46257101-46257123 GAGTCATTGAGGATGGCAGAGGG + Intergenic
1040315845 8:46260523-46260545 GAGACGTTGAGGAAGGCAGAGGG + Intergenic
1040331572 8:46388325-46388347 GAAAGGTTGAGGCTGGCAGAGGG + Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041726070 8:61018469-61018491 GATGGGTTGGGGATGGCAGAGGG + Intergenic
1042021848 8:64377649-64377671 GAGGGGGTGAGGCTGGGAAAGGG + Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042949597 8:74187206-74187228 GAGGGGGTGAAGGTGGCAGATGG - Intergenic
1043417240 8:80063897-80063919 GAATGGGGGGGAATGGCAGAGGG + Intronic
1043914015 8:85899096-85899118 GTGGGAGTAAGGATGGCAGATGG - Intergenic
1044151651 8:88784538-88784560 GAGTGGGAGAGGGTGGATGATGG + Intergenic
1044866454 8:96575603-96575625 GGGTTGGTGAGGATGGCAGTAGG + Intronic
1045976296 8:108133535-108133557 GGGAGGGAGAGGATGGTAGATGG + Intergenic
1046022191 8:108678877-108678899 GAGGGGGGGAGGATGGCATTAGG - Intronic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047060188 8:121216658-121216680 GAGAGAGAGAGGAGGGCAGAGGG + Intergenic
1047103327 8:121705361-121705383 GATTGGGTGAGGATAGGATATGG + Intergenic
1047154563 8:122302480-122302502 GTGTGGGTAAGGATTGCAAAAGG - Intergenic
1047505941 8:125480306-125480328 TAGGGGGTGAGGATGGGAGTTGG - Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048278849 8:133089802-133089824 GAGTGGGCAGGGATGGCAGTGGG - Intronic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1049222371 8:141433935-141433957 GGGTGGGGGAGGATGGCTGGAGG + Intergenic
1049279859 8:141738681-141738703 GAGTGGGTGTTTATGGCTGAAGG + Intergenic
1049334488 8:142075790-142075812 GAGTGGGGGAGGGTGGCACAAGG + Intergenic
1049522199 8:143098406-143098428 GAGAGTGTGGGGTTGGCAGAGGG + Intergenic
1049581496 8:143413223-143413245 GGGTGGTGGAGGGTGGCAGAGGG - Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1051335743 9:16064404-16064426 GAGAGGGTGAGGGAGGCTGAGGG + Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052454516 9:28678228-28678250 GAGTGGGAGAGCAGGCCAGAAGG - Intergenic
1052854897 9:33401148-33401170 GAGAGGCTGAGGATGGAACAGGG + Intronic
1052877181 9:33575814-33575836 GAGTGGGTGAGGCTGGTGGCTGG - Intergenic
1053395292 9:37768190-37768212 GAGTGTGTGAGGATGAATGATGG + Exonic
1053498820 9:38568580-38568602 GAGTGGGTGAGGTTGGTGGCCGG + Intronic
1053662371 9:40292725-40292747 GAGTGGGTGAGGTTGGTGGCTGG - Intronic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054374500 9:64438954-64438976 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1054522239 9:66083559-66083581 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1054758196 9:68980173-68980195 GAGTGGGTGAGGATACTACAGGG - Intronic
1055576148 9:77661824-77661846 GGTTGGGTGAAGAGGGCAGAGGG - Intergenic
1057022166 9:91707737-91707759 GCCTGAGTGAGGATGTCAGAGGG + Intronic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1058161040 9:101571050-101571072 AAGTGGGTGGGGATGGCTAAGGG + Exonic
1058264998 9:102888313-102888335 GAATGGGTTCGAATGGCAGAGGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060753840 9:126194561-126194583 GAGGGAGTGAGGAAGGGAGAGGG - Intergenic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1060890010 9:127182096-127182118 GAGAGGCTGAGGCAGGCAGATGG + Intronic
1060944207 9:127560390-127560412 GAGTGAGTGTGGATGGGAGGAGG - Intronic
1061164112 9:128912507-128912529 GGGGGGGTGTGGATGGCAGGGGG + Intronic
1061836907 9:133335603-133335625 GGGAGGAGGAGGATGGCAGAGGG - Intronic
1062549598 9:137079889-137079911 GGGTGGGACAGGATGGCAGAAGG - Intronic
1185603615 X:1355019-1355041 GAGGGGGAGAGGATGGAGGAAGG + Intronic
1186510501 X:10126505-10126527 GAGAAAGGGAGGATGGCAGAGGG - Intronic
1186660040 X:11660319-11660341 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1186824001 X:13319783-13319805 GAGAGGATGAGAATGGCAGAAGG - Exonic
1187073937 X:15915371-15915393 GAGAGGCTGAGGTGGGCAGATGG - Intergenic
1187270845 X:17777943-17777965 GAATGGGAGAGGATTGCACAAGG - Intergenic
1188225477 X:27592243-27592265 GGCTGTGTGAGGATGCCAGATGG - Intronic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1189100460 X:38183635-38183657 AAGTTGGGGAGGATGGGAGAAGG + Intronic
1190399180 X:50014588-50014610 GAGAGGGGGAGCAGGGCAGAAGG - Intronic
1190933064 X:54966731-54966753 GAGAGAGTGAGGATGAGAGAGGG - Intronic
1191716656 X:64198355-64198377 GGGTGGCTGAGGAGGGCAAATGG - Intronic
1192079886 X:68037630-68037652 GGGAGGCTGAGGAAGGCAGATGG + Intergenic
1194872614 X:99151903-99151925 AAGGGGGTGTGGATGGCAGGGGG + Intergenic
1196237564 X:113300022-113300044 GAGGGGGAGAGGAAGGGAGAAGG - Intergenic
1197292043 X:124670463-124670485 GAGTGGCTGAGGAGAGTAGAGGG - Intronic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200102323 X:153694306-153694328 CAGTCAGGGAGGATGGCAGACGG - Intronic
1200181765 X:154155212-154155234 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200187414 X:154192326-154192348 GAGTGGGTCAGGGGGGCAAATGG - Intergenic
1200193063 X:154229466-154229488 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200198818 X:154267270-154267292 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200685428 Y:6254495-6254517 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200687814 Y:6273104-6273126 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200827515 Y:7659500-7659522 GCATGAGTGAGGATGGCAGAGGG - Intergenic
1200830225 Y:7681509-7681531 GAGTGAATGAGGATGGCAGAGGG - Intergenic
1200909071 Y:8515092-8515114 ACATGAGTGAGGATGGCAGAGGG + Intergenic
1200954211 Y:8928756-8928778 GCATGAGTGAGGATGGCAGAGGG + Intergenic
1200958029 Y:8971081-8971103 GCATGAGTGAGGATGGCAGAGGG + Intergenic
1200986267 Y:9305500-9305522 GCATGAGTGAGGATGGCAGAGGG - Intergenic
1200990957 Y:9345736-9345758 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200993616 Y:9366029-9366051 GGGTGAATGAGGATGGCGGAGGG + Intronic
1200996278 Y:9386347-9386369 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200998793 Y:9454902-9454924 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201001448 Y:9475211-9475233 GGGTGAATGAGGATGGCGGAGGG + Intronic
1201004113 Y:9495513-9495535 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201006769 Y:9515825-9515847 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201009421 Y:9536131-9536153 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201012017 Y:9556828-9556850 GGCTGAATGAGGATGGCAGAGGG + Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201047455 Y:9901598-9901620 GGGTGAATGAGGATGGCGGAGGG - Intergenic
1201060397 Y:10038850-10038872 GTGTGAATGATGATGGCAGAGGG - Intergenic
1201062510 Y:10059723-10059745 GGGTGAATGAAGATGGCAGAGGG - Intergenic
1201146581 Y:11068012-11068034 GAGAGGGAGAGGAAGGGAGAGGG + Intergenic
1202107284 Y:21384525-21384547 GCATGAGTGAGGGTGGCAGAGGG - Intronic
1202110265 Y:21409885-21409907 GTGTGAGTGACGATGGCAGAGGG - Intergenic
1202111704 Y:21427730-21427752 GGGTGAATGAGGATGGCAGAAGG - Intergenic
1202116753 Y:21476407-21476429 GAGTGAATGAGCATGGCAGAGGG + Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202124310 Y:21555402-21555424 GCATGAATGAGGATGGCAGAGGG + Intergenic
1202154698 Y:21873978-21874000 GCATGAATGAGGATGGCAGAGGG - Intergenic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic
1202186171 Y:22186492-22186514 GTGTGAGTGATGATGGCGGAGGG - Intergenic
1202195677 Y:22296709-22296731 GCATGAGTGAGGGTGGCAGAGGG - Intergenic
1202205188 Y:22399904-22399926 GTGTGAGTGATGATGGCGGAGGG + Intronic
1202232341 Y:22670141-22670163 ACATGAGTGAGGATGGCAGAGGG + Intergenic
1202310815 Y:23526017-23526039 ACATGAGTGAGGATGGCAGAGGG - Intergenic
1202559987 Y:26144577-26144599 ACATGAGTGAGGATGGCAGAGGG + Intergenic