ID: 950968243

View in Genome Browser
Species Human (GRCh38)
Location 3:17161441-17161463
Sequence AGGGGCTCACAAGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950968243_950968250 5 Left 950968243 3:17161441-17161463 CCAGCAGCATCTTGTGAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 950968250 3:17161469-17161491 GCCAAATGCTGGCTTCCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 211
950968243_950968244 -6 Left 950968243 3:17161441-17161463 CCAGCAGCATCTTGTGAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 950968244 3:17161458-17161480 GCCCCTCTGAAGCCAAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
950968243_950968249 4 Left 950968243 3:17161441-17161463 CCAGCAGCATCTTGTGAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 950968249 3:17161468-17161490 AGCCAAATGCTGGCTTCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 183
950968243_950968252 6 Left 950968243 3:17161441-17161463 CCAGCAGCATCTTGTGAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 950968252 3:17161470-17161492 CCAAATGCTGGCTTCCCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 204
950968243_950968248 3 Left 950968243 3:17161441-17161463 CCAGCAGCATCTTGTGAGCCCCT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 950968248 3:17161467-17161489 AAGCCAAATGCTGGCTTCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950968243 Original CRISPR AGGGGCTCACAAGATGCTGC TGG (reversed) Intronic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
901836107 1:11925394-11925416 AGTGGCTCCCAAGACGCAGCTGG - Exonic
904353627 1:29924613-29924635 AGGGGCTCAGTAAATGCTGAGGG - Intergenic
904397258 1:30230208-30230230 AGGCGCTCCCAAGATGGTGGTGG - Intergenic
905229941 1:36508692-36508714 ACAGGCTACCAAGATGCTGCAGG - Intergenic
906927845 1:50138239-50138261 AGGTGCTCCAAAAATGCTGCAGG + Intronic
917403658 1:174680334-174680356 AGGGGCAAACAAGATCCTTCCGG - Intronic
917591327 1:176480073-176480095 TGGTGCTCACCAGCTGCTGCTGG + Intronic
917614131 1:176720840-176720862 AGGAGCCCCCAAGAAGCTGCTGG + Intronic
918069439 1:181124210-181124232 AGGGGCTCAGACCAGGCTGCAGG + Intergenic
918477248 1:184938039-184938061 AGAAGCTCACAAGATGAGGCTGG + Intronic
920795539 1:209132953-209132975 AGGGGCTCGGAGGCTGCTGCGGG - Intergenic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
921569823 1:216764829-216764851 AGGGGAACAACAGATGCTGCAGG + Intronic
922478186 1:225921350-225921372 GGGAGCTGCCAAGATGCTGCTGG - Exonic
924727620 1:246684897-246684919 CGGGGGTCACAAGGTGCTGGTGG - Intergenic
1064118408 10:12598394-12598416 AGGGGCTCTCAAGATACATCAGG + Intronic
1064744294 10:18463745-18463767 AGGGGATGACTAGATGCTGCAGG - Intronic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1067213875 10:44284453-44284475 AGGGGCACAGAAGATGATGCTGG - Intergenic
1067289815 10:44932534-44932556 AGGGCCTCACGAGATCCTGCAGG - Intronic
1067544323 10:47181802-47181824 AGTGGCTCATGAGCTGCTGCAGG + Intergenic
1067719309 10:48715141-48715163 CAGGGCTGACAAGATGGTGCTGG - Intronic
1067831044 10:49611139-49611161 AGGGGTTCACTAGCAGCTGCAGG - Exonic
1070716710 10:78727651-78727673 AGGGGCTCCCATGATGTTGATGG + Intergenic
1075650174 10:124122740-124122762 AGGACCTCACAAGAGTCTGCTGG + Intergenic
1076040708 10:127245747-127245769 AGGGGGTCTCAAAATGCTGAGGG - Intronic
1076853986 10:133106320-133106342 GGGGCCTCACCGGATGCTGCTGG - Intronic
1083544613 11:63538955-63538977 AGGAGCTCACAGCATCCTGCTGG - Intronic
1083612251 11:64009878-64009900 TGGGGCTCAGAAGATGGGGCTGG - Intronic
1083718868 11:64594125-64594147 AGGGGCTCAGAAGATGGGCCTGG - Intronic
1086862817 11:91944798-91944820 AGGTGCTCAGAAAATACTGCTGG + Intergenic
1088783661 11:113161421-113161443 AGGTGTTCATAAGAGGCTGCTGG + Intronic
1089694255 11:120206989-120207011 AGGTGCTGACAAGACCCTGCAGG - Intergenic
1092065275 12:5584985-5585007 AAGGGCTCAGAATATGCTGTGGG + Intronic
1094012670 12:25825675-25825697 AGGGTTTCACAGGATGTTGCTGG - Intergenic
1096528578 12:52229384-52229406 AGGGGCCCACAAACTCCTGCAGG + Intergenic
1097556379 12:61143947-61143969 AGGGGCTCACATGATGATGAAGG - Intergenic
1097689536 12:62721521-62721543 AGGGGCTCTGAAAATTCTGCTGG + Intronic
1098611994 12:72470160-72470182 AGGGGCTCCAAAGAGGCTGCTGG - Intronic
1100901655 12:99248196-99248218 ATTGGCTCAGAAGATGCTACAGG + Intronic
1101490276 12:105203667-105203689 AGGGGCACACAAGACCCGGCCGG + Intronic
1101787993 12:107903011-107903033 AGGGCTACACAAGATGCTGGAGG - Intergenic
1103605937 12:122086176-122086198 TGGGTCTCACAAGATTCAGCAGG - Intronic
1104037187 12:125105607-125105629 AGTGGCTAACATGATTCTGCTGG - Intronic
1104904970 12:132208263-132208285 AGGGGCTCTCAAGAGGCAGGAGG + Intronic
1106378314 13:29211413-29211435 AGGCGCACAGAAGCTGCTGCAGG - Intronic
1106392308 13:29346628-29346650 AGGCGCACAGAAGCTGCTGCAGG - Intronic
1108599415 13:51978971-51978993 AGGGGCTCAGATGAGGCTGTTGG + Intronic
1110065135 13:71095079-71095101 AGGAGCAGACAAGATGGTGCTGG - Intergenic
1111390584 13:87589666-87589688 AAGCTCTCACAAGATGCTGAGGG + Intergenic
1111530185 13:89526491-89526513 AGGAGCTGACAACATGGTGCTGG - Intergenic
1112621451 13:101058026-101058048 TGGGGCTCAGGAGCTGCTGCTGG + Exonic
1113055076 13:106259335-106259357 AGGGGCTCGGATGCTGCTGCGGG - Intergenic
1115464351 14:33698486-33698508 AGATGCTCACAGGATGCTACAGG + Intronic
1116246574 14:42421681-42421703 ATGGGCTCACAAGATTCTGAAGG - Intergenic
1116276396 14:42839078-42839100 AGGGGTGCACAAGACGCTGGAGG + Intergenic
1117013355 14:51493044-51493066 TGAGACTCAGAAGATGCTGCTGG + Intronic
1123830725 15:24133802-24133824 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1123835809 15:24191170-24191192 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1123845352 15:24295104-24295126 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1123850975 15:24356567-24356589 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1123860777 15:24464371-24464393 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1123864396 15:24502989-24503011 AGGAGCTGACAAGAAGCTGAAGG + Intergenic
1124102549 15:26709427-26709449 AGGCCTTCACAAGATGCTGATGG + Intronic
1124961514 15:34400176-34400198 AGGGGCACACAGGGTGCTACAGG + Intronic
1124978140 15:34546399-34546421 AGGGGCACACAGGGTGCTACAGG + Intronic
1126052104 15:44695423-44695445 AGGGGCAGACAAGATGGCGCTGG + Intronic
1126938358 15:53737187-53737209 AGGGAAACACAAGATGCTACTGG + Intronic
1129392234 15:75226232-75226254 CTGGGCTCAGAAGGTGCTGCGGG + Intergenic
1130238292 15:82160250-82160272 ATGGGCTCACAAGTTGGTGCTGG - Intronic
1131560604 15:93436375-93436397 AGAGGCTCACAAAATGCTGATGG + Intergenic
1131774369 15:95778390-95778412 AGGTCCTCACCAGATGCTGCAGG - Intergenic
1132599273 16:766798-766820 GGGGACTCACCAGATGCTGCTGG - Exonic
1133207851 16:4244519-4244541 AGGAGCAGACAAGATGGTGCTGG + Intergenic
1134531741 16:14989317-14989339 AGTGGCTCCCAAGACGCAGCTGG - Intronic
1134937187 16:18256085-18256107 AGGGTCTCCCATGAGGCTGCAGG + Intergenic
1136067496 16:27768764-27768786 AGGGGCTCCCAAAATGCTGAAGG + Intronic
1138338438 16:56270847-56270869 AGGGGCTCAAATGATGTTTCTGG + Intronic
1139791009 16:69435356-69435378 TGGTACTCAAAAGATGCTGCAGG - Intronic
1140874585 16:79138814-79138836 AGGGACTCACCAGATGTGGCAGG + Intronic
1141344357 16:83231507-83231529 AGGTGCTCACCAGCTCCTGCTGG - Intronic
1141774985 16:86117173-86117195 AGGGGCTCCCATGATGCCCCAGG - Intergenic
1141889693 16:86918336-86918358 GGGCTCTCACAAGATGCTGCAGG - Intergenic
1143023311 17:3927710-3927732 AGGGGCTCACTCGAGGGTGCAGG - Intronic
1143521151 17:7445136-7445158 AGGGGCTCTGCTGATGCTGCTGG + Exonic
1147262976 17:39219515-39219537 AGGGGCTCACAATCTCCTGGGGG - Intronic
1147871567 17:43591359-43591381 AGGGGCAAACAAGATGGTGATGG - Intergenic
1148031365 17:44623435-44623457 AGGTGTTCAGAAGATGATGCAGG + Intergenic
1148125613 17:45235019-45235041 AGGGATTCACAAGATGCTCTAGG - Intronic
1149641546 17:58206099-58206121 AGGGGCTCACTAGGTCCTGCGGG + Exonic
1149910494 17:60561896-60561918 AGGGGCTGAGAGGATGCTCCAGG + Intergenic
1152224879 17:79088083-79088105 AGGTGAACACAAGCTGCTGCCGG + Intronic
1152644173 17:81461197-81461219 GGGAGCCCACAAGCTGCTGCGGG + Exonic
1152919500 17:83058914-83058936 CGGGGCTCACAGCAGGCTGCCGG + Intergenic
1156661202 18:39348742-39348764 AGGGGATCATATGCTGCTGCAGG + Intergenic
1157833373 18:50877957-50877979 AGGAACTTACAAGATGCAGCAGG - Intergenic
1159912740 18:74161870-74161892 AGGGGATTGCAAGATGTTGCTGG - Intergenic
1160083887 18:75756253-75756275 TGGGGCTGAGAAGATGCTCCAGG - Intergenic
1160514273 18:79469882-79469904 AGGGGCTCACAGTCTGGTGCAGG - Intronic
1161591256 19:5130133-5130155 AGGCCCTCACAAGATGAGGCGGG - Intronic
1162180581 19:8866053-8866075 AGGGTCTCACCAGGTGCTGAAGG + Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163144778 19:15373053-15373075 AGGGGCTCAGAGGACGCAGCGGG + Exonic
1163550257 19:17962542-17962564 AGGTGCTCAGTAGATGCTGATGG + Intronic
1163625303 19:18386142-18386164 TGGGACTGACCAGATGCTGCCGG - Exonic
1164433369 19:28207608-28207630 AGGGGCACACATGCTGCAGCAGG + Intergenic
1166137517 19:40786376-40786398 AGGGGGCCACAAGAAGCTGTGGG + Intronic
925032525 2:661731-661753 TGAGCCTCACAAGATGCTGCAGG - Intergenic
925521457 2:4750432-4750454 AGGAGCTCACAAGATCTTACTGG + Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
927680055 2:25133056-25133078 AGGGGGTCAGAAAATGCAGCTGG - Intronic
927699245 2:25257572-25257594 AGGGGCTCTCCAGAAGCTCCTGG + Intronic
928537086 2:32251371-32251393 AGGGGCTCTGAAGAGCCTGCAGG + Exonic
931687655 2:64808266-64808288 AGGAGCAGACAAGATGGTGCTGG + Intergenic
934714949 2:96537833-96537855 AGGGGGTCCCAAGGCGCTGCGGG + Intronic
936254607 2:110901100-110901122 AGGGGCTGACACTCTGCTGCTGG - Intronic
937332120 2:121038216-121038238 AGGGGCCCAGCAGGTGCTGCTGG + Intergenic
941248895 2:163136828-163136850 AGGAGCTCACAATATGGAGCAGG - Intergenic
943985316 2:194611120-194611142 AGGAGCAGACAAGATGGTGCTGG + Intergenic
946353638 2:219171538-219171560 AGGAGCTCACAAGGCTCTGCTGG + Intergenic
948080090 2:235198704-235198726 AGGGGCTCACAGGGCTCTGCAGG + Intergenic
1171019220 20:21569971-21569993 AGATGCTCACAAGATGATGAAGG - Intergenic
1172611546 20:36256259-36256281 AAGGGCTCCCAAGGAGCTGCAGG - Exonic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1172780062 20:37431321-37431343 AGGGGCTGATAAGATGGTGGGGG - Intergenic
1173914542 20:46697161-46697183 AGGGGCTCACAGGATGTATCTGG + Intergenic
1175515720 20:59568639-59568661 AGGGGCACACATGAGGGTGCAGG - Intergenic
1175928376 20:62481733-62481755 AGGAGCTGACAGGAGGCTGCGGG - Intergenic
1176235368 20:64051216-64051238 AGGGGCTCACAGGCCTCTGCCGG + Intronic
1177390244 21:20459786-20459808 GGTGGGTCACAAGATGCTTCAGG - Intergenic
1177886630 21:26754973-26754995 ATGGGCTTGCAACATGCTGCAGG + Intergenic
1179719440 21:43306910-43306932 AGGGGGTCTCAGGATACTGCTGG - Intergenic
1180041090 21:45280518-45280540 AGGGGCTCAAAGGCTGCTCCTGG - Intronic
1180179436 21:46111464-46111486 AGGTGCTGCCAAGATGCTCCAGG + Exonic
1180702907 22:17791386-17791408 AGGGCCGAGCAAGATGCTGCCGG + Intronic
1184685080 22:46092920-46092942 AGGTGCTCACACGAGGCAGCTGG - Intronic
949803273 3:7926807-7926829 AGGGGCTCAGTGGATGGTGCAGG - Intergenic
949871649 3:8594562-8594584 AGGGGCACACAGGGTGCTGTGGG - Intergenic
950171519 3:10842112-10842134 ACCGGCTCCCAAAATGCTGCAGG - Intronic
950968243 3:17161441-17161463 AGGGGCTCACAAGATGCTGCTGG - Intronic
951642278 3:24849389-24849411 AATGGCTCTCAAGAAGCTGCTGG + Intergenic
956640061 3:71406933-71406955 AGGGGCTCAACAGATGCTTATGG + Intronic
957851749 3:85817066-85817088 GGTGGCTCACAAGAGCCTGCAGG - Intronic
959922606 3:111885085-111885107 AGTGGCTCGGAAGATGCTTCTGG + Exonic
961656904 3:128447761-128447783 AGGGGCTGGCAAGCTGGTGCTGG + Intergenic
962987947 3:140552787-140552809 AGGTGCTCACAATCTGCTGGAGG + Intronic
963174982 3:142288874-142288896 AGGAGCAGACAAGATGGTGCTGG + Intergenic
965430021 3:168574764-168574786 AGGGGCTCATAAATTGCTGGAGG + Intergenic
967036918 3:185654964-185654986 AGGGGCACATTTGATGCTGCTGG - Intronic
967990021 3:195123776-195123798 AGGGGGGCACCAGATGCTACAGG + Intronic
971465191 4:26950601-26950623 AGGCACTCACCAGATGATGCTGG + Intronic
975525110 4:75340422-75340444 AGGGTCTCAGATGATGCTACTGG + Intergenic
985771715 5:1815938-1815960 AAATGCTCACAGGATGCTGCGGG - Exonic
991444916 5:66689270-66689292 AAGAGCTCACAAGATGTTTCAGG - Intronic
991611949 5:68458569-68458591 AGGGGCTCGGATGTTGCTGCTGG + Intergenic
992073907 5:73173711-73173733 AGGGGCTCACCACAGACTGCAGG - Exonic
992990070 5:82274729-82274751 AGGGGCTCAACAGATGCTTTCGG - Exonic
1000450265 5:161377263-161377285 AGGGTTTTACAAAATGCTGCTGG - Intronic
1000563867 5:162823846-162823868 AGAGGTTCAAAAGATGCTTCTGG - Intergenic
1001199069 5:169699488-169699510 AGGGGCTCCCAAGCTGGAGCAGG - Intronic
1001272742 5:170327830-170327852 AGGTGACCACAAGAGGCTGCTGG - Intergenic
1003128443 6:3374722-3374744 AGGAGCTGACAAGTTGCTGCTGG + Intronic
1003473567 6:6460840-6460862 AGGTGCTCAACAGATACTGCAGG + Intergenic
1004368745 6:15034061-15034083 AGGAGCAAACAAGATGGTGCCGG - Intergenic
1005719473 6:28587125-28587147 AGGGGCTCACAAGCTGCCTGGGG + Exonic
1005785037 6:29236302-29236324 AGGAGCAGACAAGATGGTGCTGG - Intergenic
1006716701 6:36124977-36124999 AGGGACTTACCAGAGGCTGCTGG + Intergenic
1006804256 6:36778159-36778181 AGGGTCACACAACAGGCTGCTGG + Intronic
1006806999 6:36794981-36795003 AGGGGTTCCCAAGCTGCAGCAGG - Intronic
1007260982 6:40562913-40562935 TGTGGCTCTCAAGAGGCTGCAGG + Intronic
1011888481 6:92127239-92127261 AGGAGCAGACAAGATGGTGCAGG + Intergenic
1012496148 6:99835605-99835627 AGGACCTCACCAGATGCTGGTGG + Intergenic
1012500179 6:99879689-99879711 AGGGGCCAACAGGCTGCTGCTGG + Intergenic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1018968515 6:168508107-168508129 TAGGGCACACAAGATGCTGTAGG - Intronic
1019232784 6:170582797-170582819 AGGGCTGCACAAGATGCTGGAGG - Intronic
1019427671 7:985038-985060 GGTGGCTGACAAGATTCTGCAGG + Exonic
1020001667 7:4759538-4759560 GGGGGCTCCCATGATGCGGCGGG + Exonic
1022205424 7:28159025-28159047 AGGAGCTCACAAGCTGATGAGGG + Intronic
1022852950 7:34283708-34283730 AGGAGCAGACAAGATGGTGCTGG + Intergenic
1023173479 7:37412855-37412877 TGTGGCTGACAAGCTGCTGCTGG - Intronic
1023836748 7:44073124-44073146 AGGGGCTCAACTGATCCTGCAGG + Exonic
1025733707 7:64128510-64128532 AGGGGCTCTCAAAATATTGCTGG - Intronic
1028252038 7:88547996-88548018 AGGAGCAGACAAGATGGTGCTGG - Intergenic
1029648009 7:101870102-101870124 ATGGCCTCACAAGCTGCAGCGGG - Intronic
1032463791 7:132130691-132130713 AGGGGCACACAGGACACTGCGGG + Intronic
1032463999 7:132132151-132132173 AGGGGCACACACGACACTGCTGG - Intronic
1035746681 8:1966206-1966228 AGGGGCTCTCAGGATGGTGTGGG + Intergenic
1035917561 8:3641692-3641714 AGGAGCTCAGAACAGGCTGCAGG + Intronic
1038017966 8:23530502-23530524 ATGGGCTTCCAAGGTGCTGCTGG + Intronic
1038613189 8:29071947-29071969 CGGGGCTCACGAGCTGCTGGGGG + Exonic
1039560841 8:38511200-38511222 AGGAAGTCCCAAGATGCTGCTGG - Exonic
1040068810 8:43172490-43172512 AGTGGCTCAGAGGAGGCTGCTGG - Intronic
1045792179 8:105996342-105996364 AGGAGCAGACAAGATGGTGCTGG - Intergenic
1047091872 8:121584004-121584026 AAGGACTCAAAAGATTCTGCCGG + Intergenic
1047238800 8:123066304-123066326 AGGAGCACACAACATGGTGCTGG - Intronic
1048067658 8:130986875-130986897 AGAGGTTCACAATTTGCTGCAGG + Intronic
1048925165 8:139264953-139264975 AGGGGCACAGAAGCTGGTGCAGG + Intergenic
1049211555 8:141388954-141388976 GGGGGCTCAAGAGCTGCTGCTGG + Intergenic
1049453085 8:142672944-142672966 AGGAGCAGACAAGATGGTGCTGG - Intronic
1049743388 8:144251798-144251820 AGGGGCACACAGGAGCCTGCTGG - Intronic
1050503503 9:6323343-6323365 AGGCCCTCACCAGATGCTGGTGG - Intergenic
1051329868 9:16012880-16012902 AGGAGTTCCCAAGATGCTGGTGG - Intronic
1052401834 9:28010759-28010781 AGGGTCTCACAATATTCTCCAGG - Intronic
1053117347 9:35517160-35517182 TGGGTCTCACCAGAGGCTGCAGG + Intronic
1057008366 9:91580913-91580935 TGGGGCTCAGACGATGCTCCTGG + Intronic
1057797697 9:98170336-98170358 AGGGGTTCAGAAGAAGCTGCTGG - Intronic
1057903496 9:98967135-98967157 AAGGGCTCACAGGCTGCTGAGGG + Intronic
1060262960 9:122092355-122092377 AGGGGCTTACAAGCTGGTGGAGG + Intronic
1061264878 9:129499111-129499133 AGGGGCTCAGATGCTGCTCCAGG - Intergenic
1061340089 9:129973205-129973227 AGGGGCTGACAGCATGCTTCAGG - Intronic
1061873754 9:133534050-133534072 AGGGGCTGCCAAGTTGGTGCTGG + Intronic
1062492836 9:136815655-136815677 ATGGGCCCAGGAGATGCTGCTGG + Intronic
1187224307 X:17361193-17361215 AGGAGGCCAGAAGATGCTGCAGG - Intergenic
1188491249 X:30740805-30740827 AGGAGCAGACAAGATGGTGCCGG + Intergenic
1190146114 X:47893106-47893128 AGGGGCTCTCAAGAGACTGAGGG - Intronic
1190290341 X:48988280-48988302 AGGTGCTGAGAACATGCTGCTGG - Intronic
1190895905 X:54617715-54617737 AGGGGCAAACAAGATCCTTCAGG - Intergenic
1193755972 X:85408903-85408925 TGGGGCAGACAAGGTGCTGCTGG - Intergenic
1196916061 X:120536182-120536204 AGAGGCACAAAAGCTGCTGCAGG - Intronic
1200179463 X:154141464-154141486 CGGGGCACACACCATGCTGCTGG + Intergenic