ID: 950969381

View in Genome Browser
Species Human (GRCh38)
Location 3:17170886-17170908
Sequence GAGACTGAATTGCCTTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950969381 Original CRISPR GAGACTGAATTGCCTTTAAC TGG Intronic
902038817 1:13477436-13477458 GACAAAGAATTGTCTTTAACAGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
908177679 1:61572023-61572045 GAGACTGCACTACCTTTCACTGG + Intergenic
908710648 1:67010571-67010593 GAGGCTGAATATCCTTTATCAGG + Intronic
917403248 1:174675693-174675715 AAGACTGCATTGCCATTACCTGG + Intronic
919349846 1:196435769-196435791 GAGACAGAATTGCCTGTAATAGG + Intronic
920242160 1:204561050-204561072 AATTCTGAATTGCCTTTGACAGG - Intergenic
920247498 1:204599600-204599622 GTGACTGAATTTCATTTCACTGG + Intergenic
921084985 1:211781900-211781922 GAGAATGATTTGCCTTTTCCTGG + Intronic
924092291 1:240513930-240513952 GAGACAGAAATGGCTTTAAGAGG + Intronic
924097695 1:240571277-240571299 AAGACTGAATGACCTTGAACAGG + Intronic
1063719159 10:8561223-8561245 GAGACAGAATTGCCTGTGATTGG - Intergenic
1064990342 10:21251354-21251376 GAGACTGAGATACCATTAACTGG - Intergenic
1065442369 10:25766034-25766056 GAGGCTGAATTGTCTCCAACTGG + Intergenic
1071167981 10:82829092-82829114 GAGTCTGAAATTCCATTAACAGG - Intronic
1075119878 10:119656987-119657009 CAGACAGACTTGCCTTTAGCGGG + Intronic
1081306399 11:41517089-41517111 TAGATTGAATTGCTTTTAAAAGG - Intergenic
1081380087 11:42404102-42404124 GAAACTGAATTTCTTTTAAGTGG - Intergenic
1082124835 11:48420262-48420284 GTGACTGAATTCGTTTTAACAGG + Intergenic
1082223978 11:49678817-49678839 GAGGCTGAATTGCTTTTAAAAGG + Intergenic
1082558493 11:54591498-54591520 GTGACTGAATTCATTTTAACAGG + Intergenic
1084553439 11:69862625-69862647 GAGACTGCATTTCCTTTGAGGGG + Intergenic
1085916277 11:80891894-80891916 CAGACAGAATTCCCTTTAATAGG - Intergenic
1086625062 11:88940336-88940358 GAGGCTGAATTGCTTTTAAAAGG - Intronic
1087663632 11:101016653-101016675 GAGACATATTTTCCTTTAACAGG + Intergenic
1093404973 12:18793250-18793272 ATTTCTGAATTGCCTTTAACAGG + Intergenic
1093701002 12:22220630-22220652 GACACTTAATTGCTTTTAATTGG - Intronic
1098298651 12:69030394-69030416 GAGCCTGAAATGCCTTTCATAGG - Intergenic
1101333380 12:103775255-103775277 GAGACTGAAATTCTTCTAACTGG + Exonic
1102103096 12:110296273-110296295 GAGACAGAATTGATTTTAAATGG + Intronic
1102134628 12:110563023-110563045 GAGACAGAATTGCCTGAACCTGG + Intronic
1102617487 12:114167188-114167210 GAGTCTGACTTCCCTTTAAAGGG - Intergenic
1105636117 13:22216752-22216774 GAGACTGTGTGACCTTTAACAGG + Intergenic
1110648278 13:77915186-77915208 GAGAATAAATGGCTTTTAACTGG + Intronic
1114973247 14:28060913-28060935 GAGATTGAAATACCTTTAACTGG - Intergenic
1116757177 14:48962623-48962645 GAGACTAGGTTGCCTTTAATTGG - Intergenic
1120517090 14:85483637-85483659 GAGACTGAATTGATTTTAGGTGG + Intergenic
1120537282 14:85712628-85712650 GAGGCTGAATTGCATTCAGCGGG - Intergenic
1125350686 15:38763935-38763957 GAGAATGAAGAGCCTTGAACAGG - Intergenic
1126119948 15:45242556-45242578 GAGACAGAATAGCGTTTAAAAGG + Intergenic
1126968969 15:54088329-54088351 AAGACTGACTTGCCTCAAACTGG - Intronic
1127571962 15:60252228-60252250 GACACTCAGTTGTCTTTAACAGG - Intergenic
1130173775 15:81546457-81546479 GAGACTGAAGTGCCTGGAAGAGG - Intergenic
1131487116 15:92830342-92830364 GAGACTGAGTTGGCTTTGGCAGG - Intergenic
1131570989 15:93535801-93535823 GAGCCTGAATTGCCACAAACCGG - Intergenic
1131744632 15:95433868-95433890 GACAATGCATTCCCTTTAACAGG - Intergenic
1133461742 16:5992446-5992468 AAGACTGAATTCCTTTTGACAGG + Intergenic
1136164896 16:28447048-28447070 GAGACTAAAATGCCTCTAGCTGG - Intergenic
1136198070 16:28667933-28667955 GAGACTAAAATGCCTCTAGCTGG + Intergenic
1136214416 16:28782109-28782131 GAGACTAAAATGCCTCTAGCTGG + Intergenic
1136259138 16:29061953-29061975 GAGACTAAAATGCCTCTAGCTGG + Intergenic
1140818026 16:78638551-78638573 GAGAGTCAATTGCAATTAACAGG - Intronic
1148759280 17:49991215-49991237 GAGCCTGGATTGGCTTTAAATGG - Exonic
1149960306 17:61101853-61101875 GGGACTGCAGTACCTTTAACTGG + Intronic
1156321441 18:36028693-36028715 GAGAATGAAATGAGTTTAACGGG + Intronic
1159465142 18:68771724-68771746 GTGACTGAGTTGCCTTGAATTGG + Intronic
1164622334 19:29704014-29704036 GAGACTGAATTTCCTCCACCAGG + Intronic
1165971878 19:39638563-39638585 GAGACTGAATCACCTCAAACTGG + Intergenic
925575906 2:5359683-5359705 GAGGCTGTATTGCATTTAAGTGG - Intergenic
926453452 2:13035940-13035962 TAGACTAAATTGGCTTTAACAGG + Intergenic
928985397 2:37176354-37176376 GAGACAGAATTGCTTGAAACCGG - Intronic
931592171 2:63896702-63896724 GAGCCTGAAATTCCTTTAACAGG + Intronic
931607385 2:64065855-64065877 GAGACTGTGTTACCTTTAATTGG + Intergenic
933656761 2:84894961-84894983 GAGACTGAGTTTCCTTTAATCGG - Intronic
936666165 2:114598255-114598277 GAGACTGAATTTCATTTGGCTGG + Intronic
937774256 2:125757082-125757104 AAGACTGAATTCCATTTAAGAGG + Intergenic
939657890 2:144850429-144850451 GAAACTTAAGTGCCTTTAATTGG + Intergenic
939880716 2:147628093-147628115 GAGAATGTATTGACTTTAAAAGG - Intergenic
939969020 2:148639758-148639780 GAGACTGAACTGCCTTCACAGGG + Intergenic
940360377 2:152790411-152790433 AAAACTGAATTACCTTTAAAAGG - Intergenic
941720411 2:168806625-168806647 CAGACTGAAATCCCTTTATCAGG + Intronic
943050190 2:182904320-182904342 GAGACAGAATTGCCTGAACCTGG + Intergenic
943622401 2:190164236-190164258 CTGACCGATTTGCCTTTAACAGG - Intronic
947374122 2:229478609-229478631 GAGAGTGAATTGTTTTTAAGAGG + Intronic
1170851492 20:20008831-20008853 GGGAATGAAATGCCTTTAAAAGG - Intergenic
1172924215 20:38516058-38516080 GAGACTGATTTGTATTTAATGGG - Intronic
1173934523 20:46849761-46849783 GAGACTGAGGTGCTTTTACCAGG + Intergenic
1177815939 21:25976808-25976830 GAGACTGAATCACCTCTTACAGG - Intronic
1178291956 21:31376267-31376289 GAGACTGAGATGCATTTATCAGG - Intronic
1181379037 22:22484823-22484845 GAGAGTAAAGTGCCTTTAAGAGG + Exonic
1181723000 22:24790424-24790446 GAGGAAGAATTGCCTTCAACTGG - Intergenic
1182251298 22:29003070-29003092 GAGACTGAATATCTTATAACAGG - Intronic
1182987414 22:34733397-34733419 GAAACTGAATTGACATTATCAGG - Intergenic
1184795602 22:46730885-46730907 TAGACTGAGTTGGCTTTCACTGG - Intronic
950928897 3:16769914-16769936 GTACCTGAATTCCCTTTAACTGG - Intergenic
950969381 3:17170886-17170908 GAGACTGAATTGCCTTTAACTGG + Intronic
951047809 3:18060935-18060957 GAGACTGAATAGTCTCCAACTGG + Intronic
952047914 3:29346376-29346398 AAGAATGAATTGCCTTTACTAGG - Intronic
953366358 3:42348702-42348724 GAGGCAGAATTACCTTTAATTGG + Intergenic
953580849 3:44154911-44154933 CTGGCTGAATTGCATTTAACTGG + Intergenic
955068662 3:55554249-55554271 TAGACTGAAATGGCTTTAAAAGG + Intronic
963819517 3:149872997-149873019 GACTCTCAATTGCCTTTAAATGG + Intronic
964576720 3:158178439-158178461 GAGACTAAAATAGCTTTAACTGG - Intronic
965869033 3:173244313-173244335 GAGACAGAATTGACTCTGACAGG + Intergenic
966811907 3:183854146-183854168 GAGACAGAATTGCCTGAACCTGG + Intronic
967248133 3:187509369-187509391 GAGACTTATTTTCCTTTCACAGG + Intergenic
968928348 4:3562099-3562121 GAGATTGATTTTCCTTTCACAGG + Intergenic
970374739 4:15445501-15445523 AAAACTGAATTTCCTTTAATTGG + Exonic
970389122 4:15589816-15589838 GACACTGCATTTCTTTTAACTGG - Intronic
973532836 4:51850553-51850575 GTGACTGAACAGCCTTCAACAGG - Intronic
973537549 4:51898547-51898569 GAGGAAGAATTGCCTTTAAATGG + Intronic
974006402 4:56561578-56561600 GAGACTGGATTAGTTTTAACAGG - Intronic
975822727 4:78288315-78288337 GTGACAGATTTGCCTTTAAAAGG + Intronic
976817155 4:89162011-89162033 GTGACTACATTGCCTTTAATTGG + Intergenic
977205921 4:94164967-94164989 CTCACTAAATTGCCTTTAACTGG + Intergenic
977809336 4:101341553-101341575 GTGACTGAATCGCCATTACCAGG + Intronic
978389758 4:108213221-108213243 GAGACAGAATTACCACTAACGGG - Intergenic
978506498 4:109463428-109463450 GAGAATGAATTATCTTTAACTGG - Exonic
980468558 4:133219063-133219085 AGGACTGAATTGCCTTCATCTGG + Intergenic
981720520 4:147797118-147797140 GGAACTGAATAGCCTGTAACTGG + Intronic
982360784 4:154516558-154516580 GAGACTGAACTGCCTTTTCAAGG + Intergenic
982555641 4:156860107-156860129 GAGACTGAACTGACTTTATGAGG + Intronic
983932256 4:173465372-173465394 GAAACTGAATGTCCATTAACAGG + Intergenic
988020964 5:25620644-25620666 GAGACTGAATGACTTTGAACTGG - Intergenic
990762433 5:59144861-59144883 GAGACCGTATTCCCTTTAATAGG + Intronic
994094452 5:95836159-95836181 GAGCCTGAATTTCCTGTCACTGG - Intergenic
994698428 5:103102382-103102404 GAAACTGAACTACCTTAAACTGG - Intronic
995394869 5:111676744-111676766 GAGAGGGAGTTGCCTTTAAGTGG - Intronic
996731341 5:126720522-126720544 GAGACTCAAATGCCCTTAAGGGG - Intergenic
998392350 5:141795452-141795474 GAGCCTGAATTGCAGGTAACAGG - Intergenic
999610275 5:153361904-153361926 GAGACTGAAAGGCATTTAAATGG + Intergenic
999916265 5:156265407-156265429 GAGGATCAATTGCATTTAACTGG - Intronic
1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG + Intronic
1002340684 5:178514994-178515016 GAGAGTGACTTGTCTTTCACTGG - Intronic
1005942762 6:30573078-30573100 GAGAATGAATGGCCTTGAACTGG + Intronic
1008370829 6:50728346-50728368 GTGACTGTTTTGCCTTTAATTGG + Intronic
1008914958 6:56777436-56777458 GACACTGCATTGCCTGTGACTGG - Intronic
1010261246 6:73819642-73819664 GAGACTGAATTAGTTTTAACAGG - Intronic
1010804092 6:80214333-80214355 TAGACTGAATAGCTTTAAACTGG + Intronic
1012681569 6:102189182-102189204 CTTACTGAATTGCCTTTAACTGG + Intergenic
1013430585 6:110051656-110051678 CAGACTGAATTACCTTTTCCTGG + Intergenic
1013832337 6:114289216-114289238 GTGACTGAATTGTCTTTAGTGGG - Intronic
1015186075 6:130417619-130417641 GATACTGGATAGCCTTTAAATGG - Intronic
1015219594 6:130789095-130789117 GGAACTGAATTTGCTTTAACAGG - Intergenic
1016439172 6:144065741-144065763 AAGAATGAAGTGCCTTGAACAGG - Intergenic
1020466442 7:8485114-8485136 GTGATTGAATTGCCTTGCACCGG - Intronic
1024203291 7:47127810-47127832 GAGACTGCAATGGTTTTAACTGG + Intergenic
1024840990 7:53587370-53587392 GAGACTGCAAGGCCTTTGACAGG - Intergenic
1026684877 7:72501051-72501073 GAGACAGAATTGTCTTTAGGAGG - Intergenic
1027990699 7:85357029-85357051 AAGACTGAATTGCCTTGCAGTGG - Intergenic
1028479059 7:91284713-91284735 GAGACTGAATTATTTCTAACAGG - Intergenic
1030005921 7:105119667-105119689 GAGACTGTGTTTCCTTCAACAGG - Intronic
1034187948 7:149193867-149193889 GACACTGACCTGCCTTTAAAGGG + Intergenic
1034816862 7:154179362-154179384 GAGACTGAAGGGTATTTAACGGG + Intronic
1036140594 8:6204611-6204633 GAGATGGACTTGCCTTAAACTGG + Intergenic
1036218630 8:6902000-6902022 GAGATTGATTTTCCTTTCACAGG + Intergenic
1045955530 8:107901388-107901410 GAGACTGATTTTCCTGTTACAGG + Intronic
1046536757 8:115524177-115524199 GGGACAGATTTGGCTTTAACTGG + Intronic
1051908930 9:22130300-22130322 GAGACAGAATTCTCTTTAAGTGG - Intergenic
1054461790 9:65469061-65469083 GAGATTGATTTTCCTTTCACAGG - Intergenic
1055762250 9:79621547-79621569 GGTAGTGAATTGCCTTTCACAGG + Intronic
1058728251 9:107824110-107824132 GAGACAGAGTTTCCCTTAACCGG - Intergenic
1186429680 X:9494204-9494226 GTGACTCAACTGCCTTGAACAGG + Intronic
1188407628 X:29831282-29831304 GGGACTTAATTGCCTTTTACTGG - Intronic
1188679306 X:32982046-32982068 GAGACTGTATTCCCTCTTACTGG + Intronic
1190369209 X:49725642-49725664 GAGACTGGATTGACTTTTGCGGG + Intergenic
1193365539 X:80627958-80627980 GAGACTGGATTGGTTTTTACAGG + Intergenic
1196253990 X:113494300-113494322 GAGTTTGGATTACCTTTAACTGG - Intergenic
1199154408 X:144529819-144529841 GAGATTTAATTTCCTTTCACAGG - Intergenic
1201494966 Y:14583113-14583135 GAGATTGAATTGGGTTTAATTGG + Intronic