ID: 950969916

View in Genome Browser
Species Human (GRCh38)
Location 3:17176039-17176061
Sequence GAGAACATGGAGAGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950969916 Original CRISPR GAGAACATGGAGAGGCAGCC TGG Intronic
900192965 1:1359142-1359164 TACAACCTGGAGAGTCAGCCAGG + Intronic
900369017 1:2323272-2323294 GAGAACAAGCAGAGCCACCCTGG - Intronic
900520738 1:3104420-3104442 GTGAACAGGCAGAGGCTGCCCGG + Intronic
901118268 1:6866937-6866959 GAGATCATGGAGAAGCACACGGG - Intronic
901275327 1:7986752-7986774 GTGAAGTTGGAGAGGTAGCCAGG + Intergenic
901727442 1:11253180-11253202 GAGAATATGGGGAGGAAGCTGGG - Intronic
902220847 1:14963821-14963843 GAGAACATGTAGACGCAGGGAGG - Intronic
902825060 1:18967472-18967494 GAGAACCTGGGGAGGCTTCCTGG + Intergenic
902877091 1:19347262-19347284 GAGATCATGAGGAGCCAGCCAGG + Intronic
902983482 1:20141652-20141674 GGGCAGATGGGGAGGCAGCCAGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
904239029 1:29132177-29132199 GAGAACAGGGTCAGGAAGCCTGG + Intergenic
904362342 1:29984579-29984601 GAGATGGTGGAGAGTCAGCCAGG - Intergenic
904831834 1:33310345-33310367 GAGACCAGGGAGAGGAAGACCGG + Intronic
906031036 1:42720279-42720301 GAGAAAATGGAGAGGCAGCTGGG - Intergenic
906258994 1:44372116-44372138 GAGAAAATGGAGACACGGCCGGG + Intergenic
907466306 1:54640090-54640112 GACAAGATGGACAGGCAGGCAGG + Intergenic
907921505 1:58918501-58918523 GACAACATGGACAATCAGCCTGG + Intergenic
908799464 1:67864503-67864525 TAGGACATGGACAAGCAGCCAGG + Intergenic
909601370 1:77464835-77464857 GAGATGATGGAGGTGCAGCCAGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
910427682 1:87132563-87132585 GGGTAAATGGAGATGCAGCCGGG - Intronic
910940633 1:92530220-92530242 GGGAATCTGGAGAGGCAGTCTGG - Intronic
910978128 1:92929849-92929871 GACAACTTGGAAAGTCAGCCAGG - Intronic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912500649 1:110119961-110119983 GAGCACAGGGAGAGTGAGCCAGG - Intergenic
912735285 1:112144922-112144944 TTGAACATGGAGATGCAGCTGGG + Intergenic
915040960 1:152967961-152967983 GAGAACATGCGGTGGAAGCCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916525916 1:165609351-165609373 GAGAAAATTGAGAGCCAGGCAGG + Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918684425 1:187397248-187397270 GGGAATCTGGAGAGGCAGTCTGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920046504 1:203136238-203136260 GAGAAGAAGGAGAGGCAGATGGG + Intronic
920295349 1:204952873-204952895 GAGGCCAAGCAGAGGCAGCCAGG + Intronic
920329230 1:205193503-205193525 GAGAAAAAGGGGAGGCAGACAGG - Intronic
920373040 1:205491771-205491793 GATTTCAGGGAGAGGCAGCCAGG - Intergenic
921886633 1:220313874-220313896 GAGAACAAGGCCAGGTAGCCTGG + Intergenic
922232859 1:223701511-223701533 GAGAATATGGAAATGCTGCCTGG - Intergenic
923605305 1:235437998-235438020 GAAAACATGGAGACGGTGCCTGG - Intronic
923779366 1:237008533-237008555 AAGAACTTGGAGGGGCAGACAGG - Intergenic
924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG + Intergenic
1064226494 10:13490480-13490502 GAGAGCATGGAGAGACATTCAGG - Intronic
1064525485 10:16251459-16251481 TAGAATATGGAGAATCAGCCAGG + Intergenic
1065637584 10:27746142-27746164 GAGAAATTGGAGAAGCTGCCGGG + Intergenic
1065741186 10:28798624-28798646 AAGAAGATGGAGAGGCAGCAAGG - Intergenic
1066581943 10:36890751-36890773 GGGGACATAGAGAGGCATCCCGG - Intergenic
1066624308 10:37390679-37390701 GAGCACAGGGAGATGAAGCCTGG - Intergenic
1068927392 10:62554443-62554465 GAGAAGGTGGAGAGGTTGCCAGG - Intronic
1069874854 10:71555564-71555586 GAGAAGATGCAGGGGGAGCCTGG + Intronic
1070349284 10:75576302-75576324 GGGAATCTGGAGAGGCAGTCTGG - Intronic
1070982461 10:80660434-80660456 GGGAAGATGGTGAGGGAGCCGGG - Intergenic
1071483873 10:86085209-86085231 GAATAGCTGGAGAGGCAGCCTGG + Intronic
1071716338 10:88099998-88100020 GAGAAATTGCAGAGGCAGCGTGG - Intergenic
1072206126 10:93206796-93206818 GAGAACAAGGCCAGGCAGCCTGG + Intergenic
1072733547 10:97864320-97864342 GAGATCCTGGTGAGGCTGCCAGG + Intronic
1073771058 10:106736404-106736426 GGGAACATGAAGAGGAAGGCAGG - Intronic
1076244530 10:128936119-128936141 GAGCACTTGGATAAGCAGCCAGG - Intergenic
1076799905 10:132816260-132816282 GAGAACATGCAGAAGACGCCAGG - Intronic
1077145395 11:1042121-1042143 GAGCACAGGGAGAGGCTGCCGGG + Intergenic
1077329281 11:1976852-1976874 GAGAGCAGGGAGAGGCAGCAGGG + Intronic
1077496673 11:2890041-2890063 GAGCAGCTGGGGAGGCAGCCGGG - Intronic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1078102281 11:8336948-8336970 GAGAACAAGGCCAGGCTGCCAGG - Intergenic
1078740260 11:14059635-14059657 GGGAAAATGGAAATGCAGCCTGG - Intronic
1079223472 11:18585184-18585206 AAGAAAGTGAAGAGGCAGCCAGG - Intronic
1079484742 11:20923517-20923539 GAGAACCTTGAGAGTAAGCCAGG - Intronic
1080440172 11:32286751-32286773 GAGACCATGGAGAAGCAAACAGG + Intergenic
1081286269 11:41274158-41274180 GAGAGAGTGGAGAAGCAGCCAGG + Intronic
1081423530 11:42900108-42900130 AAGAACATGGAGAGGATTCCTGG - Intergenic
1081677044 11:44976102-44976124 GAGGACAGGGAGACTCAGCCCGG + Intergenic
1081693531 11:45094359-45094381 GAGGACATTCAGGGGCAGCCTGG - Intergenic
1082261176 11:50077172-50077194 GTGGACCTGGAGATGCAGCCAGG + Intergenic
1083372365 11:62192501-62192523 GAGGACATGGGGAGTGAGCCTGG + Intronic
1083378253 11:62243730-62243752 GAGGACATGGGGAGTGAGCCTGG + Intronic
1083744723 11:64729051-64729073 GAGCAAATGGAGAGCCAGCCAGG + Intronic
1084214594 11:67640522-67640544 GACAACCTGGAGAGGGTGCCCGG - Intergenic
1084476637 11:69393249-69393271 GGGAACATGGAGAGGAAGGAAGG + Intergenic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1084956138 11:72692668-72692690 GGGAGCATGGGGAGACAGCCAGG - Intronic
1085146060 11:74198746-74198768 GAGAAAATGAAGAGCCAGGCTGG - Intronic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1086312280 11:85548696-85548718 GGGAATCTGGAGAGGCAGTCTGG + Intronic
1089834735 11:121360017-121360039 GAGAAAATGGAGAGAAAGCTAGG - Intergenic
1202812260 11_KI270721v1_random:32031-32053 GAGAGCAGGGAGAGGCAGCAGGG + Intergenic
1091958776 12:4672662-4672684 GGGAATCTGGAGAGGCAGTCTGG - Intronic
1092579422 12:9821765-9821787 CAGAGCATTGAGAGGCAGCATGG + Intergenic
1092769398 12:11883174-11883196 CAGAACCTGGAGAGGCAGCTGGG - Intronic
1092920351 12:13225739-13225761 AAGAACTGGGAGAGGCTGCCTGG - Intergenic
1093604629 12:21074682-21074704 GAGAAGATGGAGATGCTGCAGGG + Intronic
1096239632 12:49952839-49952861 GAGGACACTGAGAGCCAGCCTGG + Intronic
1097033102 12:56104055-56104077 GAGAACAGGGAGGGGCAGACAGG - Intronic
1099318712 12:81117975-81117997 GAAAACATGGGGAGGAAGCAGGG - Intronic
1099697461 12:86040440-86040462 GGGAATCTGGAGAGGCAGTCTGG + Intronic
1100431568 12:94535673-94535695 GAGCACATCAAGAGCCAGCCTGG - Intergenic
1100631716 12:96396177-96396199 GCCAACAGGGAGAGGCAGACAGG + Intronic
1102081047 12:110098281-110098303 GAAAACATAGGGAGGCAGTCAGG - Intergenic
1102595305 12:113987739-113987761 GAGAGCCTGGAAAGGCAGGCTGG - Intergenic
1102736438 12:115164953-115164975 GAGATGATGGGGAAGCAGCCTGG + Intergenic
1102774290 12:115505300-115505322 GAGAAAATGGAGAGAGAGCTGGG - Intergenic
1103232937 12:119347244-119347266 GAAAAAATGGAGAGGAAGACAGG + Intronic
1103789785 12:123461419-123461441 GAAAAAAAGAAGAGGCAGCCGGG - Intronic
1104093917 12:125538863-125538885 TTGAAAATGGAGAGGCATCCGGG - Intronic
1104386194 12:128353669-128353691 GAGCACAGGAGGAGGCAGCCTGG + Intronic
1104432087 12:128724694-128724716 GGAAGCAGGGAGAGGCAGCCTGG + Intergenic
1105313514 13:19235444-19235466 CAGACAATGGAGAGGCAGCAAGG - Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106559003 13:30832960-30832982 GGGAGCCTGGAGAGGTAGCCAGG - Intergenic
1106718418 13:32415225-32415247 TGGAACATGGAGGTGCAGCCTGG - Intronic
1106815372 13:33401669-33401691 GAGAAAATGGAGAGGGAGCTGGG - Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1111697848 13:91647774-91647796 AAGAAAATTGAGAGGGAGCCAGG - Intronic
1111728958 13:92048459-92048481 GAGAACACAGAAAGTCAGCCAGG + Intronic
1112043182 13:95568842-95568864 AGGAACAGGGAGAGGCAGCATGG + Intronic
1112635791 13:101216425-101216447 GAGATCAGGAAGAGGCACCCAGG + Intronic
1113133551 13:107063811-107063833 GAGATCAGGGAGACCCAGCCTGG + Intergenic
1113227013 13:108169706-108169728 GAGAACATTGAGAGGGACCATGG + Intergenic
1113792677 13:113037663-113037685 GAGAGGCTGCAGAGGCAGCCAGG + Intronic
1114220091 14:20688756-20688778 CAGAACCTGGAGAGGCCTCCAGG + Intronic
1114449784 14:22817922-22817944 GAGAAAGGGGAGGGGCAGCCAGG - Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114722007 14:24892592-24892614 GACAACATGGAGAGGGGGCGGGG - Intronic
1115769898 14:36657776-36657798 GAGAAGGTGGAGAGGCTGCCGGG + Intronic
1116869680 14:50059615-50059637 GAGAACATGGAAAAGAATCCTGG + Intergenic
1118494431 14:66294340-66294362 GAGAACCTGAAGAGGCACCAAGG + Intergenic
1118737262 14:68710934-68710956 TACATCAGGGAGAGGCAGCCTGG - Intronic
1119564558 14:75617429-75617451 GAAGGGATGGAGAGGCAGCCTGG - Intronic
1119953804 14:78773385-78773407 GAAAGCATGGAGTGTCAGCCAGG + Intronic
1120393565 14:83939262-83939284 CAGAACATGGAGTGGCAGAGAGG + Intergenic
1120751156 14:88199498-88199520 AAGAACCTGGAAAAGCAGCCAGG + Intronic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122269957 14:100564518-100564540 GAGCACACGGAGAGCCAGCCGGG + Intronic
1122559145 14:102598946-102598968 GACAGCATGGAAAGGCAGTCTGG - Intronic
1124028630 15:25989594-25989616 GCGGACCTTGAGAGGCAGCCAGG + Intergenic
1124169966 15:27363856-27363878 GAGCAAATGGAGAGACAGACAGG + Intronic
1124239327 15:28017036-28017058 GATCACCTGGGGAGGCAGCCTGG + Intronic
1124785066 15:32671907-32671929 GAGAAGGTGGAGAGGCGGCAAGG - Intronic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1126070374 15:44860671-44860693 GAGGAGATGGAGAGTCAGCTGGG + Intergenic
1126087661 15:45024446-45024468 GAGGAGATGGAGAGTCAGCTGGG - Intronic
1127293160 15:57588197-57588219 GAGAAAATGGAGCGGCAGGGAGG - Intergenic
1127714816 15:61639782-61639804 GAAAACTTGGAGAGCAAGCCGGG + Intergenic
1128072775 15:64807805-64807827 GAGGACAGGCAGGGGCAGCCCGG - Intergenic
1128251416 15:66166593-66166615 GGGAACAAGGAGATGCAGCCAGG - Intronic
1129508506 15:76102906-76102928 GAGAAGCTGGCGAGGCAGCAGGG + Intronic
1130367949 15:83257524-83257546 GAAAACATGGTGTTGCAGCCTGG + Exonic
1130612684 15:85375931-85375953 GAGGGCAGGGAGTGGCAGCCAGG - Intergenic
1131965058 15:97833451-97833473 GAGAACTTTGAGAGAAAGCCAGG - Intergenic
1132342597 15:101087751-101087773 GAGTACAAGCAGGGGCAGCCAGG + Intergenic
1132551666 16:556263-556285 CAGGACATGGGCAGGCAGCCAGG - Intergenic
1132982206 16:2744051-2744073 CAGAACATGGAGAGGCAACAGGG + Intergenic
1134863218 16:17579510-17579532 GAGACCATGGAGGGGGAGCCAGG + Intergenic
1135673516 16:24394726-24394748 AAGGACATGGAGAGACAGCCAGG + Intergenic
1136248656 16:28989626-28989648 GAGAGCATGGTGGGGCAGCGGGG - Intronic
1136653454 16:31693534-31693556 GGGAACATGGTGGGGAAGCCAGG - Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137486988 16:48899744-48899766 GAGAGCAGGGACAGGCATCCAGG - Intergenic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1139494507 16:67306554-67306576 GAGAAAATGGAGAGGCAGGACGG - Intronic
1140136407 16:72209842-72209864 CAGAAGATGGAAAGGCAGCAGGG + Intergenic
1140895814 16:79323263-79323285 GATGACATGGAGAGGCTGCAGGG + Intergenic
1141017250 16:80462009-80462031 GAAAACATGGAAAGGCAGTTAGG + Intergenic
1141147078 16:81538481-81538503 AAGAACATGGAGACACAGGCTGG - Intronic
1141283868 16:82653410-82653432 GAGAACAGAGAGAGGGACCCAGG + Intronic
1141516524 16:84548694-84548716 GGGGACCTGGAGATGCAGCCGGG + Intronic
1142181662 16:88674184-88674206 GAGAACAGCGAGAGGCACGCAGG + Intergenic
1142592171 17:1011042-1011064 GGGAACAGGGAGAGATAGCCTGG + Intronic
1142882480 17:2892611-2892633 GGGAACATGGAGAGGCTACATGG - Intronic
1143289925 17:5820761-5820783 GAGAAGATGAAGAGGCAGGGAGG - Intronic
1143661513 17:8327237-8327259 GAGAACCAGGAGACACAGCCAGG - Intergenic
1143902414 17:10184168-10184190 AGGACGATGGAGAGGCAGCCAGG - Intronic
1143921116 17:10331789-10331811 GAGAACATAGAGAGGACTCCAGG - Intronic
1144676853 17:17167544-17167566 CAGGACATGGAGAGGCATCATGG + Intronic
1144820963 17:18074025-18074047 AAGAGCATGAAGAGGCCGCCGGG - Intergenic
1145320792 17:21766096-21766118 GAGAACGTGGAGAAGCAGAGAGG + Intergenic
1147196524 17:38770265-38770287 GGGAACATGGCAAGGCAGGCAGG + Intronic
1147609468 17:41793169-41793191 GTGAATAAGGAGGGGCAGCCTGG - Intergenic
1147951196 17:44108999-44109021 GAGTCCATGCAGGGGCAGCCAGG + Intronic
1148152720 17:45405707-45405729 GAGGAGTTGGAGATGCAGCCGGG - Exonic
1148180520 17:45601665-45601687 GAGTCCTTGGAGAGGCAGGCAGG + Intergenic
1148268379 17:46244229-46244251 GAGTCCTTGGAGAGGCAGGCAGG - Intergenic
1148462079 17:47844671-47844693 GAGACCAGGGAGGGACAGCCCGG + Intergenic
1148764390 17:50028738-50028760 GAGAAAATGGAGAGGAAGGACGG - Intergenic
1148776597 17:50099221-50099243 GACCAGGTGGAGAGGCAGCCAGG - Intronic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1151393034 17:73800686-73800708 GAGAACATGGAGAAACCGCCAGG + Intergenic
1151944729 17:77313315-77313337 GACAACGGGGAGAAGCAGCCCGG - Intronic
1152042120 17:77910135-77910157 GAGGACAGGGAGAGGGGGCCTGG - Intergenic
1154047761 18:10922739-10922761 GAGTGCATGGAGAGGCAAGCTGG + Intronic
1154173171 18:12065544-12065566 GAGTGCATGGAGAGGCAAGCTGG - Intergenic
1155351135 18:24907455-24907477 GAGAACATGCAGAGCCTGCCAGG - Intergenic
1155588768 18:27400304-27400326 GAGAAAATGGAGAGGGATACCGG - Intergenic
1155642213 18:28031709-28031731 GAGAACTTGGAAAGCCAGGCAGG + Intronic
1156255413 18:35391220-35391242 GGCCACATGGAGAGGCAGCATGG - Intergenic
1157066531 18:44356895-44356917 GGGAATCTAGAGAGGCAGCCTGG + Intergenic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1158888230 18:61848995-61849017 GAGAACAGGGAAGGGGAGCCTGG + Intronic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1160024689 18:75208366-75208388 GGGAACAGGGAAAGCCAGCCGGG + Intronic
1160816797 19:1039827-1039849 TACAACGTGGGGAGGCAGCCTGG + Intergenic
1161010933 19:1959007-1959029 GAGCAGATGGAGATGCAGACTGG - Intronic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1162438484 19:10678249-10678271 GAGAACATGGGGAGGAGGCAAGG + Intronic
1162769894 19:12943052-12943074 GGAAAGATGGAGAGACAGCCAGG - Intronic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1164658641 19:29942702-29942724 GAGCACAGGCAGGGGCAGCCCGG - Intronic
1165070662 19:33253303-33253325 GGGACCCTGGAGAGCCAGCCTGG - Intergenic
1165995176 19:39839006-39839028 GAGTAGATGGAGAGTCAGGCAGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166379501 19:42348464-42348486 GAGAACATGGTGAGGCCGCCTGG + Exonic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166706416 19:44910411-44910433 GAGAACAGGGAGAGACAGAGGGG - Intergenic
1166864973 19:45830316-45830338 GAGGAACTGGAGAGGCAGCAGGG - Intronic
1167049857 19:47071795-47071817 GAGGGCATGGAGATGGAGCCCGG - Exonic
1167613457 19:50518214-50518236 GAGACCCTGGAGACGCAGCCCGG - Exonic
1167806317 19:51788629-51788651 GGAAACATGCAGAGGCATCCAGG - Intronic
1168078747 19:53994080-53994102 GTGCCCATGGAGAGACAGCCTGG + Intronic
1168191364 19:54740793-54740815 GAGCTCATGGGGAGACAGCCTGG + Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
925024988 2:600633-600655 GAGCACCTGGAGAGTCAGACCGG - Intergenic
925985922 2:9214533-9214555 AAGCACCTGGAAAGGCAGCCGGG - Intronic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926280758 2:11443882-11443904 GACAACATGGAATGGCAGCTGGG + Intergenic
926422097 2:12709938-12709960 GAGAACAGGGAGTGGCAGGAAGG + Intergenic
927465443 2:23332915-23332937 GAGGACTTGGAGATGCAGCTGGG - Intergenic
927826297 2:26312197-26312219 GAGAAAAGGGAGAGGAAGACAGG + Intronic
927998871 2:27506167-27506189 GAGACCCTGGAGAGGGAGGCAGG - Intronic
928197100 2:29223870-29223892 GAGGAAATGGGGAGGGAGCCAGG + Intronic
929041810 2:37751596-37751618 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
929334589 2:40725693-40725715 GAGAAGAAGGAGAGGCAGATAGG - Intergenic
929955361 2:46454121-46454143 GAGACCATTGAGGAGCAGCCAGG - Intronic
930439917 2:51391941-51391963 GAGAATCTAGAGAGGCAGCCTGG - Intergenic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
932338701 2:70945903-70945925 GAGAAGAGGGAGAGGCATCCAGG - Intronic
932376253 2:71238605-71238627 GAGAACAAGGAGTGGCAGAGGGG + Intergenic
932419059 2:71590746-71590768 CAGGAAATGCAGAGGCAGCCTGG - Intronic
933321088 2:80776695-80776717 AAGAAAATAGAAAGGCAGCCAGG + Intergenic
933668937 2:84988277-84988299 GAGTAGATGAAGAGGCAGCAAGG + Intronic
934945124 2:98535147-98535169 GAGGACATGGCCAGGCTGCCAGG + Intronic
935659972 2:105458208-105458230 GAGGACAGAGAGAGGGAGCCGGG + Intergenic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
937170329 2:119859599-119859621 GAGAAGCTGAAGAGGAAGCCTGG - Intronic
937428827 2:121821278-121821300 TAGAACTTGTAGATGCAGCCAGG - Intergenic
938065570 2:128280330-128280352 GACACCATGGACAGCCAGCCCGG - Intronic
938400883 2:130990664-130990686 GAGGAGATGGAGATTCAGCCTGG + Intronic
938692525 2:133805416-133805438 GAGGACATGGTAAGGCAGGCTGG - Intergenic
942545825 2:177062685-177062707 GACAACATTGAGAGGCAGAAAGG + Intergenic
943660507 2:190554589-190554611 GGGAACCTGGAGAGGCAATCTGG - Intergenic
945034332 2:205691311-205691333 GAGAAAGGGCAGAGGCAGCCTGG + Intronic
946234906 2:218318151-218318173 GACACCAGGGACAGGCAGCCTGG + Intronic
946396289 2:219445288-219445310 GGGAAGATGGAGTGGCAGCAGGG - Intronic
947430331 2:230022244-230022266 GAGAACAAGGGGAAGCAGCGAGG - Intergenic
948172075 2:235911843-235911865 GAGAAGAGGGAAAGTCAGCCAGG - Intronic
948271537 2:236677615-236677637 CAGCACATGGAGAGGCATCTAGG + Intergenic
948369963 2:237482614-237482636 GAGAGCAAGCGGAGGCAGCCAGG + Intergenic
948381571 2:237553797-237553819 GAGAGGATGGTGGGGCAGCCAGG - Exonic
948640813 2:239375095-239375117 GAGAACACGCAGAGCCAGGCAGG + Intronic
948769673 2:240244815-240244837 GAGAGCAGGGAGAGGAAGCCAGG - Intergenic
948786728 2:240356546-240356568 GGGCACAGGGAGAGGCAGCCAGG + Intergenic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
1169759773 20:9078655-9078677 GAAAACATGGTGTAGCAGCCAGG - Intronic
1170009649 20:11708206-11708228 GAAATCAAAGAGAGGCAGCCCGG + Intergenic
1170843271 20:19940918-19940940 GGGATCCTGCAGAGGCAGCCTGG - Intronic
1170873403 20:20229179-20229201 GAGCACATGGAGAGAGAGACTGG - Intronic
1171191355 20:23161777-23161799 GAGGAAATGGGGAAGCAGCCAGG - Intergenic
1171284544 20:23926284-23926306 GAGGACAGGGAGAGGCCTCCAGG + Intergenic
1171992788 20:31709227-31709249 GAGATCATGAGGAGGCAGACTGG - Intronic
1172344839 20:34189944-34189966 TAGGACATGCAGAGGCAGGCAGG + Intergenic
1172444555 20:34986231-34986253 CAGAACCTGGAGGGGCTGCCTGG + Intronic
1172657148 20:36544175-36544197 GAGAACAAGGAGTGGGACCCAGG + Intronic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1173026174 20:39309551-39309573 GACCACATGGAGAGAAAGCCAGG - Intergenic
1173736543 20:45365640-45365662 GACATCATGGAGAGCCGGCCTGG - Exonic
1174617758 20:51849528-51849550 GAGGACATGGAGGCCCAGCCAGG - Intergenic
1174952324 20:55055876-55055898 GAGGAGATGGAAAGGCAGGCAGG - Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175306945 20:57982699-57982721 GGGCACAAGGAGAGGCAGACAGG + Intergenic
1175488392 20:59362238-59362260 GAAAACCTAGAGAGGCAGGCAGG - Intergenic
1177739318 21:25135230-25135252 GAGAACATGGGGAGGAAATCTGG + Intergenic
1177812497 21:25939232-25939254 CAGAACATGGGAAGGAAGCCAGG + Intronic
1178343513 21:31805857-31805879 GATGACATGCAGAGGCAGGCTGG + Intergenic
1178488873 21:33035366-33035388 GAGACCATGAAGAGGCAGTTGGG + Intergenic
1178494609 21:33076196-33076218 GAAAACACTGTGAGGCAGCCAGG - Intergenic
1178722117 21:35019233-35019255 GAGAACAGGGAAAGGTATCCAGG - Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179722330 21:43322815-43322837 GAGGAAATGGGGAGGCAGCCAGG + Intergenic
1179921872 21:44511975-44511997 GGGACCATGGAGGGGCTGCCCGG + Intronic
1181473925 22:23157126-23157148 GAAAACCGGGAGATGCAGCCTGG - Intronic
1181964985 22:26650196-26650218 GAGAAGAGGGAGAGACACCCGGG + Intergenic
1181967480 22:26667056-26667078 GAGAAGATGGCCAGGGAGCCAGG + Intergenic
1183396138 22:37571894-37571916 AAGAACATGGACATGAAGCCGGG - Exonic
1183658150 22:39202751-39202773 GAGAGCATCCAGACGCAGCCAGG + Intergenic
1183707511 22:39483542-39483564 CAGGACTTGGAAAGGCAGCCTGG - Intronic
1183999672 22:41663854-41663876 GAGGACAAGGCCAGGCAGCCTGG - Exonic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184646965 22:45901340-45901362 GAGAAAATGTAAATGCAGCCGGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1203294027 22_KI270736v1_random:23116-23138 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
949855230 3:8455342-8455364 GTGGCCTTGGAGAGGCAGCCAGG - Intergenic
949920282 3:8994635-8994657 GAGAACATGGACAGAACGCCTGG + Intronic
949940594 3:9151371-9151393 GGGCAGCTGGAGAGGCAGCCTGG + Intronic
950109234 3:10407916-10407938 GAGCACATGGAGGGCCGGCCTGG + Intronic
950158470 3:10741674-10741696 AAGCACATGGAGAGGCTGCAGGG - Intergenic
950210836 3:11121804-11121826 GTGGCCTTGGAGAGGCAGCCAGG - Intergenic
950211969 3:11130267-11130289 GAGAACACGTAGAGGGAGCCTGG + Intergenic
950884426 3:16350683-16350705 GAAAGGATGGAGATGCAGCCTGG + Intronic
950967949 3:17159443-17159465 CAGAGGATGGCGAGGCAGCCGGG - Intronic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951087135 3:18526207-18526229 GAGAACAGGGAGGGGAACCCAGG - Intergenic
952006877 3:28851159-28851181 GAAAACATGGAGAGGCTGGGAGG + Intergenic
952507932 3:34024526-34024548 GAGGACATGAAGATGCATCCTGG + Intergenic
953074083 3:39551628-39551650 AGGAACATAGAGAGGCAGTCTGG - Intergenic
953203314 3:40797544-40797566 GAGAAAATGTGGAGGAAGCCAGG - Intergenic
954117228 3:48473576-48473598 GAGAACATGGGGAGACAGATTGG - Intronic
954148055 3:48644001-48644023 GAGGACAAGGAGAGACAGCAGGG + Intronic
955950683 3:64239448-64239470 GGGAACATGGAGATGCTTCCCGG + Intronic
956158042 3:66318468-66318490 GAGAGCAAGGAAAGGCAGGCTGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
956739995 3:72268264-72268286 GACAACATTGAGAGGGAGACTGG - Intergenic
956786212 3:72644387-72644409 GAGGACATGAAGAGGCTCCCTGG + Intergenic
959487810 3:106948423-106948445 GAGAACATAGAGAGGTAAGCAGG + Intergenic
961495219 3:127286705-127286727 GAGATCCTGGAGTGGCAGCTGGG + Intergenic
962274256 3:134000269-134000291 GAGCACATGCAGATGCAGTCAGG + Intronic
962285721 3:134084352-134084374 GATGAGAGGGAGAGGCAGCCTGG + Intronic
962525912 3:136237329-136237351 GAAAAAATGGTGAGGGAGCCAGG - Intergenic
963013942 3:140802992-140803014 AAGAATCTGGAGAGGCAGTCTGG + Intergenic
963322363 3:143822625-143822647 GAGAACAGGGAAATGCAGCTGGG + Intronic
964053120 3:152420041-152420063 AAGAATCTAGAGAGGCAGCCTGG - Intronic
964770262 3:160217783-160217805 CAGAAAATGGTGAGACAGCCTGG + Intergenic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
967881251 3:194303328-194303350 GAGAACAGGGAGAGCCAGCTAGG + Intergenic
967892666 3:194374096-194374118 GAGCAGATGGAGGGGCACCCGGG - Intergenic
969218795 4:5746020-5746042 GGGACCATGGAGAGGCTGGCCGG + Intronic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970887824 4:21006990-21007012 GAGACCTTGGAAAGTCAGCCAGG - Intronic
971037419 4:22709283-22709305 GGGAAAATGGGGAGGGAGCCAGG + Intergenic
972795289 4:42411213-42411235 TAGAAAATGGAGAGGCATACTGG + Exonic
972854067 4:43084490-43084512 ATGAACTTGGACAGGCAGCCTGG + Intergenic
974466460 4:62262883-62262905 TGGAAAATGAAGAGGCAGCCTGG + Intergenic
975386127 4:73762513-73762535 GAGGAAATGGGGAGGCAGCTGGG + Intergenic
975469073 4:74743927-74743949 GGGAGCATGGAGAGGGAGCAGGG - Intergenic
976432339 4:84977146-84977168 GACAACATGGTGAGGCAACATGG + Intergenic
976634126 4:87270797-87270819 GAGATCATGGAGAGGAAACTGGG + Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977765217 4:100789468-100789490 GAGGACATGGAAGGGCAGCTTGG - Intronic
977971628 4:103219280-103219302 CAGAGCATAGAGAGGCAGCATGG + Intergenic
978481950 4:109202911-109202933 GATATGTTGGAGAGGCAGCCAGG + Intronic
978754308 4:112286021-112286043 GAGAACTGAGAGAGGCGGCCAGG - Intronic
979480787 4:121214525-121214547 GTGAATATGGAGAGGTGGCCGGG + Intronic
980447103 4:132923357-132923379 GAGAATATGCAGAGGCTACCAGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981645942 4:146998783-146998805 GGGAACAAGGATAGGAAGCCAGG - Intergenic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
983906191 4:173184579-173184601 GAGACCAGGGAGAGGGAGCTCGG + Intronic
984648536 4:182244602-182244624 GAGAATATGAAGAGGAAGACGGG + Intronic
986112154 5:4730279-4730301 GAGAAGATTGAGAGGCAGCATGG + Intergenic
986736853 5:10674389-10674411 GAGGAGATGGAGAGGAGGCCAGG - Intergenic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
987390789 5:17373583-17373605 AAGAACGTGAAGAGGCAGGCCGG + Intergenic
991559534 5:67934922-67934944 GGGAACATGGGAAGGGAGCCAGG + Intergenic
994168813 5:96637015-96637037 GAACACATGGAGAGGCAGAGAGG - Intronic
995015171 5:107301823-107301845 GAGAAAGTGGCGAGGCAACCTGG + Intergenic
995803084 5:116020801-116020823 GAGAAGAAGGAGAGGCAGAAAGG + Intronic
996388366 5:122933398-122933420 GAGAACAGGGAGCTGCACCCTGG - Intronic
997713142 5:136022857-136022879 GGGAAGCTGGAGAGGGAGCCAGG + Intergenic
997886010 5:137630472-137630494 GAAAGCCTGGGGAGGCAGCCAGG - Intronic
999550508 5:152681669-152681691 GACAACATGTAGTGGCATCCTGG - Intergenic
999679029 5:154038387-154038409 GAGGAAACGGAGAGGCAGACAGG - Intronic
1000963091 5:167623610-167623632 GAGAACAATGTGAAGCAGCCAGG - Intronic
1001119988 5:168972128-168972150 GAAGACCTGGAGAGGCATCCAGG + Intronic
1001323836 5:170704877-170704899 GACAATATAGAGAGGCAGCAGGG + Intronic
1001356134 5:171025154-171025176 GAGGTCATGGAAAGGCAGCTTGG - Intronic
1002112201 5:176924743-176924765 AAGAAAATGAATAGGCAGCCGGG + Intronic
1002806091 6:575475-575497 GAGAGGATGGAGAGGGAGCGAGG - Intronic
1002806097 6:575498-575520 GAGAGGATGGAGAGGGAGCGAGG - Intronic
1006145996 6:31960083-31960105 CACACCATGCAGAGGCAGCCAGG - Exonic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006870501 6:37246923-37246945 CAGAAGATGGGGAGACAGCCAGG + Intronic
1007238049 6:40405243-40405265 GAGAAGCTGAAGAGGCAGCAGGG + Intronic
1009682635 6:66918438-66918460 GAGAAAATGGAAGGGGAGCCAGG + Intergenic
1010329472 6:74606348-74606370 GGGAACAGGGAGAGACAGCAAGG - Intergenic
1010606346 6:77893124-77893146 GAGAACATTGGGATGCAGCAGGG - Intronic
1010844155 6:80684143-80684165 GAGAAAATGTAGTGGCAGTCAGG + Intergenic
1011491856 6:87900899-87900921 GAGAACAGAGAGTGGCAGCGTGG - Intergenic
1011861711 6:91765825-91765847 GGCCACCTGGAGAGGCAGCCAGG + Intergenic
1012534906 6:100283670-100283692 GAGAACATGGGTTAGCAGCCAGG - Intergenic
1012778020 6:103522329-103522351 GGGAACCGGGAGAGGCAGTCAGG - Intergenic
1013098651 6:106969049-106969071 GACAACCTGGAAAGGCAGGCTGG - Intergenic
1013728378 6:113130118-113130140 GAGAACAGCGAGAGTCAGTCAGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1016014984 6:139174515-139174537 GACAACATGGAGAGGCAGCCAGG - Exonic
1017184788 6:151589829-151589851 GGGAAGATGGAGAGGCCACCTGG - Intronic
1017646137 6:156541363-156541385 GGTGACATGGAGAGTCAGCCTGG + Intergenic
1018142563 6:160853809-160853831 GAGAAGACGGTGAGGAAGCCAGG - Intergenic
1018924943 6:168199306-168199328 GTGTTCACGGAGAGGCAGCCTGG + Intergenic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019460167 7:1154023-1154045 GACAACAGAGAGAGGCAGCCAGG + Intronic
1019512722 7:1426076-1426098 GAGGGGAGGGAGAGGCAGCCTGG - Intergenic
1019747332 7:2708325-2708347 GGGACGCTGGAGAGGCAGCCGGG - Intronic
1020426454 7:8071672-8071694 AAGAACATGGAGAGACAGTTGGG - Intronic
1021494418 7:21258812-21258834 GAAAACATGGAGAGGGAGAAGGG - Intergenic
1023082106 7:36535610-36535632 TAGACTATGGAGAGGAAGCCAGG - Intronic
1023142554 7:37116797-37116819 AAAACCATGGAAAGGCAGCCTGG + Intronic
1023283361 7:38593983-38594005 GACAACATGGAGAGCCAACCGGG + Intronic
1024354480 7:48400424-48400446 GAGAACATTGCTAGGCAGCAGGG - Intronic
1024645014 7:51363602-51363624 GAGAAGAAGCAGAGGCAGCTAGG - Intergenic
1026116285 7:67498412-67498434 GACTGCAGGGAGAGGCAGCCAGG - Intergenic
1026589831 7:71684997-71685019 GAGAACATGGAGATTCAGATAGG + Intronic
1026683350 7:72487388-72487410 GAGAAAATAGAGAGGTGGCCAGG + Intergenic
1028806018 7:95026790-95026812 GGGAATCTGGAGAGGCAGTCTGG + Intronic
1030576464 7:111292354-111292376 GATAACATTAAGAGGCTGCCAGG - Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031453513 7:121951663-121951685 GAGGAGATGAAGAGGCAGGCTGG - Intronic
1031938555 7:127762389-127762411 GAGGACATGAAGAGACAGCAAGG - Intronic
1032702256 7:134392582-134392604 GAGGACATGGAAAGGAAGACAGG + Intergenic
1035161486 7:156953502-156953524 GAGGCCATGGAGGGGCAGCAGGG - Intronic
1035887024 8:3302386-3302408 GAGACCTTAGATAGGCAGCCAGG - Intronic
1036418922 8:8578116-8578138 TAGAATATGCAGAGTCAGCCTGG + Intergenic
1036704369 8:11035577-11035599 GAGAACTTCGAGATGCAGCTGGG - Intronic
1036913131 8:12775770-12775792 GGGAACTTAGAGATGCAGCCTGG + Intergenic
1037105544 8:15102607-15102629 GGGAACATGGAGGGACAGCAGGG + Intronic
1037343279 8:17870642-17870664 TAGAACTTGGATATGCAGCCTGG - Intronic
1039407566 8:37326364-37326386 GAGAAGAGGCAAAGGCAGCCAGG - Intergenic
1040287369 8:46107286-46107308 GTGAAAATGGAGATGCAGCGTGG - Intergenic
1040568004 8:48583696-48583718 GAGGCCAGGGAGAGGCCGCCGGG - Intergenic
1040977122 8:53205830-53205852 GAGAACCTTCAGAGGGAGCCTGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1044768588 8:95604831-95604853 GAGAACATTCAGAGGAAGGCAGG - Intergenic
1045836760 8:106531397-106531419 GAGAACATTGAAATGCAGCAGGG - Intronic
1046012483 8:108566046-108566068 GAGAAGATGGTAAGTCAGCCAGG - Intergenic
1046259732 8:111751802-111751824 GAGTACAAGCAGAGGCTGCCCGG - Intergenic
1046990648 8:120449119-120449141 GAGGAATGGGAGAGGCAGCCAGG + Intronic
1048180611 8:132191070-132191092 GTGAACTTGGAGAGACAGGCTGG + Intronic
1048219079 8:132525022-132525044 GAGAACCTGGAAAGGGAGCAGGG + Intergenic
1048876134 8:138838108-138838130 GAGAACAGGGACAGGAACCCAGG - Intronic
1049775530 8:144402149-144402171 GAGGAGATAGAGAGGCAGCCTGG - Intronic
1050035307 9:1429428-1429450 GATAACATGGACAGACTGCCTGG + Intergenic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1052512725 9:29441880-29441902 GAGAAACTGGGGAGGAAGCCTGG + Intergenic
1053142745 9:35691172-35691194 GAGAACAAGCGGAGGAAGCCGGG + Intergenic
1053284070 9:36839260-36839282 GGGAACTTGGAGAGGGAGCTTGG - Exonic
1054452956 9:65413101-65413123 TAGGACAGGGAGAAGCAGCCTGG - Intergenic
1056413443 9:86354418-86354440 GAAAACACGGAGAGGGAGCCCGG - Intronic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1056986951 9:91372090-91372112 GAGAACATGAACAGGGAGGCAGG - Intergenic
1058658123 9:107243557-107243579 TAGAACCTGGAGAGCCATCCAGG + Intergenic
1058815923 9:108682820-108682842 GAGATCATGGAGAGGGAGGTGGG - Intergenic
1059612037 9:115908889-115908911 GACATCATGGAGAGGCAGATTGG + Intergenic
1060059791 9:120448824-120448846 GAAAGAATGGAGAGACAGCCTGG - Intronic
1060237739 9:121877911-121877933 GAGGACCTGGAGAGTCAGGCCGG + Intronic
1060674149 9:125497048-125497070 GAGCCCATGGAGGGGCAGCCAGG + Intronic
1060745630 9:126129073-126129095 GAGGACTTGGAGATGCAGCAAGG - Intergenic
1060759218 9:126234279-126234301 CAGAGCATGGAGGGGCAGCCAGG + Intergenic
1061087976 9:128410269-128410291 GAGGACAGGGAGAGAAAGCCTGG + Intergenic
1061552758 9:131347543-131347565 GAGAATATGCTGAGTCAGCCAGG - Intergenic
1062193121 9:135257744-135257766 GAGGCCATGGAGATACAGCCAGG - Intergenic
1062425288 9:136503434-136503456 CAGGACATGGTGAGGCAGCCTGG + Intronic
1062601123 9:137319019-137319041 AAGAAAATGGAAAGTCAGCCCGG + Intronic
1185575898 X:1172022-1172044 GAGATCAAAGACAGGCAGCCCGG + Intergenic
1185685703 X:1926576-1926598 GAGAAAAGGGAGAGGAAGCAAGG - Intergenic
1186776706 X:12872095-12872117 GAGAAAATGGAGAGTCCTCCAGG - Intronic
1188829245 X:34876228-34876250 GAGAATATGGAGAAGAATCCAGG + Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189285848 X:39852030-39852052 GAGGACATGGAGAGAGAGCCAGG + Intergenic
1189304566 X:39977172-39977194 GGGGACAGGGAGAGGCAGCAAGG + Intergenic
1189590668 X:42507464-42507486 GGGAATCTAGAGAGGCAGCCTGG - Intergenic
1190263615 X:48814935-48814957 GGGGACATGGAGGGTCAGCCTGG - Intronic
1190751395 X:53364846-53364868 GAGAACATGGAGTGGGAGCGAGG + Intergenic
1191254424 X:58273652-58273674 GAGAACAGAGACAGGCGGCCAGG - Intergenic
1191257627 X:58286485-58286507 GGGAACAGAGAAAGGCAGCCAGG - Intergenic
1192336643 X:70226755-70226777 GAGAACAGGGACAGGCACACAGG + Intergenic
1192964193 X:76159749-76159771 GGGAATCTGGAGAGGCAGTCTGG - Intergenic
1193377145 X:80774874-80774896 GAGAAACTGGAGAGGCAGGTAGG - Intronic
1194916983 X:99719294-99719316 GAGAACAAGGCCAGGCAGCCTGG + Intergenic
1195697295 X:107676597-107676619 GAGGAGGTGGAGAGGCAGGCAGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1198758376 X:140004631-140004653 GAGACCACGGAGAGGCAGTGTGG + Intergenic
1198780386 X:140228965-140228987 GAGACCACGGAGAGGCAGTGTGG - Intergenic
1199500927 X:148504822-148504844 CAGAACAGGAGGAGGCAGCCGGG - Intronic
1199596187 X:149507950-149507972 GAGGATATAGAGAGGCAGCAAGG + Intronic
1199681914 X:150231010-150231032 GAGGACAAGGCCAGGCAGCCTGG + Intergenic
1200144640 X:153920402-153920424 GGGAGCATGGAGAGGCTGCATGG + Intronic
1200923708 Y:8635581-8635603 GAGTACAGGCAGAGCCAGCCTGG - Intergenic
1202151694 Y:21849598-21849620 GAGAACATGCTGAGGCATGCTGG - Intergenic