ID: 950972369

View in Genome Browser
Species Human (GRCh38)
Location 3:17202083-17202105
Sequence CAAAATGCTGATAGTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 38, 1: 78, 2: 68, 3: 54, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950972367_950972369 4 Left 950972367 3:17202056-17202078 CCTGGAAACTTGTTAAACTGTTG 0: 1
1: 1
2: 8
3: 117
4: 340
Right 950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG 0: 38
1: 78
2: 68
3: 54
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950972369 Original CRISPR CAAAATGCTGATAGTGATAT AGG Intronic