ID: 950975154

View in Genome Browser
Species Human (GRCh38)
Location 3:17233623-17233645
Sequence GTAGGCAATGATAATACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950975154 Original CRISPR GTAGGCAATGATAATACTGT AGG Intronic
900282211 1:1877883-1877905 GTAGCCACTGACAAAACTGTTGG + Intronic
906331299 1:44887265-44887287 GTTGTAAATGGTAATACTGTAGG + Intronic
907175732 1:52520706-52520728 ATAGGGAATGATGCTACTGTTGG - Intronic
908310493 1:62877152-62877174 GTAAGCAATGATAATAACTTTGG - Intergenic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
915552484 1:156643188-156643210 ATAGGCACTGGTAATACTGTGGG - Intronic
916325236 1:163549297-163549319 GTAGGGAATGAGAAAACTTTTGG - Intergenic
917486433 1:175459156-175459178 GGAGGTCATGATAATAGTGTTGG - Intronic
917831168 1:178888380-178888402 GAAGGCTTTGAAAATACTGTGGG + Intronic
919271194 1:195348560-195348582 GTTGGCAATACTAATTCTGTGGG - Intergenic
919330099 1:196160145-196160167 GTAGCAAATGGTAATATTGTAGG - Intergenic
1063496504 10:6514172-6514194 GTAGGGAATGATAATGATGATGG - Intronic
1064595347 10:16939123-16939145 TTTGGCAATGATAATATTGTGGG - Exonic
1064634235 10:17347439-17347461 GAGGGCAATGATAATAATGAAGG + Intronic
1065193543 10:23237932-23237954 GTTTGCTATGATAATACTATTGG - Intronic
1066675726 10:37885048-37885070 GTAAGCAAAGAAAATACTATTGG + Intergenic
1067691758 10:48506377-48506399 GCAGGCAATAATAACACGGTGGG + Intronic
1068280587 10:54863671-54863693 GTTGGAAATGCAAATACTGTGGG + Intronic
1068321137 10:55418016-55418038 GTAGGAAAAGATAATTCTTTGGG + Intronic
1068546385 10:58350943-58350965 GTAGGCAATTGTAACACAGTGGG + Intronic
1069312368 10:67054139-67054161 GAAGGCAATGATAATTCAGGAGG + Intronic
1072840901 10:98772603-98772625 GGAGGGCATGATAATACTTTGGG - Intronic
1075178489 10:120187768-120187790 GTAGGTAAAGATAATTCAGTAGG + Intergenic
1076988449 11:256507-256529 ATTGTCAGTGATAATACTGTGGG - Intergenic
1078566289 11:12417488-12417510 GTAGTCACTGTTAATACTGTAGG - Intronic
1089976524 11:122736974-122736996 GTGGGCAGAGATATTACTGTAGG + Intronic
1094554147 12:31481736-31481758 GTAGGCCATGTTAGAACTGTGGG + Intronic
1099010127 12:77281771-77281793 CTAGGCTATTATAAAACTGTGGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106857295 13:33867091-33867113 CAAGGCAATGCTAATACTCTTGG + Intronic
1109242939 13:59913402-59913424 TTTGGCAGTAATAATACTGTGGG - Intronic
1112397778 13:99049103-99049125 GTAGTCATTGATGATTCTGTTGG - Intronic
1114898056 14:27017777-27017799 GTAGGCACTGAACATACAGTAGG + Intergenic
1115315361 14:32019648-32019670 TTAGGCAAGGCTAACACTGTGGG + Intergenic
1117155502 14:52936342-52936364 GTAAGCAATGATAATCCTCTTGG - Intronic
1117167188 14:53048062-53048084 ATAGGAAATCATAATACTCTAGG + Intronic
1120834749 14:89029621-89029643 TTAGGCTATAATAATACTCTGGG - Intergenic
1121195102 14:92064693-92064715 GCAGGAAAAGATAAAACTGTAGG - Intronic
1122082610 14:99275848-99275870 GAAGGCAAAGATAACATTGTAGG - Intergenic
1124821072 15:33045717-33045739 GTAGTAAATGGTAATACTGCAGG + Intronic
1127402340 15:58602037-58602059 GTAGACAATGAAAATTTTGTAGG + Intronic
1129070563 15:72946750-72946772 GTGGGCAATGATAGTAGTGGTGG - Intergenic
1130007145 15:80110710-80110732 GTGGGCAAAGATGAGACTGTAGG + Intronic
1130709211 15:86263255-86263277 GTAGGCAATAGTAATACAATGGG - Intronic
1131312191 15:91300915-91300937 GAAGGCATTTGTAATACTGTTGG + Exonic
1136363902 16:29799647-29799669 GTTGGCAATAAGGATACTGTGGG - Exonic
1139138051 16:64228776-64228798 CTAGGTGATGATGATACTGTTGG + Intergenic
1139907258 16:70374973-70374995 TTAAACATTGATAATACTGTTGG - Intergenic
1143234431 17:5386743-5386765 GTAGGCACTGAGAATAATGGTGG + Exonic
1153340929 18:3973998-3974020 GTAGGCAATTGTAACACCGTGGG + Intronic
1156144132 18:34155618-34155640 GTAGGTAATTTTAATACAGTGGG + Intronic
1162919684 19:13893228-13893250 GTAGGAAAAGATAAAACTGAAGG + Intronic
1165212392 19:34246425-34246447 GTAGCCAAAGTTATTACTGTTGG - Intergenic
1166164279 19:40976226-40976248 GCAGATTATGATAATACTGTAGG + Intergenic
1166186504 19:41142800-41142822 GAAGATCATGATAATACTGTAGG - Intergenic
1167032429 19:46971802-46971824 GTAGGGAAGGATAAAACTGAGGG - Intronic
1202632680 1_KI270706v1_random:15032-15054 GTAGTAAATGATAATATTGGAGG - Intergenic
925312273 2:2893445-2893467 GTAATCAATGATAATAATGCAGG - Intergenic
926288370 2:11508771-11508793 GTAGGCAATGGCAATAATGGTGG - Intergenic
928270316 2:29849522-29849544 GTAGGCCCTGAGAATACAGTGGG - Intronic
928382111 2:30827188-30827210 GTAGTAAATGGTAATATTGTAGG + Intergenic
930820313 2:55639855-55639877 GTAGGAAAAGATAATCTTGTTGG - Intronic
935889112 2:107656447-107656469 CCAGGGAATGTTAATACTGTAGG - Intergenic
936693904 2:114925298-114925320 GCAGGTAATGATGATGCTGTTGG + Intronic
939810241 2:146823091-146823113 CGAGGCAATGTTAATGCTGTTGG - Intergenic
939969240 2:148642021-148642043 GTAGGCAATGATTATAGAGCTGG - Intergenic
941639430 2:167971361-167971383 GTAGCAAATGATAATATTGTAGG + Intronic
943788968 2:191910249-191910271 CTAGGCACTGAAAAGACTGTGGG + Intergenic
944224946 2:197340311-197340333 GTAGGCAATTGTAACACAGTAGG + Intergenic
944906493 2:204266785-204266807 GGAGGCAGTGATATTACTGAAGG - Intergenic
1168753998 20:303199-303221 GTAGGCCATGTTAAGAATGTGGG + Intergenic
1168837816 20:889453-889475 GTAGGCAGTTATAACACAGTGGG + Intronic
1170604840 20:17867998-17868020 GTGGGCAATGATCATATTTTGGG - Intergenic
1170933306 20:20788649-20788671 GTAGGCAATTGTAACACAGTGGG + Intergenic
1173479070 20:43384898-43384920 ATAGGCAATGGCAACACTGTGGG + Intergenic
1173826968 20:46054203-46054225 GTAGGCAATGGCAACACAGTGGG + Intronic
1174427847 20:50445843-50445865 GTAGGCAATGGTAACACAATGGG - Intergenic
1174573067 20:51517223-51517245 GTAGGCAATGGTAACACAATGGG + Intronic
1176644894 21:9340912-9340934 GTAGTAAATGATAATATTGGAGG - Intergenic
1177003177 21:15638706-15638728 GTAGGCATTGATGTTACTGCTGG - Intergenic
1180368054 22:11958322-11958344 GTAGTAAATGATAATATTGGAGG + Intergenic
950975154 3:17233623-17233645 GTAGGCAATGATAATACTGTAGG + Intronic
951586631 3:24221518-24221540 GGAGGCAATGATCATAGTGGAGG + Intronic
952219802 3:31313591-31313613 ATTGGCAATGAGAATAATGTTGG - Intergenic
952480263 3:33753990-33754012 GGAGGCAAAAATAATTCTGTGGG - Intergenic
954983376 3:54766998-54767020 GGAGGGAATGATAGTTCTGTTGG - Intronic
957278546 3:78120136-78120158 GTAGGCATTTATAATATTATGGG - Intergenic
960524473 3:118693835-118693857 GGAGGCAATGTTAATACAGTGGG - Intergenic
960967951 3:123118343-123118365 GCAGGCAGAGAGAATACTGTGGG - Intronic
962784541 3:138754717-138754739 CTAGCTAATGATTATACTGTGGG - Intronic
964138722 3:153373324-153373346 GTAGACCATGATAATGGTGTGGG - Intergenic
1202741997 3_GL000221v1_random:64156-64178 GTAGTAAATGATAATATTGGAGG + Intergenic
970319262 4:14859845-14859867 GTTGGGAATTATAATACTATTGG + Intergenic
971059226 4:22948526-22948548 GTAGGCAATTGTAACACAGTGGG + Intergenic
971428235 4:26537044-26537066 GGAGGGAATGATCAGACTGTGGG - Intergenic
972038395 4:34556588-34556610 GTAGGCAATGGGAATATTATGGG - Intergenic
972599669 4:40561013-40561035 GTAGGCAGTGCTAAGAATGTGGG - Intronic
973232708 4:47860755-47860777 GTAAGCAATAGTGATACTGTTGG - Intronic
973238391 4:47930909-47930931 GTAAGCAATGATACCACTGGGGG + Intronic
973362311 4:49177004-49177026 GTAGCAAATGATAATATTGGAGG - Intergenic
974359526 4:60858763-60858785 TTTTGCAATGATAATACAGTAGG + Intergenic
976621113 4:87128248-87128270 GAAGGTAATGATTATACTGTTGG + Intronic
977852400 4:101846401-101846423 GTATGCATGGATAAAACTGTGGG + Intronic
979771744 4:124533441-124533463 AAAGGGAATGATAATAGTGTGGG + Intergenic
980575086 4:134676894-134676916 GTAGGCAATTGTAATACTTTAGG - Intergenic
981652365 4:147074229-147074251 GTAGGTACTGAAAATACAGTGGG - Intergenic
983235740 4:165177521-165177543 TTTGGAAATTATAATACTGTAGG - Intronic
984458125 4:179996956-179996978 CTAGGCGATGCTAATGCTGTTGG - Intergenic
1202759650 4_GL000008v2_random:98477-98499 GTAGCAAATGATAATATTGGAGG - Intergenic
986535543 5:8783169-8783191 GTAGTCATTGAAAATAATGTGGG - Intergenic
987210191 5:15673597-15673619 TTAAGCAATGGTAACACTGTTGG - Intronic
989429328 5:41334240-41334262 ATTAGCAATGATAATACTTTGGG + Intronic
990833636 5:59989253-59989275 GTAGGCAATTATAACACAATGGG + Intronic
991309801 5:65225022-65225044 GTAGGCTGTGATAATATTTTGGG - Exonic
991708045 5:69378881-69378903 GTAGGCAATTATAACACAGTGGG + Intronic
995031211 5:107483523-107483545 GTAGGCTATAAAAATACTGGAGG - Intronic
996213665 5:120841827-120841849 GAAGGCAAGGATAATCCTGAAGG - Intergenic
998586688 5:143434267-143434289 GTAGGCAATGAAGATACAGCAGG - Intronic
1001302824 5:170549269-170549291 CTAGGCCATGATAATGCTCTTGG + Intronic
1004184094 6:13407113-13407135 GAAGGCAAAGACAATACTCTAGG + Intronic
1004667830 6:17764731-17764753 GTAGCCACTGGTAATACTGCTGG + Exonic
1005850317 6:29815922-29815944 GAAGGCACTGAAAGTACTGTGGG + Intergenic
1007156525 6:39750687-39750709 GTAGTCAATGAGACTACTTTTGG + Intergenic
1009666241 6:66684693-66684715 GTAGGAAATGGTAATATTGCAGG + Intergenic
1010811666 6:80307906-80307928 GTAGCCCATGATATTACTTTTGG - Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1012415854 6:99012789-99012811 GTAGGCAATTGTAACACAGTGGG - Intergenic
1013206573 6:107952052-107952074 GTATGCAATGATAACACGGAGGG - Intronic
1014163335 6:118195600-118195622 GTAGTAAATGATAATATTGCAGG - Intronic
1014211650 6:118714785-118714807 GTAGGTAATAATTATACTATTGG + Intergenic
1014832015 6:126113918-126113940 GCAGGCAATGTCAATGCTGTTGG + Intergenic
1015443785 6:133279736-133279758 ATAATCAAAGATAATACTGTAGG - Intronic
1017030013 6:150212780-150212802 GTAGGCAACGGTAACACAGTGGG - Intronic
1017508107 6:155087268-155087290 GTTTCCAATGATAATAATGTTGG - Intronic
1017611111 6:156187294-156187316 ATAGGTAATTATAATACAGTGGG + Intergenic
1020646827 7:10824815-10824837 GTAGTAAATGTTAATATTGTAGG + Intergenic
1024923170 7:54582503-54582525 GTAGGGGATGTTAATAGTGTGGG + Intergenic
1028717365 7:93986881-93986903 GTAGGCAATTGTAACACAGTGGG - Intronic
1028766410 7:94564712-94564734 GAAGGCCATGAAAATACTTTGGG + Intergenic
1029002643 7:97170973-97170995 GTTGGCAATGATAATAAATTTGG - Intronic
1030536808 7:110777435-110777457 GTAGGGAAAAATATTACTGTAGG - Intronic
1033546689 7:142407573-142407595 GGAGACAATGATGTTACTGTAGG + Intergenic
1033549492 7:142433839-142433861 GGAGGCAATGATGTCACTGTGGG + Intergenic
1034131370 7:148721316-148721338 GCAGGCAATTAAAATATTGTGGG - Intronic
1036965054 8:13288495-13288517 CTAGGCAAGGAAAATACTGTTGG - Intronic
1037544377 8:19903900-19903922 GTAGACAATGATAATAATGAAGG + Intronic
1042789325 8:72586127-72586149 GTAGGGAATGGAAATGCTGTAGG - Intronic
1047245234 8:123137046-123137068 GGAGGTAATCATAATATTGTTGG - Intronic
1047909673 8:129514305-129514327 GTAGACAATGATTACACTTTTGG + Intergenic
1049963800 9:760754-760776 GTAGGAGATGTTAATACTGGTGG - Intergenic
1051803688 9:20966202-20966224 GTTGGCAATGATAATAATAATGG - Intronic
1051828070 9:21243597-21243619 TTAGGCAATGAGAAGAATGTTGG - Intergenic
1052655448 9:31353062-31353084 GTAGGAAACTATGATACTGTAGG - Intergenic
1056370966 9:85953728-85953750 GTAGTCAATAATAATACTGTAGG - Intronic
1058127058 9:101207322-101207344 GAGGGCAATAATAATACTGCAGG - Intronic
1059038571 9:110787389-110787411 GATGGCAATGATAATCCTATTGG + Intronic
1203691443 Un_GL000214v1:46692-46714 GTAGTAAATGATAATATTGTAGG - Intergenic
1203710627 Un_KI270742v1:94080-94102 GTAGTAAATGATAATATTGGAGG + Intergenic
1203540428 Un_KI270743v1:83372-83394 GTAGCAAATGATAATATTGGAGG - Intergenic
1203644852 Un_KI270751v1:57499-57521 GTAGTAAATGATAATATTGTAGG + Intergenic
1187148186 X:16656732-16656754 GTAGAAAATGATGATACTGAAGG + Intronic
1187738408 X:22328226-22328248 GTAGGCAATTATAATAGTATGGG + Intergenic
1193315396 X:80059022-80059044 GTAGTAAATGAAAATATTGTAGG - Intergenic
1197073173 X:122324699-122324721 GTTGGAAATGATGATAGTGTGGG + Intergenic
1198864710 X:141109198-141109220 GTAGGCAAAGATGGTACTTTAGG - Intergenic
1198897980 X:141478210-141478232 GTAGGCAAAGATGGTACTTTAGG + Intergenic
1199211520 X:145216894-145216916 TATGGCAATGAAAATACTGTAGG - Intergenic