ID: 950978305

View in Genome Browser
Species Human (GRCh38)
Location 3:17274243-17274265
Sequence TGACCTCTGATTAAACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950978305 Original CRISPR TGACCTCTGATTAAACAAGG AGG (reversed) Intronic
901013291 1:6212940-6212962 TGACCTCTAATTAAAGAGGGAGG - Intronic
904193878 1:28769928-28769950 TGACCTCTGCAAAAGCAAGGTGG + Intergenic
904893498 1:33796987-33797009 TGACCTCAGATTTACCAGGGTGG - Intronic
905707846 1:40075582-40075604 TGACCTCTGAAATAACATGGAGG + Intronic
906423329 1:45688414-45688436 TGACCTCTGAGAAAGGAAGGCGG - Intronic
906550350 1:46661023-46661045 TGACCTATGATTCCACAATGTGG - Intronic
907238296 1:53066280-53066302 TGGCTTCTGACTAGACAAGGTGG - Intronic
907620495 1:55973043-55973065 TGACCTCAGGCTAAACATGGTGG + Intergenic
907627755 1:56047484-56047506 TGGCTTCTGACTAATCAAGGTGG + Intergenic
911831332 1:102554212-102554234 TGACCTCAGATTTACCAGGGTGG - Intergenic
912489446 1:110053849-110053871 TGACCTCTGGTTAGAAAGGGAGG + Exonic
914881820 1:151553066-151553088 TGACTTCAGATCAAGCAAGGTGG + Intronic
916423335 1:164657636-164657658 TCAACTCAGATTAAACAAGAAGG - Intronic
919301020 1:195766007-195766029 TGACCTCTGATAAAATATGGGGG + Intergenic
920281346 1:204846047-204846069 TGACTTCTGATTTAAAAATGGGG + Intronic
922897046 1:229108615-229108637 TGCACTCTGATCAAACTAGGGGG + Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1065745658 10:28839195-28839217 TGACCTATCATTCAACAAGAAGG + Intergenic
1066055377 10:31675931-31675953 TGACCTCTGTTTATACCATGAGG - Intergenic
1067918225 10:50423610-50423632 TGAACTCTTCTTAGACAAGGTGG + Intronic
1068202770 10:53804685-53804707 TGACCTCTGATTGAATTAGTAGG + Intronic
1068380398 10:56246633-56246655 TGACCTGTGGTGAATCAAGGTGG + Intergenic
1068403263 10:56557159-56557181 TGATTTCTGAATAAATAAGGCGG - Intergenic
1073133134 10:101203645-101203667 TGAAATCTGATTAAATAAAGTGG + Intergenic
1073372981 10:103007383-103007405 TGACCTCAGATTTACCAGGGTGG + Intronic
1073929760 10:108561790-108561812 TGACCTCTGCTAAAAAAAGTAGG - Intergenic
1074823068 10:117195938-117195960 TGCCCACTGACTAAGCAAGGTGG - Intergenic
1080656340 11:34261518-34261540 TTACTTCTGAGGAAACAAGGGGG + Intronic
1081086446 11:38807617-38807639 AGAGCTCTGATGATACAAGGAGG + Intergenic
1081247810 11:40790970-40790992 AGACCTCTGATTAAATAACTTGG - Intronic
1083099791 11:60291418-60291440 TGTGCTCTGATTAGAAAAGGAGG + Intronic
1088339906 11:108752238-108752260 TAACCTCAGATTAAACTTGGAGG - Intronic
1088604595 11:111515686-111515708 TGTCCTCTGGATAAACAGGGTGG - Intronic
1090407047 11:126482664-126482686 AGACCTCTGCTTTACCAAGGGGG - Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1092270558 12:7019952-7019974 TGACCTCTGAGAAAGGAAGGAGG - Intronic
1094028607 12:25985506-25985528 TTAGCTCTGTGTAAACAAGGAGG + Intronic
1098049152 12:66434962-66434984 TCTTCTCTGATTAAACCAGGTGG + Intronic
1098441700 12:70525857-70525879 TCCCCACTTATTAAACAAGGAGG + Intronic
1100878665 12:98992276-98992298 TGACTTCTGAATAATAAAGGAGG - Intronic
1102585538 12:113920275-113920297 GGACCTCTGAATAAACATGCAGG - Intronic
1108531350 13:51330120-51330142 TGAACCCTGTTTAAACTAGGTGG + Intergenic
1109118227 13:58418197-58418219 TGAACACTGATGAAACGAGGCGG + Intergenic
1110080113 13:71298957-71298979 TGACCTCAAATTAACCAAGGTGG + Intergenic
1112204588 13:97311711-97311733 TGACCTCAAAGCAAACAAGGAGG - Intronic
1117098601 14:52322574-52322596 TGACCTCAAATTAACCAGGGTGG + Intronic
1119256778 14:73205033-73205055 TGACCTCAGAAATAACAAGGTGG + Intronic
1119576810 14:75731225-75731247 TGACCTCTGATCAAACAGTAAGG + Intronic
1120994903 14:90409652-90409674 TGAACTCTGATTAAATCAAGTGG + Intergenic
1126593446 15:50362347-50362369 TGACATCTGATTCAACATGGTGG - Intergenic
1127458173 15:59173889-59173911 AGACCTCTTATTGAACAAGAAGG - Exonic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128662447 15:69512370-69512392 TGACCTCTGATGTGACCAGGAGG + Intergenic
1129344076 15:74905787-74905809 TGTCCTCTGATTAAATAAGTGGG - Intronic
1131523686 15:93136026-93136048 TGACCTCTGGTAAAACCAGCAGG - Intergenic
1131955116 15:97727286-97727308 TGACCACTGATTGATCAATGGGG - Intergenic
1132296463 15:100738416-100738438 TGTCCTCTGATAAAACTAGCTGG - Intergenic
1135826839 16:25736144-25736166 TGACCTCTGCTCAGACAACGTGG - Intronic
1137526180 16:49238365-49238387 TGAACTCTTATTAAGCAAGAAGG - Intergenic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1140094623 16:71864239-71864261 TGACCTGTGATTCAACAAATAGG + Exonic
1141373637 16:83509570-83509592 TGACCTCTGATTTAAAGAGTGGG + Intronic
1143057417 17:4172675-4172697 TGGCCTCTGATAAAACAAGTTGG + Exonic
1148078034 17:44950732-44950754 TGACCTCTTGTTAAACCAAGTGG - Intergenic
1151148325 17:72062539-72062561 AGACCTCAGTTTAAGCAAGGAGG + Intergenic
1152875130 17:82782050-82782072 CGAGCTCTAATAAAACAAGGTGG + Intronic
1156058077 18:33035188-33035210 TGACCTCTGGTTTGACAAGAGGG + Intronic
1158666854 18:59440089-59440111 TGGCCACTGATTCAAAAAGGAGG - Intronic
1158718662 18:59903105-59903127 TGACCTGTGATTAGACTGGGCGG + Exonic
1159690403 18:71480312-71480334 AGACCCCTCATTAAACAATGGGG + Intergenic
1164070781 19:21766507-21766529 TAACCTCTGATTACACAACCAGG + Intronic
1164262224 19:23577840-23577862 TAACCTCTAATTATATAAGGAGG - Intronic
925254271 2:2468872-2468894 TGACCTCTGCTTGATCTAGGTGG + Intergenic
925282428 2:2694116-2694138 GGACTTCTGGTTAAACATGGCGG + Intergenic
925522870 2:4767258-4767280 TGACCTCTGGCCAAACATGGAGG - Intergenic
926328379 2:11804833-11804855 TTACCTTTGATTGAACAAGCCGG + Intronic
929266891 2:39928498-39928520 TTTCCTCTGATTAAAAAAGGGGG - Intergenic
936068153 2:109347733-109347755 TGACCTCAAGTTCAACAAGGGGG + Exonic
936748272 2:115607982-115608004 AGACTTCTGTTTAAACATGGTGG + Intronic
937576357 2:123426867-123426889 TGACCTCTGATAACTCAAGATGG + Intergenic
937616485 2:123928843-123928865 TCACCTCTAATTAAACAAGATGG + Intergenic
938604336 2:132876629-132876651 TGACCCCTGATTACACATGCAGG - Intronic
943649892 2:190446010-190446032 TGCCCTTTGATTGATCAAGGAGG - Intronic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
1169367651 20:5003799-5003821 TGACATCTGATAAAACAGGGAGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1172055210 20:32150035-32150057 TGGCCTCTGACTACAAAAGGAGG - Intronic
1174313188 20:49675458-49675480 TGGCCTCTGAGTGAACTAGGAGG - Intronic
1174556014 20:51396278-51396300 TGAGCTCTGATAAAGGAAGGAGG - Intronic
1175499790 20:59441691-59441713 TGAGCTCTGCTTGTACAAGGTGG - Intergenic
1185017951 22:48356544-48356566 TGACCTTGGATTCAGCAAGGAGG - Intergenic
950495758 3:13333382-13333404 TGGCCTCTGATCAGACCAGGTGG + Intronic
950515061 3:13459805-13459827 TGACCCCAGATTAAACAACCTGG + Intergenic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
951428914 3:22583476-22583498 TGAACTCTGATGACACAAGGAGG + Intergenic
953724747 3:45388307-45388329 TGGCCTCAGAATAAACTAGGCGG - Intergenic
955783894 3:62515698-62515720 TTTCCTCTGTTTAAAGAAGGGGG + Intronic
960330422 3:116353102-116353124 TGACCTCTGGATAATCAGGGTGG + Intronic
960814139 3:121656157-121656179 TTATTTCTGATTAAACAATGTGG + Intronic
961256084 3:125554175-125554197 TAGCCTCTGGATAAACAAGGTGG + Intronic
961404550 3:126668880-126668902 TGGCCTCTGATCAGACCAGGTGG - Intergenic
961553426 3:127681633-127681655 TGACCTATAGTCAAACAAGGTGG + Intergenic
966260674 3:177974918-177974940 TGACCTCTGTTAAACTAAGGTGG - Intergenic
971013652 4:22465418-22465440 TGACCTCTTATCAAACCAGTGGG - Intronic
972513125 4:39788116-39788138 GGACTTCTGATTAAACATGGTGG + Intergenic
974412652 4:61562282-61562304 TGGCTTCTGATTAATCAGGGTGG + Intronic
975307677 4:72867627-72867649 TGACCTCAAATTCACCAAGGTGG + Intergenic
976737906 4:88329112-88329134 TGACCTATAATCAGACAAGGTGG + Intergenic
978769375 4:112438198-112438220 AGACCTCTGGTAAGACAAGGGGG - Intronic
978819014 4:112943962-112943984 TGACCTCAGACTAAACAAAATGG + Intronic
978826485 4:113030273-113030295 TGATATCTTCTTAAACAAGGTGG + Intronic
980236896 4:130119647-130119669 TGACCTCAGATTACACTACGAGG + Intergenic
981550776 4:145938430-145938452 TGATCTCACATTAACCAAGGAGG - Exonic
982030499 4:151295683-151295705 TGCCCACTGATTAGAAAAGGAGG + Intronic
984829751 4:183961409-183961431 TGACCTCACATAAAGCAAGGTGG - Intronic
990841486 5:60084734-60084756 TGACTGCTGACTAACCAAGGCGG - Intronic
994165136 5:96600297-96600319 AGAAATCTGATTAAACAAGGAGG - Intronic
994516818 5:100782647-100782669 TGACTTCTGATTCATCAGGGTGG + Intergenic
996116547 5:119626745-119626767 TTACCTCTGAGTCAAGAAGGAGG - Intronic
998695952 5:144639765-144639787 TGATCTCTGATTCAAAAAGATGG + Intergenic
999410344 5:151344883-151344905 TGACTTCTGAATAAACAGGTCGG + Intronic
1005477265 6:26219956-26219978 TGACCTGCAATTAAACAAGGTGG - Intergenic
1006205938 6:32342951-32342973 TGACTTCTGAAGAAATAAGGGGG + Intronic
1008951935 6:57171325-57171347 TGATCTCTGATTAAAGGTGGTGG + Intergenic
1009766161 6:68078788-68078810 TTAACTCTGCTTAAACAAGAAGG + Intergenic
1012031925 6:94080939-94080961 TAACCTCTGATTAAAAAAACAGG + Intergenic
1013489524 6:110632311-110632333 AGACCTCTGGTTAAAAAGGGAGG - Intronic
1018139907 6:160820923-160820945 TGACCTCAGATTTACCAGGGTGG - Intergenic
1018237280 6:161738774-161738796 TGACTTCTGATTTAAGTAGGTGG - Intronic
1019654429 7:2182591-2182613 TGAGCTCTGATGACACAATGGGG + Intronic
1021017790 7:15556617-15556639 TGAGTTCTGCTTAAACAAGCAGG + Intronic
1021091462 7:16487508-16487530 CGACATCTGAGTAAAGAAGGGGG - Intronic
1023504340 7:40884598-40884620 TGACCTCTGCTTGAAAAATGCGG - Intergenic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1037247111 8:16847347-16847369 TGACCTCTCATTAATTTAGGAGG - Intergenic
1037536606 8:19830389-19830411 TGAACTCTGCTTAAAGAATGTGG - Exonic
1038596865 8:28894729-28894751 TGACCTTAGATGAAACAAGTTGG + Intronic
1039183116 8:34888515-34888537 TGACCTCAAATTTACCAAGGAGG + Intergenic
1039619732 8:38985550-38985572 TGCCCTCTGATTTCACTAGGGGG - Intronic
1044385032 8:91577972-91577994 GGACATCTGATTAAACAGGGAGG + Intergenic
1051135102 9:13911183-13911205 TGACCTCAGAATGAAGAAGGTGG - Intergenic
1060245298 9:121940863-121940885 TCAACTCTAATTAAACAAAGAGG + Intronic
1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG + Exonic
1186834136 X:13420553-13420575 TGACCTCTAACTAAAAATGGTGG + Intergenic
1192709039 X:73560883-73560905 TGACATCTGACTAAACATGAGGG + Intergenic
1193623215 X:83782968-83782990 TGACCTCAGATTTACCAGGGTGG - Intergenic
1193903633 X:87216217-87216239 TGCCCTCTGCTTACACAGGGAGG - Intergenic
1194912244 X:99660561-99660583 AGTCCACTGCTTAAACAAGGTGG - Intergenic
1198024927 X:132695515-132695537 TGCCCTCAGATTAAACTATGGGG + Intronic
1202276906 Y:23131973-23131995 TGACCTCTGAATATACATGTTGG - Intronic
1202289122 Y:23288716-23288738 TGACCTCTGAATATACATGTTGG + Intronic
1202429898 Y:24765687-24765709 TGACCTCTGAATATACATGTTGG - Intronic
1202440894 Y:24904400-24904422 TGACCTCTGAATATACATGTTGG + Intronic