ID: 950980123

View in Genome Browser
Species Human (GRCh38)
Location 3:17294642-17294664
Sequence CATTGCATGCAGTGACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950980123_950980127 28 Left 950980123 3:17294642-17294664 CCATCCAGTCACTGCATGCAATG 0: 1
1: 0
2: 1
3: 11
4: 132
Right 950980127 3:17294693-17294715 AGATATCCAGAGACTATGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950980123 Original CRISPR CATTGCATGCAGTGACTGGA TGG (reversed) Intronic
905813252 1:40928617-40928639 CATGGCATTGAGTGACTGGGTGG - Intergenic
906146484 1:43563746-43563768 CAGTGTCTGTAGTGACTGGAAGG + Intronic
907781519 1:57571414-57571436 AATTACATGCAGTGAATAGAGGG - Intronic
920534602 1:206729429-206729451 GATTGAATGCAGATACTGGATGG - Exonic
921055432 1:211539134-211539156 CATTGCAACCAGAGAATGGAGGG + Intergenic
921836730 1:219785969-219785991 CATCACATGCAGTGACAAGAGGG + Intronic
923852558 1:237813215-237813237 CATTGCCTGCAGTGACTTCCAGG + Intronic
1063037242 10:2298571-2298593 CATTTCAGGCAGTGAAGGGAAGG - Intergenic
1063508272 10:6621707-6621729 CAGAGCATGCAGTGACTGAGAGG + Intergenic
1068722504 10:60261736-60261758 CATAGCCTTCACTGACTGGAAGG + Intronic
1069919530 10:71808046-71808068 CAGTCCATGCAGTGACTGAGAGG - Intronic
1075570298 10:123536772-123536794 CTTTGGATCGAGTGACTGGAAGG + Intergenic
1076371967 10:129961103-129961125 AATTGCATGCAGAGAGTGGGAGG + Intronic
1078713555 11:13817911-13817933 CATTGGCTCCAGTGACAGGAGGG + Intergenic
1080419553 11:32097802-32097824 CAATGCATGCAGTAATGGGAAGG + Intronic
1080605029 11:33858304-33858326 CATTGTATGGAGTGAGTGGAAGG - Intergenic
1081172294 11:39883875-39883897 CATTCCAAGCAGTGAGTAGAGGG + Intergenic
1081971598 11:47202811-47202833 CACTGGATGCAGTGACTGTGTGG - Intergenic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1089208401 11:116783923-116783945 CATTGGATGCAGTGGATGAAAGG - Intronic
1090261971 11:125327723-125327745 AATTGCTGGCAGTGACAGGAAGG + Intronic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1098588294 12:72182036-72182058 TAATGCATTCAGTGACAGGATGG - Intronic
1098604127 12:72369694-72369716 AATGGTATGCAGGGACTGGAGGG - Intronic
1098777083 12:74634430-74634452 CATAGAATTCAGAGACTGGATGG - Intergenic
1100084188 12:90887525-90887547 AACTAGATGCAGTGACTGGATGG + Intergenic
1100744480 12:97630526-97630548 GATTGCATTCAGTAACTGGCAGG - Intergenic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1105529917 13:21209801-21209823 TCTTGGAAGCAGTGACTGGATGG + Intergenic
1108279441 13:48846707-48846729 CATTGCATGGAGTGAGGGTAAGG + Intergenic
1111235274 13:85400812-85400834 CATGGGATGGAGTGCCTGGAGGG - Intergenic
1111652078 13:91103948-91103970 CATTGCATTCATTGCCTGGGGGG + Intergenic
1111660512 13:91204168-91204190 CAATGCTAGCAGTGACTGAATGG - Intergenic
1112251048 13:97780713-97780735 CATTGAGTGCTGTGCCTGGAGGG - Intergenic
1116085817 14:40236625-40236647 CATATCATGTAGTGACTGGGGGG - Intergenic
1116110561 14:40575330-40575352 CATGACATGCAGTGGCAGGACGG + Intergenic
1119654918 14:76410365-76410387 GAGTGCAGGCAGTGACTGGTAGG + Intronic
1120025877 14:79583649-79583671 AATTGCTTACAGTGACTGCATGG - Intronic
1124172087 15:27384227-27384249 CATTGCAAGCAGTGAGAAGATGG + Intronic
1125812069 15:42549965-42549987 AATGGAATGCAGTGACAGGAGGG + Intronic
1126338565 15:47614325-47614347 TATTGCCTGCCATGACTGGAGGG - Intronic
1126500024 15:49335182-49335204 CTTTGCTTGGTGTGACTGGAGGG - Intronic
1127635510 15:60865728-60865750 CAATGCAGGCTGGGACTGGAAGG - Intronic
1130758201 15:86789140-86789162 CATTGCAGGCAGTGGCTTGTAGG - Intronic
1131098660 15:89671550-89671572 CATTGGCAGCTGTGACTGGAAGG + Exonic
1131392233 15:92058867-92058889 CATTGCAGGCAGAGATTGAAGGG - Intronic
1132915816 16:2342680-2342702 AATTGAATGCAGTTACAGGATGG + Intergenic
1134290356 16:12899604-12899626 TATTTCATGTAGTGGCTGGAGGG + Intergenic
1136221985 16:28834980-28835002 CTGTGCACGCAGTGACTGGCAGG + Intronic
1137575302 16:49595554-49595576 CATTGGATGCAGGTACTGGTGGG - Intronic
1138564930 16:57826103-57826125 CATTGCCACCAGTGGCTGGAGGG + Intronic
1138910112 16:61386403-61386425 CAAGGCAGGCAGTGACAGGATGG - Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1142988251 17:3710960-3710982 CTTTGGATGCAGTTATTGGAGGG - Intergenic
1143033412 17:3980880-3980902 CATTGAATGAAGTCACAGGAGGG - Intergenic
1143892459 17:10113066-10113088 CCATGCAGGCAGTGAGTGGATGG - Intronic
1144088508 17:11832216-11832238 CATGACATGGAGTGACAGGAGGG - Intronic
1145202551 17:20959617-20959639 CCTTGCATGCTGTGAGTGGGAGG - Intergenic
1148785948 17:50146311-50146333 CATCGCCTGCAGTGACAGGTTGG + Intronic
1150319327 17:64198532-64198554 AATTGCATGCAGGGACTGTATGG - Intronic
1151643272 17:75412082-75412104 CAGTGCATGCAGTGAATAAATGG + Intergenic
1152633502 17:81421092-81421114 CACTGCAGGCAGTGCCAGGATGG + Intronic
1157870148 18:51222630-51222652 CACAGCAGGAAGTGACTGGAGGG + Intergenic
1159268397 18:66114845-66114867 CATAGCATGCTGTAACTGCATGG + Intergenic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1165825526 19:38703645-38703667 CACTGGATCCAGTGCCTGGAAGG - Intronic
925196594 2:1930950-1930972 CACTGCATACACTGACTAGAGGG + Intronic
937095399 2:119232225-119232247 GCTTGAATGCAGGGACTGGATGG + Intronic
938930578 2:136083141-136083163 CATTACATGCATTAACTTGATGG - Intergenic
942640959 2:178059872-178059894 GACGGCATGCAGTGACTGGATGG + Intronic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
948975810 2:241463214-241463236 CTTTGTAGGCGGTGACTGGAGGG + Intronic
1169340915 20:4795605-4795627 CAGTGATTGCAGTGACAGGAAGG + Intronic
1169889945 20:10441486-10441508 CATCCCATGCAGTGGCTGGTGGG + Intronic
1170732652 20:18988065-18988087 CACTGCAAACAGTGACTGGCTGG + Intergenic
1171273596 20:23835583-23835605 CAGTGGATGCAGTGCATGGAGGG + Intergenic
1173148262 20:40544087-40544109 CATGGCCTTCAGTGACTGGGCGG - Intergenic
1173183292 20:40820630-40820652 CAGGGAGTGCAGTGACTGGAAGG - Intergenic
1174341053 20:49895760-49895782 CATTAGATGGAGTGACTTGAAGG + Intergenic
1176519782 21:7815855-7815877 CATTCCCTGCTGTGTCTGGACGG + Intergenic
1177458360 21:21374617-21374639 AATTCCATGCAGTGACCAGAGGG - Intronic
1178473348 21:32914904-32914926 CATTTTCTGCAGTGATTGGAAGG + Intergenic
1178653810 21:34445868-34445890 CATTCCCTGCTGTGTCTGGACGG + Intergenic
1179722963 21:43325752-43325774 CAAGGCATGCAGTGAGTGGAAGG + Intergenic
1180032587 21:45222456-45222478 GATTGAAAGCAGTCACTGGACGG - Exonic
1182648484 22:31830047-31830069 CATAGCATACTGAGACTGGATGG + Intronic
1182650210 22:31845413-31845435 GAGTGCAGGCAGTGACTGGGTGG + Intronic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
952440035 3:33317345-33317367 AATTGGATGCAGTGAATGAATGG - Intronic
952554887 3:34520792-34520814 CACTGCATGCAGTAACTCCATGG + Intergenic
954860559 3:53685778-53685800 CGTTGAATGCAGTGCTTGGAGGG + Intronic
959807736 3:110577566-110577588 GATTGCATACTGTGAGTGGAAGG - Intergenic
968865106 4:3204334-3204356 CTTAGAATCCAGTGACTGGAAGG - Intronic
971403205 4:26295346-26295368 CAATTCATGCCGTGAATGGAAGG - Intronic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
976475946 4:85483100-85483122 CAATGCATGAAAAGACTGGAGGG + Intronic
978846265 4:113276563-113276585 CATTGTGTGCATTGAGTGGAGGG + Intronic
980302868 4:131016128-131016150 TACTGGATGCAGTGACTGGATGG + Intergenic
980692918 4:136319638-136319660 GTGTGAATGCAGTGACTGGAAGG + Intergenic
986296683 5:6445143-6445165 CATTTCCTTCAGTGACAGGATGG - Intergenic
987481175 5:18459721-18459743 CTCTGCATGAAGTGATTGGAAGG - Intergenic
989496588 5:42116183-42116205 CATTGCATGCAATAACTCCATGG - Intergenic
994300154 5:98137804-98137826 CATTGAAAGCAGTGTCTAGAGGG + Intergenic
998273048 5:140724821-140724843 GTTTATATGCAGTGACTGGAAGG + Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
999426897 5:151495905-151495927 CATTTCTTTCAGTGACTGAAGGG - Intergenic
1001687480 5:173604983-173605005 GGTTGGATGCAGTGACTAGACGG + Intergenic
1003402088 6:5799092-5799114 ACTTGGAAGCAGTGACTGGATGG - Intergenic
1006409600 6:33864960-33864982 CATTGCATGGTGTGGCTGGAGGG - Intergenic
1009513477 6:64582759-64582781 TATTCCATGCAGTGACTAGTGGG + Intronic
1010351366 6:74878936-74878958 CAATGGATGCAGTCACTGGATGG + Intergenic
1013165599 6:107588852-107588874 CATTTCTAACAGTGACTGGAAGG - Intronic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1027688702 7:81312809-81312831 CACTTCATGGAGTGACTGTAAGG + Intergenic
1028971738 7:96867104-96867126 CATAGCATGAAGTGACTGGAAGG + Intergenic
1030749210 7:113209731-113209753 CAATGCATCCTGTGGCTGGAGGG - Intergenic
1037556821 8:20033199-20033221 AATTGCATGGAGATACTGGAGGG + Intergenic
1037638746 8:20723413-20723435 CAGTCCAGGCAGTGAGTGGATGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1040481538 8:47831717-47831739 CATTGGAGGCAGTGTCTGGCAGG + Intronic
1041421872 8:57675986-57676008 CATAGGATGTAGTCACTGGAAGG + Intergenic
1043234889 8:77851702-77851724 AATTGCATGCAGTGGTTTGATGG + Intergenic
1043498197 8:80825916-80825938 CATTTAAAGCAGTGTCTGGAGGG + Intronic
1049197393 8:141323210-141323232 CATAGCTTGCAGAGAGTGGAGGG - Intergenic
1051597715 9:18842189-18842211 CATTCAAAGCAGTGACTAGAGGG - Intronic
1051966761 9:22837005-22837027 CATGCCATGCAGTGGCTGGTGGG + Intergenic
1056183363 9:84107308-84107330 CAGTGCATGCAGTGCCATGACGG + Intergenic
1061426046 9:130499111-130499133 GATGGCATGCAGTGACCTGAAGG - Intronic
1185728373 X:2441362-2441384 CATAGCATCCAGGGAATGGAAGG - Intronic
1188675020 X:32928996-32929018 AATAGCATTCAGTGACTGAATGG + Intronic
1189349181 X:40264201-40264223 CATGGTCTGCAGAGACTGGAAGG + Intergenic
1190057108 X:47187380-47187402 CATGGGTTGCAGTGACTAGAGGG - Intergenic
1190637732 X:52452677-52452699 CATTGCATGCATTCACAGGGAGG - Intergenic
1190678913 X:52807782-52807804 CATTGCATGCATTCACAGGGAGG + Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1193272818 X:79548713-79548735 CATTTGATGCAGTGTCTAGATGG + Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1193736197 X:85159715-85159737 AACTGCATGCAGTTGCTGGAGGG + Intergenic
1193834360 X:86323516-86323538 CATTGCATACAGAGAGGGGATGG + Intronic
1194802012 X:98285746-98285768 CATTGAATACAGTGACTGCATGG - Intergenic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1202021485 Y:20469151-20469173 CATTGCATCCAGAGAAGGGATGG + Intergenic