ID: 950981891

View in Genome Browser
Species Human (GRCh38)
Location 3:17315877-17315899
Sequence CCATGCCTACAGCCTTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950981891_950981896 -2 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981896 3:17315898-17315920 GGCAGAGGGCTAACTAGACGTGG 0: 1
1: 0
2: 2
3: 1
4: 59
950981891_950981899 21 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981899 3:17315921-17315943 GGTACCATATATGATTGATTTGG 0: 1
1: 0
2: 0
3: 7
4: 95
950981891_950981897 -1 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981897 3:17315899-17315921 GCAGAGGGCTAACTAGACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
950981891_950981898 0 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981898 3:17315900-17315922 CAGAGGGCTAACTAGACGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
950981891_950981900 22 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981900 3:17315922-17315944 GTACCATATATGATTGATTTGGG 0: 1
1: 0
2: 0
3: 10
4: 159
950981891_950981901 23 Left 950981891 3:17315877-17315899 CCCACTGAAGGCTGTAGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 950981901 3:17315923-17315945 TACCATATATGATTGATTTGGGG 0: 1
1: 0
2: 1
3: 23
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950981891 Original CRISPR CCATGCCTACAGCCTTCAGT GGG (reversed) Intronic
900741863 1:4335208-4335230 CTTTGCCAACAGCCTTCATTTGG - Intergenic
901355194 1:8640379-8640401 CAATGCCTGCAGCCTTCAAAGGG + Intronic
903582837 1:24385112-24385134 CCATCCCTACTGCCTTCCTTAGG + Intronic
907414813 1:54307024-54307046 CCCTGCCCACAGCCTCCAGGAGG + Intronic
908350877 1:63285857-63285879 GCATGCCTACAGTCTCCAGCTGG - Intergenic
908572311 1:65422386-65422408 GCTTCCCTACAGCCTTCAGAGGG + Intronic
908790041 1:67772098-67772120 CCATGCCTACCCCCTTCCCTGGG - Intronic
912236882 1:107861904-107861926 ACATGCATACATACTTCAGTGGG + Intronic
916845446 1:168645413-168645435 CCATGCCAACTGACTTCAGCTGG + Intergenic
920224975 1:204431839-204431861 CCTTTCCTACACCCTTCACTGGG - Intronic
920547557 1:206831047-206831069 CCATGCCTATTGCCTTCTGTGGG - Intronic
920547728 1:206832440-206832462 CCATGCCTATTGCCTTCTATGGG - Intronic
921670680 1:217920704-217920726 CCTTCCCTAGAGCCTTCAGAGGG + Intergenic
924303630 1:242665009-242665031 CCATGCCTACAGCCTAAGGGTGG + Intergenic
1063032271 10:2247589-2247611 CCTTGCCCAAAGCCATCAGTAGG - Intergenic
1063938904 10:11107464-11107486 CCATTCCTCCAGTCTTCTGTAGG - Intronic
1066327847 10:34382877-34382899 CCATGCGTACACCCATCATTTGG - Exonic
1067835203 10:49634122-49634144 CAATGCCTCCCTCCTTCAGTAGG + Intronic
1070560605 10:77563794-77563816 CCATGCATCCATCCTTCTGTGGG + Intronic
1070856439 10:79611184-79611206 CCATCCCTACAGGGTTCAGCAGG + Intronic
1074873422 10:117595643-117595665 CCATGGCTTCAGCTCTCAGTGGG - Intergenic
1075333698 10:121593908-121593930 CAATGCCTTCAGCCTGCGGTGGG + Exonic
1077586946 11:3461050-3461072 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
1079184002 11:18220486-18220508 CCAGGCCTACTGGCTGCAGTGGG + Intronic
1080139862 11:28903830-28903852 TCTTGCCTAGAGCCTTCAGAAGG - Intergenic
1084242945 11:67835082-67835104 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
1086402519 11:86472327-86472349 TCCTGCCTAAAGCCCTCAGTGGG - Intronic
1089351114 11:117822265-117822287 CCATTCCCACATCCTGCAGTGGG + Intronic
1091862657 12:3800482-3800504 CCAATCTTACAGCCCTCAGTGGG - Intronic
1092413185 12:8269795-8269817 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
1092732230 12:11545685-11545707 GCCTGCCTTCAGCCTTCATTAGG + Intergenic
1098130971 12:67349260-67349282 CCATTGCTACAGCCTTCTATTGG - Intergenic
1099574417 12:84362226-84362248 CCAGGTCCACAGCCTTCACTTGG - Intergenic
1100341671 12:93685100-93685122 TCATGCTTAAAGCCTTCTGTGGG + Intronic
1100771852 12:97932109-97932131 TCTTCCCTAGAGCCTTCAGTGGG - Intergenic
1109091668 13:58053587-58053609 CCATGTATACTGTCTTCAGTAGG - Intergenic
1112338798 13:98536272-98536294 CCAGGCCAACACACTTCAGTAGG + Intronic
1113541085 13:111110252-111110274 CCATGCCTGCAGCCTTCCCCTGG - Intergenic
1114059624 14:19007412-19007434 CCATCCCCACTTCCTTCAGTGGG - Intergenic
1114102922 14:19394339-19394361 CCATCCCCACTTCCTTCAGTGGG + Intergenic
1114149938 14:20026864-20026886 TCATCCCTAAAGCCTTCAGAGGG - Intergenic
1121021736 14:90584448-90584470 CCAGGCACACAGCCTGCAGTGGG - Intronic
1123552859 15:21399210-21399232 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1123553075 15:21400490-21400512 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1123589105 15:21836598-21836620 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1123589320 15:21837878-21837900 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1125209440 15:37196383-37196405 CCCTGCTTCCAGCCTTCAGTGGG + Intergenic
1125416857 15:39462840-39462862 CCAAGCCTACAGCCTTCCTGTGG - Intergenic
1127243730 15:57148494-57148516 CCAAACCAGCAGCCTTCAGTGGG + Intronic
1128757935 15:70195988-70196010 CCTTCCTTCCAGCCTTCAGTGGG - Intergenic
1129314185 15:74731293-74731315 CTTTGCCCACAGCCTTCAGCAGG - Intergenic
1202961208 15_KI270727v1_random:126430-126452 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1202961423 15_KI270727v1_random:127710-127732 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1133336363 16:5009089-5009111 CCCTCCCTACAGCCTTCAGAGGG - Intronic
1133338145 16:5019915-5019937 CCTCCCCTACAGCCTTCAGAAGG - Intergenic
1133354389 16:5125292-5125314 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
1135852572 16:25977882-25977904 CCCTGCCTAGAGCCCTCAGCTGG + Intronic
1138583934 16:57958473-57958495 CCATGCCACCAGCCTGCAGGTGG + Exonic
1140819367 16:78648689-78648711 CCATGTCCACAGCCTCCAATCGG + Intronic
1141432939 16:83980355-83980377 CCATTCCTACAGCCTGGAGAAGG - Intronic
1143538871 17:7558015-7558037 CCATGCCTCCAGCCCCCAGGTGG + Intronic
1145285587 17:21503855-21503877 CCAAGCCAACAGCCTCCACTCGG - Intergenic
1145391940 17:22461882-22461904 CCAAGCCAACAGCCTCCACTCGG + Intergenic
1145790213 17:27621919-27621941 CCAGGCCTACAACCTACAGAGGG - Exonic
1146754067 17:35410525-35410547 TCATGCCTAAGACCTTCAGTGGG - Intergenic
1147625381 17:41896683-41896705 CAAAGCCTCCAGCCATCAGTGGG - Intronic
1147836258 17:43334174-43334196 CCATGCCCACAGCCATCTGGAGG - Intergenic
1149300899 17:55304073-55304095 CCATCCCTACCCACTTCAGTGGG + Intronic
1149758813 17:59210447-59210469 CCAGGACTACAGCCTTCTGCAGG + Exonic
1151011692 17:70505640-70505662 TCTTCCCTACAGCCTTCAGAGGG + Intergenic
1151034522 17:70782919-70782941 CCATGGCTACAGCTCTCACTTGG + Intergenic
1152017001 17:77757269-77757291 TCTTCCCTACAGCCTGCAGTTGG - Intergenic
1152813344 17:82392576-82392598 CCACGGCCACAGCCTTCAGAGGG + Intronic
1154083548 18:11280661-11280683 CCATTCCTGCAGCCTTCAGGTGG + Intergenic
1154326258 18:13393022-13393044 GCAAGCCTACATCCTTCACTCGG - Intronic
1154453767 18:14502607-14502629 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1159292204 18:66437860-66437882 CAATCCCAACAGTCTTCAGTGGG - Intergenic
1159563167 18:70017236-70017258 GCATGGCTTCAGCCTTCCGTGGG - Intronic
1161253398 19:3293459-3293481 CCATGCCTACAGCCTCAGGGCGG - Exonic
1161646339 19:5455645-5455667 TCATGCCTGCCGCCTCCAGTGGG + Exonic
1162131223 19:8527214-8527236 CCATGCCTGTAGCCCTCTGTTGG - Intronic
1163692366 19:18744739-18744761 CCATGCCCACAGCCTTTTGGGGG + Intronic
1163752743 19:19087864-19087886 CCAGGCCAACAGCCTCCTGTGGG - Intronic
1165234477 19:34409439-34409461 TCATGCCCACAGCCTTCTGAGGG + Exonic
1168449824 19:56457656-56457678 ACAGGCCTGGAGCCTTCAGTGGG + Intronic
925273990 2:2636184-2636206 CCTTGCCCCCACCCTTCAGTCGG + Intergenic
926178938 2:10623035-10623057 CCATGCCTACTGCCTTAAATGGG + Intronic
927109295 2:19852741-19852763 CCATGCCTCCAGGCTTGTGTGGG - Intergenic
927930718 2:27041768-27041790 CCACGGCTACAGTCTTCAGGAGG - Intergenic
929773823 2:44915400-44915422 CCATGCCTCCATCCTTCCCTGGG - Intergenic
933424365 2:82091000-82091022 CCATACCAACAACCTTCAATTGG - Intergenic
934896066 2:98121355-98121377 CCATAGCTACTGCCATCAGTTGG + Exonic
936529576 2:113266513-113266535 ACATGCCTCCATCCATCAGTAGG - Intronic
937813245 2:126221942-126221964 CCATGCCAACAGCCTCCATCAGG + Intergenic
937954146 2:127410029-127410051 CCTTGCCTGCAGCCTTTAGTAGG + Intergenic
938280400 2:130059992-130060014 CCATCCCTGCTTCCTTCAGTGGG + Intergenic
938281116 2:130064322-130064344 CCATCCCTGCTTCCTTCAGTGGG + Intergenic
938281555 2:130067066-130067088 CCATCCCTGCTTCCTTCAGTGGG + Intergenic
938331984 2:130454434-130454456 CCATCCCTGCTTCCTTCAGTGGG + Intergenic
938332177 2:130455608-130455630 CCATCCCTGCTTCCTTCAGTGGG + Intergenic
938358027 2:130667405-130667427 CCATCCCTGCTTCCTTCAGTGGG - Intergenic
938477979 2:131633676-131633698 CCATCCCTGCTTCCTTCAGTGGG - Intergenic
938672426 2:133598867-133598889 TCTTCCCTAGAGCCTTCAGTAGG - Intergenic
939187448 2:138877782-138877804 CCTTGCCTCCAGCATTCAGGTGG - Intergenic
940001894 2:148974992-148975014 CCATGTCCAAAGCATTCAGTTGG + Intronic
940825128 2:158402558-158402580 CCATTACTCTAGCCTTCAGTTGG + Intronic
942657174 2:178226104-178226126 CCATGACTAGAGCTCTCAGTGGG - Intronic
942980851 2:182079745-182079767 TCTTCCCTACAGCCTTCAGTGGG - Intronic
943719716 2:191191102-191191124 CCATGCCAATAGCCTCCAGTTGG - Intergenic
944258065 2:197645256-197645278 CATTGCCTACAGTATTCAGTCGG + Intronic
948030212 2:234811566-234811588 CCTTCCCTACAGCCTACAGAGGG + Intergenic
948266495 2:236638842-236638864 GCACTCCTACAGCCTTCAGGAGG - Intergenic
948336738 2:237214212-237214234 CCATGTCTACTGTCTTCAGCAGG - Intergenic
1169462391 20:5807031-5807053 CCATGCCCACTGCTTTCAGCTGG + Intronic
1170682827 20:18542052-18542074 TCATGCCTAAACACTTCAGTAGG + Intronic
1171970478 20:31561965-31561987 CCATGCCTGCTGCCTTCATCAGG + Intronic
1173794509 20:45849867-45849889 CCATGCCAACAGCCTGCAATGGG - Intronic
1173883163 20:46434306-46434328 CCATGCCTATAGACTTCTTTGGG - Intergenic
1175455327 20:59108393-59108415 CCTTCCCCACAGCCTTCAGAGGG - Intergenic
1175667194 20:60870791-60870813 CCAAGCTTGCAGCCTGCAGTTGG - Intergenic
1176820413 21:13650698-13650720 CCATCCCTACTTCCTTGAGTGGG - Intergenic
1178003193 21:28187326-28187348 CCATGGCTACAGTATTGAGTTGG - Intergenic
1179145801 21:38766368-38766390 CCTTCCCTACAGTCTTCAGAAGG + Intergenic
1180478104 22:15730024-15730046 CCATCCCCACTTCCTTCAGTGGG - Intergenic
1180600097 22:17009848-17009870 CCATGACTGCAGCCTGCAGAGGG - Intergenic
1180643141 22:17315652-17315674 CCATGCCTCAACCCTTCACTTGG - Intergenic
1181798409 22:25327214-25327236 CCAGGCCAGCAGCCCTCAGTCGG + Intergenic
1184895254 22:47402932-47402954 CCCTGGCCACAGCCTTCAGTGGG + Intergenic
1184997313 22:48217769-48217791 CCTTCCCTACAGGCTTCAGAGGG + Intergenic
949389316 3:3541728-3541750 GCTTCTCTACAGCCTTCAGTAGG - Intergenic
950437244 3:12987266-12987288 CCCAGCCCACAGCCTGCAGTTGG + Intronic
950981891 3:17315877-17315899 CCATGCCTACAGCCTTCAGTGGG - Intronic
953251256 3:41247280-41247302 CCAGGCCTGGGGCCTTCAGTGGG + Intronic
954421260 3:50420247-50420269 CCATGCATGGAGCCTTCAGCTGG - Intronic
958738518 3:98039475-98039497 CCATGCCTAGAGCAGCCAGTAGG + Intergenic
961295157 3:125878718-125878740 TCATCCCTAGAGCCTTCAGAGGG + Intergenic
961890743 3:130128444-130128466 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
962946438 3:140174939-140174961 CCTTTCCTAGAGCCTTCAGAGGG - Intronic
964305546 3:155335744-155335766 CCATGGCTCCAGCTTTCAGCTGG + Intergenic
966334949 3:178857479-178857501 CCATGCCTATTGCCTTGAATCGG + Intergenic
969002128 4:3990859-3990881 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
969751875 4:9117651-9117673 TCATCCCTAGAGCCTTCAGAGGG + Intergenic
972581621 4:40400190-40400212 CCATGACTGGAGCCTTCAGCTGG - Intergenic
973758392 4:54096591-54096613 CCCTGCCTGCAGCCTCCATTTGG + Intronic
976101048 4:81564340-81564362 ACAAGTCTACAACCTTCAGTAGG + Intronic
977704559 4:100056873-100056895 CCATGGTTACAGCATTCTGTGGG - Intergenic
978796782 4:112715777-112715799 CCATGCCTTCCTCATTCAGTAGG - Intergenic
986485278 5:8229751-8229773 CCTTGCCCAGAGCCTGCAGTTGG - Intergenic
991186086 5:63809590-63809612 CCCAGCCTCCAGCCTCCAGTAGG + Intergenic
991302183 5:65139609-65139631 CCCTTCCTCCACCCTTCAGTAGG + Intergenic
996990800 5:129628294-129628316 CCCACCCTCCAGCCTTCAGTAGG - Intronic
997650307 5:135512597-135512619 CAAGGCCTACAGCCTTCAGCAGG + Intergenic
997810026 5:136957921-136957943 CCATGCCAATAGCCTCCAATAGG - Intergenic
1001678869 5:173541408-173541430 CCATGCCTACCGGGTGCAGTAGG + Intergenic
1005275414 6:24211733-24211755 CCTTGCCTAGAGCCTCCAGAAGG + Intronic
1006293836 6:33160993-33161015 CCAGGCCCACAGCCTTCTCTTGG - Intergenic
1007338264 6:41171003-41171025 CCATGGCTCCAGCCCTCACTTGG + Intergenic
1010408124 6:75528825-75528847 GCATGCCTCCAGCCTTTAGGGGG + Intergenic
1013041500 6:106438446-106438468 CCTTCCCTAGAGCCTTCAGAAGG - Intergenic
1014028820 6:116678718-116678740 CCATGCCAACAGCCTTGAATTGG - Intergenic
1014760305 6:125348913-125348935 CCTTCCCTAGAGCCTTCAGAGGG + Intergenic
1015661650 6:135581921-135581943 CTATACCTTCAGCCTTCTGTAGG + Intergenic
1016911171 6:149200660-149200682 CCCTACCAACAGCCTTCAATTGG + Intergenic
1017657347 6:156642602-156642624 CCATGTCTTCAGCCTGCAGATGG - Intergenic
1017823658 6:158066174-158066196 CCATGGCTTCTGGCTTCAGTTGG + Intronic
1017941848 6:159060369-159060391 CTATGCCTGCTGCCTTCTGTGGG + Intergenic
1020565672 7:9791995-9792017 TCTTCCCTACAGCCTTCAGAAGG + Intergenic
1022407020 7:30099970-30099992 CCCTCCCTAAAGCCTTCAGAGGG - Intronic
1023515377 7:40996504-40996526 ACATTCCTTCAGCCTTCAGTAGG - Intergenic
1024529151 7:50376359-50376381 CCGTGCATTCAGCCTTGAGTGGG - Intronic
1026895850 7:74009717-74009739 CCACGCCTACAGCAAACAGTGGG + Intergenic
1029506184 7:100965413-100965435 CCCTGCCCACAGGCTTCAATGGG - Intronic
1033862486 7:145644835-145644857 CCATGACTACAGCCTCTACTGGG + Intergenic
1036854458 8:12230067-12230089 TCATCCCTAGAGCCTTCAGAGGG - Intergenic
1038041668 8:23728494-23728516 CCTTCCCCACAGCCCTCAGTTGG + Intergenic
1039176848 8:34818152-34818174 TCCTGCCTAGAGCCTTCAGAGGG + Intergenic
1040415562 8:47191764-47191786 CTCCGCCTACATCCTTCAGTGGG - Intergenic
1040755582 8:50770506-50770528 CCCAGCCCACACCCTTCAGTGGG - Intronic
1040802533 8:51358866-51358888 CCAGGCCTGCAGCCTTTAGGAGG - Intronic
1043520454 8:81039475-81039497 CCTTGCCTAGAGCCATCAGAGGG + Intronic
1045910784 8:107407136-107407158 CCATGCATATGGCCCTCAGTAGG + Intronic
1049734730 8:144198987-144199009 CCATGCCTACAGCATGCAGCGGG - Intronic
1057055617 9:91958378-91958400 CCCTCCCTAGAGCCTTCAGAGGG + Intergenic
1057204038 9:93160105-93160127 CGATGCCTACAGCCGCCAGCAGG + Intergenic
1057480896 9:95444917-95444939 CCCTGCCTACATCTTTCAGTGGG + Exonic
1058449185 9:105080300-105080322 CCATGCCTACCACCAGCAGTGGG + Intergenic
1059763579 9:117362401-117362423 TCTTGCCTGCAGCTTTCAGTTGG + Intronic
1062165039 9:135103420-135103442 CTGTGCCTACAGCCAGCAGTTGG + Intronic
1203526837 Un_GL000213v1:98223-98245 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1203526957 Un_GL000213v1:98862-98884 CCATCCCTACTTCCTTGAGTGGG + Intergenic
1186610078 X:11130431-11130453 CCTTCCCTAGAGCCTTCAGAGGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187578177 X:20580025-20580047 CCTTCCCTAGAGCCTTCAGAGGG - Intergenic
1190756640 X:53407261-53407283 CCACCCCTACAACCTTCAGGAGG + Intronic
1191861785 X:65671560-65671582 CCCTGCCTACAGACTTAAGTGGG + Intronic
1192351768 X:70361803-70361825 GCATGCCTACATACTTCACTGGG + Intronic
1193234893 X:79094753-79094775 TAATGCCTACAGCCTTCTTTGGG - Intergenic
1194763226 X:97818565-97818587 CCATGCCGACAGCCTCCAGAAGG - Intergenic
1196029697 X:111083289-111083311 CCATGGCTACTGGTTTCAGTTGG + Intronic
1198307710 X:135399332-135399354 CCATAACTACAGCTTTCACTGGG - Intergenic
1199236213 X:145497354-145497376 GCATCACTACAGCCTCCAGTAGG - Intergenic
1200045683 X:153400275-153400297 CCACGCCGACAGCCTCCAGGGGG + Intergenic