ID: 950981925

View in Genome Browser
Species Human (GRCh38)
Location 3:17316127-17316149
Sequence CTGAACATGCAAATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 8, 3: 46, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950981925_950981928 -2 Left 950981925 3:17316127-17316149 CCATTGCCCATTTGCATGTTCAG 0: 1
1: 1
2: 8
3: 46
4: 284
Right 950981928 3:17316148-17316170 AGTCTTTCAACATACACCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 140
950981925_950981931 28 Left 950981925 3:17316127-17316149 CCATTGCCCATTTGCATGTTCAG 0: 1
1: 1
2: 8
3: 46
4: 284
Right 950981931 3:17316178-17316200 GCCTATGCCTGTCCCCAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950981925 Original CRISPR CTGAACATGCAAATGGGCAA TGG (reversed) Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
907726173 1:57022822-57022844 CTGTACTTGCAAATAGCCAAAGG - Intronic
908121846 1:60993255-60993277 CTGAAAAAGGAAATGGGCAGGGG + Intronic
908337501 1:63142338-63142360 CTGAACATGACAAGGGGAAAAGG - Intergenic
908788927 1:67761842-67761864 GTGATCCTGCAAATGGGAAATGG + Intronic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
913314622 1:117539511-117539533 GTGTACATGCAAATGGAGAAGGG + Intergenic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
917571924 1:176275712-176275734 CTTAACTTTAAAATGGGCAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918680758 1:187350134-187350156 CTGAACCTGTAAATGGCCTAGGG + Intergenic
919320045 1:196024689-196024711 CAAAACTTGAAAATGGGCAAAGG + Intergenic
919754616 1:201059033-201059055 CTGAAGGTGGAAGTGGGCAAAGG + Intronic
920211868 1:204334177-204334199 GTGAACATGCTTCTGGGCAAGGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920673661 1:208024068-208024090 CAGAGGATGCTAATGGGCAATGG - Exonic
921809126 1:219491793-219491815 CTAAAAGTGCAAATGGGCAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922392074 1:225154951-225154973 ATCAACAGGAAAATGGGCAAAGG + Intronic
922655265 1:227376773-227376795 CTCAATTTGAAAATGGGCAAAGG - Intergenic
922891820 1:229067589-229067611 CTGAACAGGGACAGGGGCAAGGG - Intergenic
923885697 1:238152825-238152847 CGGAACATGGAAATGGGTACAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1062952285 10:1513657-1513679 CTGAGCATGCACCTGGGCAGAGG - Intronic
1063933153 10:11049918-11049940 CTGAGCATGCACACGGGCAACGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067457293 10:46428059-46428081 CTGAAAAAGAAAATGGCCAATGG + Intergenic
1067629909 10:47956579-47956601 CTGAAAAAGAAAATGGCCAATGG - Intergenic
1068853127 10:61767721-61767743 CTAATCAAGCAACTGGGCAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071195069 10:83149265-83149287 CTGAACATGGGAACAGGCAAAGG + Intergenic
1071791645 10:88960669-88960691 CTGTACATGCCAATGGGTCATGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076189579 10:128473497-128473519 GTGAACCAGCAAATGGGCAATGG - Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1078648160 11:13161890-13161912 CAGAACATGCAAATGAGACATGG + Intergenic
1079495125 11:21034077-21034099 CTGGACATAGGAATGGGCAAAGG - Intronic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080926744 11:36765214-36765236 CTTAACATGGCAATGGGCAATGG - Intergenic
1085581541 11:77655239-77655261 CTGATCATAAAAATAGGCAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086941003 11:92798541-92798563 ATGAAAATGGAAATGGGCAATGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1089699767 11:120237583-120237605 TTGCACATGAAAAAGGGCAACGG + Intronic
1091405918 12:209546-209568 GTGAAGATGAAACTGGGCAATGG - Intronic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1091959657 12:4682665-4682687 CTGATCATGCTATTGGGGAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095484899 12:42674561-42674583 CTGAACTTGAAAACGGGCAGTGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1100232593 12:92623645-92623667 TTGAACATGCAAATTAGAAAAGG - Intergenic
1100675176 12:96858557-96858579 CTGGACATGGGAATGAGCAAAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105356772 13:19665867-19665889 CTGAACCTGCAAATGTACGATGG - Intronic
1105790542 13:23793906-23793928 AGGAACTTGCAAGTGGGCAAAGG + Intronic
1106268386 13:28130601-28130623 ATGAACAAGAACATGGGCAAAGG - Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108598531 13:51970953-51970975 CTGGAAATCCAAATAGGCAATGG - Intronic
1108902995 13:55435877-55435899 GTGTACATGCAAATGTGCAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1110301893 13:73938368-73938390 CTGAACCTGGAAATGTGCTATGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114752079 14:25216279-25216301 CTGAAGATGGAAATAGGGAAGGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1117934344 14:60885579-60885601 CTCAACTTAAAAATGGGCAAAGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118979199 14:70702271-70702293 CTGAACATGTAAATATGCACAGG - Intergenic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119960583 14:78851335-78851357 CTGAACTTGAAATTGGGCAGAGG + Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1126018021 15:44372211-44372233 CTGAACATGGGAATGGGGCATGG - Intronic
1126019449 15:44385858-44385880 CCCAACATAAAAATGGGCAAAGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1126666404 15:51079179-51079201 CAGAAAATGCAAAAGTGCAAGGG - Intronic
1127283907 15:57516198-57516220 CTGCCCATGCAAATGGGGCAGGG + Intronic
1127641540 15:60920394-60920416 CTTCACATACAAATGGGCATAGG - Intronic
1129329846 15:74821390-74821412 CTGCACAAGCAAATGCGCACGGG + Intronic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131631334 15:94179754-94179776 GTTGACATGCAAATGGCCAATGG + Intergenic
1132222868 15:100117989-100118011 CTGAACATGGAAAATGGCAAAGG - Intronic
1134037642 16:11043517-11043539 CTCAAAATGAAAATGGGGAAAGG - Intronic
1134872764 16:17666771-17666793 CTGGAAATGGGAATGGGCAAGGG - Intergenic
1135171106 16:20184442-20184464 ATGGACATACAAATGTGCAAAGG + Intergenic
1135524393 16:23203024-23203046 CTAAACATGCAAATGTTTAAGGG + Intronic
1136061197 16:27727650-27727672 CTGAAAATGCAAATGGTCATAGG - Intronic
1138443262 16:57047528-57047550 CTGAGGCTGCAAAGGGGCAATGG - Exonic
1138712678 16:58986854-58986876 CTGAAGATGTACATGGGCACTGG - Intergenic
1138792350 16:59920751-59920773 CTGAACATAAAAACAGGCAATGG - Intergenic
1138956285 16:61974315-61974337 CTTACCATGCAAATGGGAATGGG + Intronic
1140177616 16:72679362-72679384 CCCAACTTTCAAATGGGCAAAGG + Intergenic
1141977315 16:87525540-87525562 CAGAACCTGCAAATGAGCCAGGG - Intergenic
1143306326 17:5949961-5949983 CAGAACATGCAAAGGGGCTGAGG - Intronic
1143894976 17:10128575-10128597 CTGAAAATGAAAACAGGCAAGGG - Intronic
1144622788 17:16829146-16829168 CTGAACATGGCAATGGCCATGGG + Intergenic
1144883643 17:18443570-18443592 CTGAACATGGCAATGGCCATGGG - Intergenic
1145148585 17:20500816-20500838 CTGAACATGGCAATGGCCATGGG + Intergenic
1146222846 17:31040393-31040415 CTAAACTTGCAAAAGGGAAATGG - Intergenic
1146342153 17:32029618-32029640 CTAAACTTGCAAAAGGGAAATGG + Intronic
1146350653 17:32089974-32089996 CTAAACTTGCAAAAGGGAAATGG - Intergenic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1149131999 17:53313981-53314003 CTGAGCATGCAAATTAGCACTGG + Intergenic
1149975727 17:61263937-61263959 CTGACCATGCATGTTGGCAAGGG + Intronic
1150379380 17:64708603-64708625 CCGAACATGGAAATGGACAGAGG + Intergenic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1152934332 17:83127458-83127480 CTGAACATGCACAGGACCAAGGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1155776189 18:29765099-29765121 CTGAACGTGCAGAAGAGCAAGGG - Intergenic
1155891594 18:31277395-31277417 CTGAACATGAGATTCGGCAAGGG - Intergenic
1155912112 18:31515950-31515972 GTGACCATGCAGATGGGAAAAGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157324764 18:46660724-46660746 GTGCACATGCAAATGGTCATTGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159531802 18:69664816-69664838 CTGAACAAGAAACTGTGCAAAGG + Intronic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159899593 18:74033335-74033357 CTTAATAGGAAAATGGGCAAAGG + Intergenic
1167511815 19:49899152-49899174 CTGAACAAGCTATTGGGCAGGGG - Intronic
928189105 2:29145260-29145282 CTGAATTTGCAAGTGGGCAGTGG + Exonic
928299323 2:30111609-30111631 CTGAAAATGACCATGGGCAATGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929997908 2:46840523-46840545 CAGCACATGCAAAGGGCCAAAGG - Intronic
930912782 2:56650000-56650022 ATGCAGAAGCAAATGGGCAAGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
934130916 2:88947858-88947880 GGGAACATGCAAATGAGCAGGGG + Intergenic
934132927 2:88966820-88966842 GGGAACATGCAAATGAGCAGGGG + Intergenic
934135556 2:88992966-88992988 GGGAACATGCAAATGAGCAGGGG + Intergenic
934140340 2:89040780-89040802 GGGAACATGCAAATGAGCAGGGG + Intergenic
934146566 2:89100416-89100438 GGGAACATGCAAATGAGCAGGGG + Intergenic
934148307 2:89117899-89117921 GGGAACATGCAAATGAGCAGGGG + Intergenic
934220983 2:90082712-90082734 GGGAACATGCAAATGAGCAGGGG - Intergenic
934222700 2:90100159-90100181 GGGAACATGCAAATGAGCAGGGG - Intergenic
934234752 2:90220804-90220826 GGGAACATGCAAATGAGCAGGGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935582043 2:104764523-104764545 TTTAAAATGCAAATGAGCAATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940006347 2:149012407-149012429 TTGAACATGCAGATGGGAAGAGG + Intronic
940176121 2:150879297-150879319 CTGAACATTCAGAAGTGCAAAGG + Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941750086 2:169126260-169126282 CTGTACATAGAAATGGGAAAAGG - Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942285861 2:174415445-174415467 CCCAACATGAAAATGGGAAAAGG - Intronic
942963894 2:181866114-181866136 CTGTACGTGCAAAGGGGCAAAGG + Intergenic
943501703 2:188698394-188698416 CAGGACATACACATGGGCAAAGG - Intergenic
943655943 2:190509140-190509162 CTGGACAAGGAAGTGGGCAAAGG - Exonic
944090562 2:195905205-195905227 CTGAATATGTAAATTTGCAAAGG - Intronic
944955949 2:204809342-204809364 CTGAACATAGAAACTGGCAAAGG - Intronic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946684045 2:222249391-222249413 CTGAAGATGAAAATGGGAAAAGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946930871 2:224669099-224669121 CTGAATATGAAACTGGGGAAAGG + Intergenic
947627079 2:231626440-231626462 CTGCACCTGCCAATGGGGAAAGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170868248 20:20179948-20179970 CTGGACATAGGAATGGGCAAAGG + Intronic
1171085787 20:22236956-22236978 CTTAACTTGTCAATGGGCAATGG + Intergenic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1173556351 20:43968727-43968749 CTGAAGATGGCAATGGGAAAAGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180879469 22:19193503-19193525 CTGACCATGCTAGTGGGCACGGG - Intronic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951268919 3:20602176-20602198 CTGAACATTCCCATTGGCAATGG - Intergenic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954288034 3:49632933-49632955 CTGAAAAACAAAATGGGCAAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
957569320 3:81926011-81926033 CTGAACATGGACAAGGGCAAGGG - Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
958486850 3:94723528-94723550 CTGAACATGGAAAATGGAAAGGG - Intergenic
959337936 3:105089691-105089713 ATAACCATGCAAATGGGAAAGGG + Intergenic
959568121 3:107853415-107853437 CTGAAAATGCAAATGGGGCTGGG - Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
961989193 3:131169202-131169224 ATAAACATGTATATGGGCAAGGG - Intronic
964689089 3:159429984-159430006 CTGAACATGGGACTGAGCAAAGG + Intronic
964901599 3:161665570-161665592 CATGACATGCAAATGGGTAAAGG - Intergenic
965187126 3:165479271-165479293 CAGAACATGCAACTAAGCAAAGG - Intergenic
967081714 3:186055698-186055720 CTAAAGATTCAAATGGGAAAAGG - Intronic
967095879 3:186176840-186176862 CTGGAGGTGCAAAGGGGCAAAGG + Intronic
969281936 4:6176670-6176692 CTGAACATGCAAAAGGACCCAGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
977177384 4:93834082-93834104 TTGAACTTTCAAATGGGCAAAGG - Intergenic
977902213 4:102435809-102435831 CCCAATATGAAAATGGGCAAAGG + Intergenic
978751992 4:112260118-112260140 CTGAACATGGAAATGACCCAGGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
979518919 4:121643588-121643610 CAGAAAATGGAAATGGGAAAAGG - Intergenic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
985558634 5:570362-570384 CAGACCAGGAAAATGGGCAAGGG - Intergenic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
988783370 5:34543599-34543621 GTGAACCTGCAAGAGGGCAAAGG - Intergenic
991117676 5:62972794-62972816 CTGAAGATGGATGTGGGCAAAGG - Intergenic
993222846 5:85124180-85124202 GATAACATGCAAATGGCCAATGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995705526 5:114985419-114985441 CTGCAGATGCCAATGGGGAAAGG - Intergenic
995860384 5:116634696-116634718 CTGAACGTATAAGTGGGCAAGGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996799096 5:127382766-127382788 CTGAACTTTAAAATAGGCAAAGG + Intronic
998168693 5:139859412-139859434 ATGAACATGGAAATGGGGAATGG + Intronic
998788469 5:145738562-145738584 CTGAACATCAGAATGGGGAAAGG + Intronic
998924469 5:147106731-147106753 CTGAACATGAACATGTGCTATGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999672823 5:153972597-153972619 CTGAAGATCCAAGTGGGGAAAGG + Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1001800460 5:174539243-174539265 AATAAGATGCAAATGGGCAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003897911 6:10624832-10624854 CTGAGAATGCAAAAGAGCAAGGG - Intronic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008894810 6:56540754-56540776 CAAAACATGTAAATGGTCAAAGG - Intronic
1009227577 6:61033010-61033032 CATAACATGCAAATGGGGACAGG - Intergenic
1009764124 6:68047296-68047318 CTGAACACAGGAATGGGCAAAGG - Intergenic
1010185295 6:73136966-73136988 CTGAGCATGTTAATGGGCAATGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012365289 6:98431744-98431766 ATGATCATGGAAATGGGCAGTGG + Intergenic
1012527793 6:100198327-100198349 CTAAACATGGAAAGGAGCAACGG + Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016941894 6:149489262-149489284 CAGAATAGGAAAATGGGCAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019303264 7:319930-319952 TTCAACTTGAAAATGGGCAAAGG + Intergenic
1021135372 7:16958975-16958997 CTGGACATAGGAATGGGCAAAGG - Intergenic
1021706839 7:23376117-23376139 CTCCACTTGCAAAAGGGCAAAGG + Intronic
1023843782 7:44110113-44110135 CTCAACATGCAGGTGGGCATTGG + Exonic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024756904 7:52544162-52544184 GAGAACATTCACATGGGCAAGGG - Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030448051 7:109672326-109672348 CTGAACATGCTTCTGGACAAAGG + Intergenic
1032130878 7:129226015-129226037 CTGAATATGTAAAAGGGTAATGG + Intronic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032884931 7:136127193-136127215 CTGAACATGAACATAGGGAAGGG + Intergenic
1033109375 7:138561069-138561091 ATGAACATGCAATGTGGCAAAGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035131248 7:156656039-156656061 CTGAACATGGAAATGATCACTGG - Intronic
1036582594 8:10089463-10089485 CTGACCATGGGAATGTGCAATGG - Intronic
1037791893 8:21951597-21951619 CTGAACATGCAAATCAGAAAAGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041282869 8:56229084-56229106 CTGAACATGACAAGGGGCAGGGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047104075 8:121713918-121713940 CTGCACAGGCAAATGGACAGAGG + Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1050609277 9:7334586-7334608 CTTAATGTGCAAATGGGCCACGG + Intergenic
1050767425 9:9152142-9152164 CAGTGCATGCAAATGTGCAAGGG - Intronic
1050786224 9:9405291-9405313 CTGAACATGGAAAATTGCAATGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051370746 9:16356863-16356885 GTGCACCTGGAAATGGGCAATGG + Intergenic
1051666241 9:19469404-19469426 ATGAACATGCAAACGGGGACAGG + Intergenic
1051712401 9:19945470-19945492 ATGAACATGGAAAAGGGGAAAGG - Intergenic
1051748029 9:20314149-20314171 CACAACAGGAAAATGGGCAAAGG + Intergenic
1051863065 9:21648558-21648580 CTGAACCAGGAAATGGGCAAAGG - Intergenic
1052029270 9:23609977-23609999 CTGAGCAAGCAAAGGGGCAAAGG - Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056885687 9:90441700-90441722 CTCATCCTGGAAATGGGCAAAGG - Intergenic
1058372207 9:104282804-104282826 GTTAGCATGAAAATGGGCAATGG - Intergenic
1058418008 9:104808040-104808062 CTGAACATTCAAAAGGGGATTGG + Intronic
1059017462 9:110535084-110535106 CTGGACATAGGAATGGGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061175497 9:128993628-128993650 CAGAGCATGCAAAAAGGCAATGG - Exonic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061755704 9:132810957-132810979 CTTAACTGGAAAATGGGCAAAGG + Intronic
1062012618 9:134275180-134275202 CTGAACATGCAAACAGCAAATGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188542222 X:31263547-31263569 CTTAACTCACAAATGGGCAATGG - Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191739345 X:64420172-64420194 CTGAACATAGAAACTGGCAAAGG - Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192383493 X:70640772-70640794 CTGAACATGGAAAGGAACAACGG + Intronic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195275961 X:103281021-103281043 CTGGACATAGAAATGGGCACAGG - Intergenic
1195579056 X:106481098-106481120 CTGAGCATGAAAAGGGGCATGGG + Intergenic
1196516071 X:116613626-116613648 CTCAACTTGAAAGTGGGCAAAGG + Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1201190685 Y:11439902-11439924 CTGAAGATGGGAAAGGGCAAGGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201541747 Y:15112315-15112337 CAGAACATGAAAGTGGACAAGGG + Intergenic