ID: 950984646

View in Genome Browser
Species Human (GRCh38)
Location 3:17348416-17348438
Sequence TGGTGGAAATGCAGAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 1, 2: 12, 3: 142, 4: 635}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950984646_950984650 4 Left 950984646 3:17348416-17348438 CCTGGGGTTCTGCATTTCCACCA 0: 1
1: 1
2: 12
3: 142
4: 635
Right 950984650 3:17348443-17348465 TGCAGGTGACGCAGTGTTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950984646 Original CRISPR TGGTGGAAATGCAGAACCCC AGG (reversed) Intronic
900795990 1:4708728-4708750 TGGTGGCAATGCAGAGCCTGGGG + Intronic
901451720 1:9340064-9340086 TGCTGGAAATGCAGAGTCTCGGG - Intronic
901682017 1:10918626-10918648 TGTCAGAAATGCAGAATCCCAGG - Intergenic
901840019 1:11948350-11948372 TTGTGGAAATGCTGATCCCGAGG - Intronic
902168565 1:14592521-14592543 TTGTGAAAATGCAGAAGCCCAGG - Intergenic
902556267 1:17248705-17248727 TGGTGAAAATGCGGATTCCCAGG - Intergenic
904683610 1:32245626-32245648 TGGTAGAAATGCAGATTACCAGG + Intergenic
906124489 1:43419318-43419340 TGTTTGAAATGCAGAATCTCAGG + Intronic
906223943 1:44105771-44105793 TGTTAGAAATGCAGAATCCCTGG - Intergenic
907032439 1:51185747-51185769 TGTTGGAAATGCAGAATTTCAGG + Intergenic
907475298 1:54701379-54701401 AGGTGGAAATGCAGCCCCCAAGG - Intronic
907818186 1:57940615-57940637 TGTTGGAAAGGCAGAATCTCAGG - Intronic
907923621 1:58935671-58935693 TGGAGGAAATGCAGAAAGGCTGG - Intergenic
907938589 1:59065360-59065382 TGTTAGAAATGCAGAATCTCAGG + Intergenic
908153788 1:61331392-61331414 TGGTGGATATGCAGTGCCACAGG + Intronic
908799921 1:67869031-67869053 TGTTAGAAATGCAGAATCTCAGG - Intergenic
909056110 1:70823111-70823133 AGGTGGAAATATAGAAGCCCAGG - Intergenic
910159352 1:84256807-84256829 TGGTGGGAAAGCAGAAGCCAGGG + Intergenic
910232402 1:84999274-84999296 TGCTAGAAATGCAAAACCTCAGG - Intronic
910440280 1:87244753-87244775 TGGAGGAACTGCAGAAACCATGG - Intergenic
911263407 1:95714569-95714591 TGTTAGAAATGCAGAATCTCAGG - Intergenic
911599156 1:99829510-99829532 TGTTAGAAATGCAGAATCTCAGG - Intergenic
912416668 1:109513039-109513061 TGCTGGAAAAGCAGAATCTCAGG - Intergenic
914926277 1:151891114-151891136 TGTTGGAAATGCAGAATCTCAGG + Intronic
915263839 1:154700263-154700285 TGTTAGAAATGCAGAATCTCAGG - Exonic
916213419 1:162376088-162376110 TGTTAGAAATGCAGAATCTCAGG - Intronic
916309969 1:163386989-163387011 TGCTAGAAATGCAAAATCCCAGG - Intergenic
916357635 1:163931041-163931063 TGTTGGAAATGCAGAATTTCAGG - Intergenic
916520985 1:165563337-165563359 TGTTAGAAATGCAGAATCTCAGG - Intronic
916658568 1:166899977-166899999 TGCTAGAAATGCAGAATCTCAGG + Intergenic
916811626 1:168310453-168310475 TGGTAGAAATGCAGAATCTCAGG - Intronic
917265406 1:173215953-173215975 TGTTAGAAAAGCAGAATCCCAGG + Intergenic
917386282 1:174479169-174479191 TGTTAGAAATGCAGGACCTCAGG - Intronic
917510822 1:175667985-175668007 TGTTAGAAATGCAGAATCTCAGG + Intronic
917599988 1:176564177-176564199 TGTTAGAAATGCAGAATCTCAGG - Intronic
917852727 1:179079212-179079234 TGTTAGAAATGCAGAATCTCAGG - Intergenic
917955813 1:180096933-180096955 TGTTGGAAATGCAGAATTTCAGG - Intronic
918261136 1:182797347-182797369 TGGTAGAAATGCACAAGCTCGGG + Intronic
919094675 1:193017142-193017164 TGTTAGAAATACAGAACCTCAGG - Intronic
919787956 1:201272020-201272042 TGCTGGAAATGCAGAGCCTTAGG + Intergenic
920033928 1:203053625-203053647 TGCTGGAAATGCAGAATCTCAGG - Intronic
920213054 1:204342590-204342612 TGCTGGAAATGCAGAATCTCAGG - Intronic
920662174 1:207924513-207924535 TGTTAAAAATGCAGAACCCCAGG - Intergenic
921683724 1:218065411-218065433 CAGTGGAAAGGCAGAACCCACGG + Intergenic
922019452 1:221688898-221688920 TGGTAGAAATGCAGAATCTCAGG + Intergenic
922355207 1:224768900-224768922 TGTTAGAAATGCAGATCCTCAGG - Intergenic
922557806 1:226546367-226546389 TGGTGGTGATGCAGAATCACTGG - Intergenic
922731226 1:227949630-227949652 TAGTGGAAAAGCAGAACCAGGGG - Intergenic
923279669 1:232431015-232431037 GCGTGGAAATGCATAAACCCTGG + Intronic
923463786 1:234231125-234231147 TGTTGGAAATGCAGAATCTCAGG - Intronic
923893597 1:238243016-238243038 TTGTAGAAATGCAGAATCTCAGG + Intergenic
1063164221 10:3445151-3445173 TGGGAGAAATGAAGAACCCGGGG + Intergenic
1063611426 10:7566066-7566088 TGTTGGCAATGTAGAAACCCAGG + Exonic
1064806466 10:19139779-19139801 TAGTGGAAATGCAGAACCTCAGG + Intronic
1065570100 10:27062436-27062458 TACTAGAAATGCAGAACCCCAGG + Intronic
1065776659 10:29126574-29126596 TGGTGGAAATGCAGAATTGCAGG + Intergenic
1066321459 10:34307505-34307527 TGTTGGAAATGTGGAATCCCAGG - Intronic
1066337296 10:34491071-34491093 TGATGGAAATGCAGAGTCTCAGG - Intronic
1067696687 10:48541060-48541082 TGGTGGAAATACAGACCCTGGGG - Intronic
1068422937 10:56820621-56820643 TGGTGGAAATGTGGATCCTCAGG - Intergenic
1069091380 10:64203305-64203327 TATTAGAAATGCAGAACCTCAGG - Intergenic
1069412924 10:68171423-68171445 TGGTTGGAATGCAGACTCCCAGG + Intronic
1069415344 10:68195670-68195692 GGTTGGAAATGCAGAATCCCAGG + Intronic
1069655254 10:70083123-70083145 TGGTGGGAAAGCTGAGCCCCCGG + Intronic
1069685865 10:70318094-70318116 TGTTAGAAATGCAGAACCTTAGG - Intronic
1069945153 10:71980634-71980656 TGGTGGAAATGCGAATCCTCAGG - Intronic
1070090996 10:73285582-73285604 TCTAGGAAATGCAGAAACCCAGG + Intronic
1070401196 10:76055182-76055204 TGGAGGGAAGGCAGAACCCAGGG + Intronic
1070873030 10:79774788-79774810 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1071129478 10:82374640-82374662 TGTTGGAAACATAGAACCCCAGG - Intronic
1071267746 10:83979342-83979364 TGTTAGAAATACAGAACCTCTGG + Intergenic
1071516765 10:86302846-86302868 TGTTAGAAATGCAGAATCTCAGG + Intronic
1071639956 10:87296939-87296961 TGTGAGAAATGCAGAATCCCAGG + Intergenic
1071655278 10:87441010-87441032 TGTGAGAAATGCAGAATCCCAGG - Intergenic
1071919998 10:90338754-90338776 TGATAGAAATGGAGAGCCCCAGG - Intergenic
1072037376 10:91575708-91575730 TGCTAGAAAGGCAGAACCTCAGG + Intergenic
1072487795 10:95873102-95873124 TGTTGGAAATGTAAAACCTCAGG - Exonic
1073071083 10:100793607-100793629 TGGAGGAAACCTAGAACCCCGGG - Intronic
1073620567 10:105043294-105043316 TGTTAGAAATGCAGAATCTCAGG + Intronic
1073964159 10:108969098-108969120 TAGTGGAAATGCTAATCCCCAGG + Intergenic
1074310286 10:112316562-112316584 GCTTGGAAATGCAGAACCCAGGG + Intergenic
1074941063 10:118236321-118236343 TGGTAGAAATGCAAATTCCCTGG + Intergenic
1075991142 10:126839788-126839810 TGCTGGAAATGCACAATCTCAGG + Intergenic
1076082372 10:127594383-127594405 AGGTGGAAGTTCAGAACACCTGG + Intergenic
1076386258 10:130058143-130058165 TATTCGAAATGCAGAATCCCAGG + Intergenic
1079152951 11:17917771-17917793 TGCTGGAAATGCAGAATCTCAGG + Intronic
1079355443 11:19726742-19726764 TGTTAGAAATGCAGAATCCCAGG + Intronic
1080160606 11:29170761-29170783 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1080249150 11:30213629-30213651 TGTTAGACATGCAGAATCCCGGG + Intergenic
1080556431 11:33421451-33421473 TGTTAGAAATGCAGAATCCTAGG + Intergenic
1080641117 11:34158929-34158951 TGTTGGAAATGCAGAGCCCCAGG - Intronic
1080757571 11:35216813-35216835 TGTTGGAAATGCAGAATCCTTGG + Intronic
1080998932 11:37643274-37643296 TGTTAGAAATGCAGAACCTCAGG - Intergenic
1081268838 11:41059735-41059757 TGTTAGAAATGCAGAATCTCTGG + Intronic
1084292675 11:68184703-68184725 TGGTGGAAAAGCATAACAGCAGG - Intronic
1085460531 11:76690408-76690430 TGGTGGCAATGTAGCACGCCAGG + Intergenic
1087767672 11:102174047-102174069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1087817851 11:102678808-102678830 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1088398641 11:109398178-109398200 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1088587781 11:111375356-111375378 TGTTGGCAATGTACAACCCCAGG + Intronic
1088597976 11:111454047-111454069 TGTTAGAAATGCAGAATCTCAGG - Intronic
1088707855 11:112479969-112479991 TTCTAGAAATGCAGAAGCCCAGG - Intergenic
1089391653 11:118106337-118106359 TGGTGGAAATGGACATTCCCAGG - Intronic
1090301489 11:125644498-125644520 TGTTTGACATGTAGAACCCCTGG + Exonic
1091449686 12:564811-564833 TGCTGGAAATGCAGAATCTCAGG - Intronic
1091455831 12:607153-607175 TGCTGGAAATGCAGAACCTCAGG + Intronic
1091461174 12:644308-644330 TGTTGGAAATGCAGAATCTCAGG - Intronic
1093381475 12:18499858-18499880 TGTTAGAAATGCAGAATCTCAGG + Intronic
1093781077 12:23138199-23138221 TGCTGGAAGTGCAGAAACTCAGG + Intergenic
1094009882 12:25796579-25796601 TGTTAGAAATGCAAAACCGCAGG - Intergenic
1094496327 12:30991677-30991699 TGTCAGAAATGCAGAACCTCAGG + Intronic
1095445519 12:42278361-42278383 TGTTGGAAATGCACAATCTCAGG - Intronic
1095516534 12:43012406-43012428 TGTTGGAAATGCAGAATCCCAGG - Intergenic
1095543400 12:43338040-43338062 GGTTTGAAATGCAGAACCCCAGG + Intergenic
1095738510 12:45584085-45584107 TAGTAGAAATGCAGAATCCCAGG - Intergenic
1095832565 12:46603542-46603564 TGGTGGAAATGTAGACCACTGGG - Intergenic
1097691432 12:62738210-62738232 TGTTAGAAATGCAGAATCTCAGG + Intronic
1098153687 12:67574869-67574891 TGTTGAGAATGCAGACCCCCTGG + Intergenic
1098601147 12:72332824-72332846 TGTTAGAAATGCAGAATCTCTGG + Intronic
1098601529 12:72336971-72336993 TGTTAGAAATGCAGAATCTCAGG + Intronic
1099067767 12:78005498-78005520 TGTTGGCAATGCAGAACCTCAGG + Intronic
1100584963 12:95971024-95971046 TGCTAGGAATGCAGAACCTCTGG + Intergenic
1101279542 12:103238417-103238439 TGTTGGAAATGCAGAATCTCAGG + Intronic
1101535912 12:105616412-105616434 TGCTGGAAATGCAGATTCCATGG - Intergenic
1101589255 12:106111634-106111656 TGCTGGAAATGCAGAATCCCAGG - Intronic
1101750362 12:107578506-107578528 TGATGGAGATGCAGCCCCCCAGG + Intronic
1102084239 12:110123194-110123216 TGCTGGAAATGCAGAAGGGCAGG - Intergenic
1102806073 12:115782161-115782183 TGTTAGAGATGCAGAACCTCAGG - Intergenic
1102818912 12:115891475-115891497 TGTTGGAAATGCAGAGTCCCAGG + Intergenic
1103988425 12:124782331-124782353 TGCTAGAAATGCAGATCCCTGGG - Intronic
1104623159 12:130333338-130333360 TGATAGAAATGCAGATTCCCAGG - Intergenic
1104738479 12:131154656-131154678 TGTAAGAAATGCAGAATCCCAGG - Intergenic
1105376014 13:19845355-19845377 TGATGGAAATGCAAAACCTCTGG + Intronic
1105594250 13:21821291-21821313 TCTTAGAAATGCAGAATCCCAGG + Intergenic
1105884914 13:24633588-24633610 GGGTGACAATTCAGAACCCCAGG + Intergenic
1106175789 13:27330013-27330035 TAGTGGAAAAGCAGAGCCTCTGG + Intergenic
1106633693 13:31504682-31504704 TGATAGAAATGCAGAATCCCGGG - Intergenic
1106805666 13:33303954-33303976 TCTTGGAAATGCAGAATCTCAGG + Intronic
1107523118 13:41203052-41203074 TGTTAGAAATGCAGAATCACAGG + Intergenic
1108112109 13:47085308-47085330 TCATAGAAATGCAGAATCCCAGG - Intergenic
1108510558 13:51151967-51151989 TGTTAGAAATGCAGAATCTCTGG + Intergenic
1108520037 13:51238296-51238318 TGTTAGAAATGCAGAATCCCAGG + Intronic
1109302787 13:60606367-60606389 TGCTAGAAATGCAGAACCTCAGG + Intergenic
1109777324 13:67058768-67058790 TGGTGGAGATGGAGACCACCTGG + Intronic
1110046615 13:70841034-70841056 TGTTGGAGTTGCAGAACCCCTGG - Intergenic
1110071885 13:71188034-71188056 TGGTGCAAATGGAGAAGGCCTGG + Intergenic
1110314152 13:74085773-74085795 TGGTTGAAATGCAGAGTCCTGGG - Intronic
1110358988 13:74603934-74603956 TGCTAGAAATGCAGAATTCCAGG + Intergenic
1111664789 13:91253627-91253649 AGGAGGAATTGCAGAACCTCAGG + Intergenic
1111868269 13:93797204-93797226 TGTTAGAAATGCAGAATCTCAGG - Intronic
1112029208 13:95441647-95441669 TGCTTGAAATGCAGAATCTCAGG + Intronic
1112109813 13:96283839-96283861 TGCTGGAAATACAGAACCTCAGG - Intronic
1112140330 13:96634258-96634280 AGGTGCAAATGCAGAAGCCAGGG - Intronic
1112212966 13:97399569-97399591 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1112678549 13:101734109-101734131 TGTTAGAAATGCAGAATCCCAGG + Intronic
1113568430 13:111335807-111335829 TGGTGTAAATGCATCACTCCAGG + Intronic
1113885638 13:113657174-113657196 AGGTGGGAATGCAAAGCCCCAGG - Intronic
1114539880 14:23447020-23447042 TGTTAGAATTGCAGAACCTCAGG + Intergenic
1115050749 14:29059773-29059795 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1115877300 14:37874990-37875012 TGTTAGGAATGCAGAACCCTAGG + Intronic
1117012741 14:51487490-51487512 GGTTGGAAATGCAGGACCTCAGG - Intergenic
1117045774 14:51811668-51811690 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1117457014 14:55908013-55908035 AGGTGGAAATGCTGAACCCAGGG - Intergenic
1118463659 14:66011658-66011680 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1118601267 14:67472789-67472811 TGGTGGGAATCCAGCACCACGGG + Exonic
1118945500 14:70382531-70382553 TGTTAGAAATGCAGAATCTCAGG - Intronic
1119231262 14:72981692-72981714 TGGTGTGGATGCAGATCCCCTGG - Intronic
1119678432 14:76573760-76573782 TGTTAGAAATGCAGAATCTCGGG - Intergenic
1119867263 14:77984170-77984192 TGTTGAAAATGCAGAATCTCAGG + Intergenic
1119910935 14:78348682-78348704 TACTGGAAATGCAGAATCTCAGG + Intronic
1119953736 14:78772697-78772719 TGCTAGAAATGCAGAATCCCAGG - Intronic
1120222079 14:81745848-81745870 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1121120765 14:91374568-91374590 GGGTGGAACTGGAGAATCCCAGG + Intronic
1121149522 14:91618895-91618917 TGTTAGAAATGCAGAATCTCAGG - Intronic
1121219925 14:92277625-92277647 TGCTGGAAATGCAGATTCCCAGG + Intergenic
1121469269 14:94139273-94139295 TGCTGGCAATGCAGAATCTCAGG - Intergenic
1121560852 14:94874164-94874186 TGTAAGAAATGCAGAACCTCAGG + Intergenic
1122429001 14:101628173-101628195 TGAGGGAATTGCAGAAGCCCCGG + Intergenic
1202852753 14_GL000225v1_random:31320-31342 TGGAGGAGATTCAGGACCCCGGG + Intergenic
1123457019 15:20435544-20435566 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1123661043 15:22564815-22564837 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1124055855 15:26240507-26240529 TGTTGGAAATGCAGAGTCTCAGG - Intergenic
1124263173 15:28210697-28210719 TGTTAGAAATGCAGACTCCCAGG - Intronic
1124314843 15:28659049-28659071 TGTTAGAAATGCAGACTCCCAGG + Intergenic
1124996297 15:34726267-34726289 TGATTGAAATGCAGAATCCCAGG - Intergenic
1125313976 15:38411200-38411222 TGCTGGAAATGCACATTCCCAGG - Intergenic
1126182657 15:45801013-45801035 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1126429572 15:48566984-48567006 TGATGGAAATGCAGAGACTCAGG + Intronic
1126513335 15:49504514-49504536 TGCTAGAAATGCAAAATCCCAGG + Intronic
1126681018 15:51202240-51202262 TGTTAGAAATGCAGAACCTCAGG + Intergenic
1127238568 15:57084565-57084587 TTGTTGAAATGCAGAAGCTCCGG - Intronic
1127310102 15:57744873-57744895 TGGTGAAAAAGCAGAACTCCAGG + Intronic
1127398961 15:58566105-58566127 TGTTAGAAATGCAGAACATCAGG - Intronic
1127539239 15:59920806-59920828 TGCTAGAAATGCAGAATCTCAGG + Intergenic
1127659377 15:61085542-61085564 TGTTAGAAATGCAGATCCTCAGG - Intronic
1127807417 15:62534076-62534098 TGTTGGAAATGCAGATCCTCAGG - Intronic
1128219226 15:65956279-65956301 TGTTAGAAATGCAGAACCTCAGG + Intronic
1128307559 15:66609956-66609978 TGCTGGAAATGCAGAATCTCAGG - Intronic
1128556431 15:68635029-68635051 TTGTGGAAATGCAGGCTCCCGGG - Intronic
1128613544 15:69092105-69092127 TGGTGGGGATGCAGAACAACTGG + Intergenic
1128615251 15:69103869-69103891 TGTTGGAAATGCAGAATCTCAGG - Intergenic
1128784938 15:70388012-70388034 TGGTTGAAATGCAGATTCCTGGG - Intergenic
1128880760 15:71240477-71240499 TGTTGGAAATGCAGACTCTCAGG + Intronic
1128922915 15:71628602-71628624 TGTTAAAAATGCAGAACCTCAGG - Intronic
1129695053 15:77735698-77735720 TGTTGGAAATGCAGATCCTCAGG - Intronic
1129782742 15:78284568-78284590 TGTTAGAAATGCAGAATCCCAGG + Intronic
1129789015 15:78328403-78328425 TTGTTAAAATGCAGAACCCCAGG - Intergenic
1129886970 15:79045210-79045232 TGTTGGAAATGCAGTCCCCTGGG + Intronic
1130388799 15:83436551-83436573 TGGTAGAAATGCAGAGGCTCAGG + Intergenic
1130720902 15:86385400-86385422 TGGTAGAAATGCAGAGTCTCAGG + Intronic
1130737776 15:86568678-86568700 TGTTAGAAATGCAGACTCCCAGG + Intronic
1130772248 15:86936112-86936134 TAGTGGCACTGCAGAACCCCAGG - Intronic
1130887824 15:88108810-88108832 TGGCAGAAATGCAGAACCTCAGG + Intronic
1130911875 15:88276410-88276432 TGTTGGAAATGCAGAATCTGGGG - Intergenic
1130931624 15:88432488-88432510 TGCTGGAAATGCAGAGTCTCAGG - Intergenic
1131017548 15:89070615-89070637 TGTTAGAAATGCAGAACCTCAGG - Intergenic
1131017993 15:89073730-89073752 TATTAGAAATGCAGAACCTCAGG - Intergenic
1131506844 15:93026879-93026901 TGATGGAAATGCAGGACCTCTGG - Exonic
1131512301 15:93056084-93056106 TGGTAGAATTGCAGAACCCCTGG - Intronic
1131589465 15:93732238-93732260 TGGTGGAAATGTGGAATCCTGGG + Intergenic
1131729130 15:95260520-95260542 TGTTAGACATGCAGAACCTCAGG + Intergenic
1132147976 15:99439673-99439695 TGTCAGAAATGCAGAGCCCCAGG - Intergenic
1132313159 15:100871681-100871703 TGATAGAAATGCAGACTCCCAGG - Intergenic
1133097273 16:3456266-3456288 TGCTAAAAATGCAGAACCTCAGG - Intronic
1133929933 16:10223873-10223895 TGTTGGAACTGCAGAATCTCAGG + Intergenic
1134079391 16:11314599-11314621 TGCTGGAAATGCAGAACTGCAGG - Intronic
1134258523 16:12631097-12631119 TCGTGAAAATGCAGAGTCCCAGG - Intergenic
1134669992 16:16047763-16047785 GCGTAGAAATGCAGAATCCCAGG + Intronic
1134882584 16:17758679-17758701 GGTGGGAAATGCAGAATCCCAGG - Intergenic
1135019039 16:18948197-18948219 CGGTAGAAATGCAGAACCTCAGG - Intergenic
1135044885 16:19147019-19147041 TGTTAGAAATGCAGAATCTCAGG - Intronic
1135046311 16:19158878-19158900 TGTCAGAAATGCAGAATCCCAGG - Intronic
1135055976 16:19232402-19232424 TGTTAGAAATGCAGAATTCCAGG - Intronic
1135072582 16:19364974-19364996 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1135472585 16:22744595-22744617 TGTTGGAAATGCATGACCTCAGG - Intergenic
1136029978 16:27495797-27495819 TGCTGGCAGTGCAGAACCCTTGG + Intronic
1136078115 16:27830801-27830823 TGATGGAAACTCAGAACCCGAGG + Intronic
1137238994 16:46638847-46638869 TGTTCGAAATGCAGATTCCCAGG + Intergenic
1137604645 16:49779444-49779466 TGTTAGAAATGCAGAATCTCAGG + Intronic
1137611122 16:49818313-49818335 TGGTAGCAATGCAGATCCCCGGG - Intronic
1137841012 16:51640893-51640915 TGTTAGAAATGCAGAACCTCAGG - Intergenic
1138262638 16:55636251-55636273 TGGTGGGAATGGAGAATCCTGGG + Intergenic
1138420979 16:56898905-56898927 TGTTAGAAATGCAGAATCCCAGG + Intronic
1138435861 16:56999819-56999841 TGCTGGAGAAGCAGAGCCCCAGG + Intronic
1138449707 16:57086339-57086361 TCTTAGAAATGCAGAATCCCAGG - Intergenic
1138932072 16:61671217-61671239 TGTTTGAAATGCAGATACCCAGG - Intronic
1139013596 16:62663158-62663180 TGATGGAAAAGCAGAAACTCGGG + Intergenic
1139037092 16:62960134-62960156 TGGTAGAAATGCAGAATATCAGG - Intergenic
1139333066 16:66209187-66209209 TGTTGAAAATGCAGAATACCAGG - Intergenic
1139444432 16:66988187-66988209 TGGTGGGAATGAAGATTCCCTGG - Intergenic
1139529467 16:67535969-67535991 TTGTGGAAATGCAGACCCCTGGG + Intronic
1140035085 16:71365630-71365652 TGTTAGGAATGCAGAATCCCAGG - Intronic
1140525047 16:75615765-75615787 GGCTAGAAATGCAGAACCTCAGG + Intronic
1140709321 16:77661983-77662005 TGTTATAAATGCAGAACCTCAGG + Intergenic
1140937977 16:79692581-79692603 TGGGGGAAATGCAGAATGCATGG + Intergenic
1140951294 16:79820370-79820392 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1140972592 16:80027917-80027939 TGCTAGAAATGCAGACTCCCAGG - Intergenic
1141254728 16:82390436-82390458 TGTTGGAAATGCAGAATCTTAGG + Intergenic
1141276481 16:82593069-82593091 TTTTGGAAATGCAGAATCCCAGG + Intergenic
1141288159 16:82691860-82691882 TGCTGGAAATGCAAACCCTCAGG + Intronic
1141377171 16:83542078-83542100 TGCTAGAAATGCAGAGCCTCAGG + Intronic
1141408910 16:83818953-83818975 TGCTGGAAATGTAGATCCCCAGG + Exonic
1141493133 16:84388453-84388475 TGTTAGAAATGCAGAAACTCAGG - Intronic
1141563377 16:84885059-84885081 TGTTGGAAATGCAGATTCTCTGG + Intronic
1141752508 16:85968295-85968317 GGCTGGAAATGCAGAATCCCGGG - Intergenic
1141775033 16:86117436-86117458 TGGTAGAAATGCAGATTCCGGGG + Intergenic
1141783959 16:86185867-86185889 AGTTGGAAATGCAGAATCCAGGG - Intergenic
1141787998 16:86214482-86214504 TGTTGGAAATGCAGAGTCTCAGG + Intergenic
1141807923 16:86354247-86354269 TGATAGAAATGCAGAGTCCCAGG + Intergenic
1141875249 16:86819773-86819795 GGTTAAAAATGCAGAACCCCAGG - Intergenic
1142185677 16:88693707-88693729 AGGTGGGAATGGAGAGCCCCTGG - Intergenic
1142952850 17:3497819-3497841 TGTTAGACATGCAGAATCCCAGG + Intronic
1143396287 17:6600644-6600666 TGTTGGAAATGCAGACTCTCAGG - Intronic
1143417952 17:6763732-6763754 TGTTAGAAATGCAGAATCTCAGG + Intronic
1143673144 17:8410779-8410801 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1143902263 17:10183201-10183223 TGCTGGAGATGCAGAATCTCAGG + Intronic
1144357406 17:14459378-14459400 TGCTGGAAATGCAGAATCTCAGG - Intergenic
1144388461 17:14771541-14771563 TGTTAGAAATGCAGAATCCTTGG - Intergenic
1144479607 17:15618027-15618049 TGTTAGAAATACAGAATCCCTGG + Intronic
1144918696 17:18745712-18745734 TGTTAGAAATACAGAATCCCTGG - Intronic
1146297366 17:31660337-31660359 TGTTAGAAATGCAGAGTCCCAGG + Intergenic
1146723297 17:35138346-35138368 TGTTAGAAATGCAGATTCCCAGG + Intronic
1147041685 17:37724168-37724190 TGTTGAAAATGCAGAAACCCAGG + Intronic
1147430911 17:40370236-40370258 TGTTGAAAATGCAGGGCCCCAGG - Intergenic
1147547684 17:41415340-41415362 TGTTAGAAATGCAGACTCCCTGG - Intergenic
1147873050 17:43601334-43601356 TGGTACAAATGCAGAATGCCAGG - Intergenic
1147949291 17:44098058-44098080 TGGGTGACATGCAGCACCCCAGG + Intronic
1149057862 17:52387284-52387306 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1149288396 17:55191341-55191363 AGCTGGAAATGCAGAATCTCAGG - Intergenic
1150144104 17:62753499-62753521 TCTTAGAAATGCAGAACCTCAGG - Intronic
1150206645 17:63413784-63413806 TCTTGGTAAGGCAGAACCCCAGG - Intronic
1150605465 17:66686818-66686840 TATTAGAAATGCAGAAACCCAGG - Intronic
1151960807 17:77404705-77404727 TGTAGGAAATGCAGAGTCCCAGG - Intronic
1152276886 17:79363198-79363220 TGCTGGCACTACAGAACCCCTGG - Intronic
1152808747 17:82371444-82371466 TGGTGGACACGGAGAATCCCAGG + Intergenic
1152979800 18:266412-266434 TGGTAGAAATGCAAAATCTCAGG + Intronic
1153448523 18:5199544-5199566 TGTTGGAAATTCAGAATCTCGGG - Intergenic
1153543607 18:6183529-6183551 AGGTGGAAATTCAGAATCTCAGG - Intronic
1153986389 18:10354558-10354580 TGAAGGAAATGCAGAAAGCCTGG - Intergenic
1155349432 18:24891970-24891992 TGTTAGAAATGCAGAGCCTCAGG - Intergenic
1155865940 18:30964837-30964859 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1155990136 18:32271572-32271594 TGTTAGAAATGCAGATTCCCAGG - Intronic
1156213697 18:34976007-34976029 TGCTAGAAATGCAGAATCTCAGG + Intergenic
1156372486 18:36483987-36484009 TGGTAGAAATGCGGAATCCCAGG + Intronic
1157167624 18:45372651-45372673 TGTTGGGAATGCAGAATCTCAGG - Intronic
1157168849 18:45383823-45383845 TGGAGGAAATAAAGAAGCCCAGG - Intronic
1157201425 18:45663183-45663205 TGTTAGAAATGCAGAATCTCAGG - Intronic
1157220646 18:45826484-45826506 TGGTGAAAATGCAGATTCCTAGG - Intronic
1157347898 18:46856616-46856638 TGTTGGAAATGCAGACTCTCAGG + Intronic
1157655323 18:49381517-49381539 TGGTGGAAGTTCAGAATCCCAGG + Intronic
1157880276 18:51314839-51314861 TGGTAGAAATTCAGAATCTCAGG - Intergenic
1158978557 18:62736233-62736255 TGTTAGAAATGCAGAATCTCAGG + Intronic
1160099427 18:75906202-75906224 TGGTGGAAATGCAGAGCCTCAGG + Intergenic
1160250415 18:77198929-77198951 TGTTGGCAATGCGGAATCCCAGG + Intergenic
1160689610 19:455455-455477 CGGTGCAAATGCAGTACCTCCGG - Intronic
1161492213 19:4568192-4568214 TGTCAGAAATGCAGAATCCCAGG + Intergenic
1161874274 19:6895557-6895579 TGTTAGAAATGCAAAATCCCCGG + Intronic
1163204065 19:15789462-15789484 TGGTGCAAATGCAGAATCCCAGG - Intergenic
1163204076 19:15789558-15789580 TGGTGCACACGCAGAACCTCAGG - Intergenic
1163263410 19:16204633-16204655 CTTTGGAAATGCAGAATCCCAGG + Intronic
1163633235 19:18427468-18427490 CAGTGGAAATGAAGGACCCCCGG - Intronic
1164603443 19:29578965-29578987 TGCTAGAAATGCAGACCCTCAGG - Intergenic
1165153603 19:33774630-33774652 TGGAGGAATTGCTGATCCCCAGG + Intergenic
1165301631 19:34973444-34973466 TGTTTGAAAAGCAGAACCTCAGG + Intergenic
1168484084 19:56746221-56746243 TGGTAGAAATAATGAACCCCTGG + Intergenic
1168569393 19:57452737-57452759 TGTTGGAAATTCAGAATCTCGGG - Intronic
1168654233 19:58115921-58115943 TGGTGGAAACGCTGAAAACCTGG + Intronic
925679091 2:6398232-6398254 TTGTGGAAATGCAGAGTCCTGGG + Intergenic
925985649 2:9212804-9212826 TTGCTGAAATGCAGAGCCCCGGG + Intronic
926217966 2:10916759-10916781 TGTTGGAAATGCAGATTCCAGGG - Intergenic
926792870 2:16593001-16593023 TTGTGCAAATGAAGAACCCAAGG - Intronic
927056144 2:19367273-19367295 TGCTGGAAATGCAGAAGCCCAGG + Intergenic
927731673 2:25478823-25478845 AGGAGGAAAAGCACAACCCCTGG + Intronic
927882870 2:26701040-26701062 TTTTGGAAATGCAGAATCTCAGG - Intronic
928066914 2:28174597-28174619 TGGTGGAAATGTGGACCCCTGGG - Intronic
928626717 2:33147381-33147403 TGGTAGAAATGCAGAATCTCAGG - Intronic
928732920 2:34253503-34253525 TGTTAAAAATGCAGAATCCCAGG + Intergenic
928820060 2:35350930-35350952 AGATGGAAATGCATAAACCCTGG + Intergenic
928976036 2:37087411-37087433 TGCTAGAAATGCAGAACCTCAGG + Intronic
929055611 2:37873869-37873891 TGGTGGATAAGCAGAGCCCATGG + Intergenic
930044517 2:47157275-47157297 TGTTGGAAATGCAGAATCTTAGG - Intronic
931009335 2:57890408-57890430 TGTTAGAAATGCACAATCCCAGG - Intergenic
931219296 2:60274738-60274760 TGATAGAAATGCAGAATCCCAGG + Intergenic
931286848 2:60839613-60839635 TGTTGGAAATGCATGACCTCAGG - Intergenic
931700116 2:64902510-64902532 TGTTAGAAATGCAGATTCCCAGG - Intergenic
931877062 2:66525334-66525356 TGCTGAAAATGCAGAATCTCAGG - Intronic
931936747 2:67206679-67206701 TGTTAGAAATGCAGAATCTCAGG - Intergenic
932480968 2:72039016-72039038 CGGTGGCAATGCAGACCTCCTGG + Intergenic
933279373 2:80315913-80315935 TGTTAGAAATGCAGAATCTCAGG + Intronic
933566963 2:83962083-83962105 GGTTAGAAATGCAGAATCCCAGG - Intergenic
933881447 2:86673941-86673963 TTGTAGAAATGCAGAATCTCAGG - Intronic
935538174 2:104318594-104318616 TGTTAGAAATGCAGAATCTCAGG + Intergenic
935562806 2:104576165-104576187 TTGTAGAAATGCAGACCCCCAGG + Intergenic
935679245 2:105621743-105621765 TTGTGGAAATGCAGACTCTCAGG + Intergenic
935782709 2:106521925-106521947 TGTTAGAAGTGCAGACCCCCAGG - Intergenic
936664889 2:114582998-114583020 TGTTAGAAATGCAGATTCCCAGG - Intronic
937122284 2:119449107-119449129 TGTTAGAAATGCAGAATCTCAGG - Intronic
937582809 2:123509170-123509192 TGGTGAGGATGCAGAACCACTGG + Intergenic
937968215 2:127530678-127530700 TGGTGGATATGCAGCATTCCAGG + Intergenic
938569079 2:132545790-132545812 TGTTAGAAATGCAGAATCCCAGG - Intronic
938966733 2:136395268-136395290 TGTTAGAAATGCAGAATCTCAGG + Intergenic
939092322 2:137793723-137793745 TGCTGAAAATGCACAACCACTGG - Intergenic
939902410 2:147866398-147866420 TCTTGGAAATGCGGAACCTCAGG - Intronic
939960627 2:148562031-148562053 TGGCAAAAATGCAGAATCCCAGG - Intergenic
940744819 2:157555437-157555459 TAATGGAACTCCAGAACCCCAGG - Intronic
940781056 2:157934022-157934044 TGTTAAAAATGCAGAATCCCAGG - Intronic
941321099 2:164055710-164055732 TGCAGCAAATGCAGAAACCCTGG + Intergenic
941327660 2:164136932-164136954 TGTTAGAAATGCAGAATCTCAGG + Intergenic
942102843 2:172603084-172603106 TGTTAGAAATGCAGAATCTCAGG - Intronic
942631563 2:177955579-177955601 TGTTAGAAATGCAGAATCTCAGG - Intronic
942906890 2:181193769-181193791 TGGTGGAAATGCAAAACGGTAGG + Intergenic
942926390 2:181438307-181438329 TGTTAGAAATGCAGAATCTCAGG + Intergenic
944153141 2:196583489-196583511 TGTTGGAAATGCAGAATCTCAGG - Intronic
944353299 2:198755647-198755669 TGCTAGAAATGCAGAACCTCAGG + Intergenic
944562157 2:200950809-200950831 TGGTGGAAATACAGATCACTAGG - Intronic
945066937 2:205955483-205955505 TACTGAAAATGCAGAACCCCAGG + Intergenic
945488225 2:210423810-210423832 TGTTAGAAATGCAGAATCTCAGG + Intergenic
945964419 2:216170719-216170741 CGATGGAAATGCAGAACTCTTGG + Intronic
946219204 2:218211926-218211948 CATTGGAAATGGAGAACCCCAGG - Intergenic
946387262 2:219391747-219391769 TTTTAGAAATGCAGAACCTCAGG + Intronic
946445279 2:219734112-219734134 TGCTAGAGATGCAGAATCCCAGG + Intergenic
946588750 2:221219908-221219930 TGGGAGAAATGCAGAATCCCAGG + Intergenic
946826777 2:223687276-223687298 TTGTGGAAATGCAGATTCCAAGG - Intergenic
948023991 2:234762082-234762104 TGGTGGAGATGCAGAATGTCTGG - Intergenic
948251778 2:236535536-236535558 GGGTGGAAAGGCGGAAGCCCTGG + Intergenic
948281768 2:236752591-236752613 TGGTGGAGCTGGGGAACCCCAGG + Intergenic
948619211 2:239223445-239223467 AGGTGGAAATGCAGAAGGCAGGG + Intronic
948753050 2:240143538-240143560 TGTTGGAAATGCAGATTCCCAGG - Intronic
949064495 2:241981418-241981440 TGCTGGAAATGCAGAGTCTCAGG - Intergenic
1169122877 20:3107810-3107832 TGTTAGAAATGCAGATCCCCAGG + Exonic
1169205386 20:3737145-3737167 TGTTAGAAATGCAGAACCTCAGG - Intronic
1169251600 20:4065039-4065061 AGTTAGAAATGTAGAACCCCAGG - Intergenic
1169578864 20:6996296-6996318 TGTTAGAAATGCAGATCCTCAGG + Intergenic
1169703514 20:8475991-8476013 TGTTAGAAATGCAGAATCTCAGG - Intronic
1169806126 20:9560940-9560962 TGTTAGAAATGCAGAATCTCAGG - Intronic
1169912114 20:10655461-10655483 TGTTAGAAATGCAGAAACCTGGG + Intronic
1170347180 20:15400286-15400308 TGCTGAAAATGCTGAACCCCAGG + Intronic
1170846658 20:19967748-19967770 TGCTGAAAATGCAAAACCTCAGG - Intronic
1171428112 20:25061139-25061161 TTGTAGAAATGCAGAATGCCAGG + Intergenic
1172006726 20:31823164-31823186 TGGTGGAAATGCAGATAGCTTGG + Intronic
1172020768 20:31912325-31912347 TGGTAGAAATGCAGGTTCCCAGG - Intronic
1172053621 20:32138869-32138891 TGGTGGTAATGCTAAATCCCTGG - Intronic
1172068541 20:32239151-32239173 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1172160904 20:32867221-32867243 TGGTCAGAATTCAGAACCCCAGG - Intronic
1172885215 20:38226423-38226445 TGTTGGAAATTCAGAGTCCCAGG + Intronic
1173359641 20:42330875-42330897 TGTTGGAAATGCAGAGTCCCAGG + Intronic
1173365056 20:42377500-42377522 TGTTTGAAATGCAGAATCTCAGG - Intronic
1174262466 20:49306666-49306688 TGGTGGAAATGCACAATTTCAGG - Intergenic
1174606738 20:51767364-51767386 TGGTGCAAATGCAGATTTCCCGG - Intronic
1174710650 20:52701364-52701386 TGTTAGAAATGCGGAACCCCAGG - Intergenic
1175104581 20:56605550-56605572 TGCTAGAAATGCAAAATCCCAGG + Intergenic
1175160029 20:57001524-57001546 TGCTAGAAATGCAGAGGCCCAGG + Intergenic
1175165439 20:57040453-57040475 TGCTGGAAATGCAGATTCTCAGG + Intergenic
1175293896 20:57895756-57895778 GGGTGGAGATGCTGACCCCCAGG - Intergenic
1175367499 20:58466317-58466339 TGCTGGAAATGCAGAACCCCGGG + Intronic
1175671380 20:60905699-60905721 TGGTGGAAAGGCTGAACCTTAGG - Intergenic
1175724095 20:61305421-61305443 TGTTGGAAATGCAGACTCTCAGG - Intronic
1175732698 20:61364875-61364897 TGTTGGAAATGCAGACCCTCAGG + Intronic
1176218343 20:63958594-63958616 TGGTTGGAAGGCAGGACCCCAGG + Exonic
1176905355 21:14493876-14493898 TGCTGGGATTGCAGAACCCCAGG + Intronic
1177057835 21:16331006-16331028 TGCTAGAAATGCAGACCCCCGGG - Intergenic
1177438739 21:21090098-21090120 TGATGGAAATGCAGAATCTCAGG + Intronic
1177665289 21:24148769-24148791 TATTGGAAATGCAGAATCTCAGG - Intergenic
1177811061 21:25925450-25925472 TGTTAGACATGCAGAACCTCAGG + Intronic
1178696884 21:34800627-34800649 TGCTGGAAATGAAAAGCCCCTGG - Intronic
1179100452 21:38351492-38351514 TGCTGGAAATGCTGAAGCTCAGG + Intergenic
1179117441 21:38507102-38507124 TGCTGGCAATGCAGAGCCCAGGG - Intronic
1179165683 21:38933547-38933569 TGTTAGCAATGCAGAATCCCAGG - Intergenic
1179447615 21:41444016-41444038 TGCTGGAAATGCAGAATTCTAGG - Intronic
1179488820 21:41727492-41727514 TGGTGGGACAGCACAACCCCTGG + Intergenic
1179651152 21:42809922-42809944 CAGGGGAAATGGAGAACCCCAGG - Intergenic
1179722587 21:43324050-43324072 ATGTGGAAATGCAGATCTCCAGG - Intergenic
1180004394 21:45013371-45013393 TGGTGGTACTGCAGAGCCCAGGG - Intergenic
1180047704 21:45317439-45317461 GGGTAGAAATGCAGAGTCCCAGG - Intergenic
1180653503 22:17398997-17399019 TGTTAGAAATGCAGAATCTCAGG + Intronic
1181602967 22:23963279-23963301 TGTTGGAAATGCAGAGGCTCAGG + Intergenic
1181605547 22:23978028-23978050 TGTTGGAAATGCAGAGGCTCAGG - Intronic
1181668162 22:24412486-24412508 TGGTGCAGATGCAGAAGCTCAGG + Intronic
1181880498 22:25975764-25975786 GGTTGGAAATGCAGAATCTCAGG - Intronic
1182000163 22:26913586-26913608 TGGTTGGAATGCAGAATCTCAGG - Intergenic
1182031893 22:27165726-27165748 TTGTGGAAATGCAGATTCCTGGG + Intergenic
1182070999 22:27463609-27463631 TGTTTGAAATGCAGAACCCCAGG + Intergenic
1182087524 22:27571573-27571595 TGGTGAGAATGCAGATGCCCAGG - Intergenic
1182535832 22:31002262-31002284 TGGTAGAAATGCAGAATCTCAGG - Intergenic
1182742789 22:32580897-32580919 TGTTAGAAATTCAGAACCCCAGG + Intronic
1183077806 22:35437816-35437838 TTGTGAAAATGCAGATGCCCAGG - Intergenic
1184152005 22:42644804-42644826 TGCTGGAAAAACAGAACTCCAGG - Intronic
949330610 3:2917492-2917514 TGTTAGAAATGCAGAATTCCAGG - Intronic
949728474 3:7078283-7078305 TGTTAGAAATGCAGAACCACAGG + Intronic
950577187 3:13839225-13839247 TGTCGGAAATGCAGAATCTCAGG + Intronic
950778398 3:15370357-15370379 TGTTGGAAATGCAGAATCTCAGG - Intergenic
950984646 3:17348416-17348438 TGGTGGAAATGCAGAACCCCAGG - Intronic
951190419 3:19762684-19762706 TGTTGGAGATGCAGAATCTCAGG + Intergenic
951471695 3:23063465-23063487 TGCAGGAAATGCAGAATCTCAGG + Intergenic
951599735 3:24360379-24360401 TGTTAGAAATGCAGAACCTCAGG + Intronic
951731873 3:25818675-25818697 TGATGCAAATTCAGAATCCCGGG - Intergenic
951884072 3:27506732-27506754 TGCTGGACATGCAGAATCACGGG + Intergenic
952227708 3:31395993-31396015 TGTTAGAAATGCAGAATCTCAGG - Intergenic
952268405 3:31808564-31808586 TGGGGGAAATGCAGGAGCCTGGG + Intronic
952302735 3:32118433-32118455 TGTTAGAAATGCTGAACCTCAGG - Intronic
952815937 3:37448019-37448041 TGTTGGAAATGCAGATTCCTGGG + Intergenic
952847074 3:37696888-37696910 TGTTAGAAATGCAGAATCTCAGG + Intronic
953344295 3:42162003-42162025 TGCTAGAAATGCAGAACCTTAGG + Intronic
953417533 3:42731515-42731537 TGTTAGAAATGCAGAATCCCAGG + Intronic
953576303 3:44115646-44115668 TGTTGGAAAAGCAGGATCCCAGG + Intergenic
953774313 3:45802454-45802476 TGTGGGAAATGCAGAATCGCAGG - Intergenic
953781310 3:45873240-45873262 TGTTGGAAATGCAGAATTTCAGG - Intronic
954044021 3:47914039-47914061 TGGTAGAAATGCAGAATCTTGGG - Intronic
954072643 3:48154223-48154245 TGTTAAAAATGCAGAACCTCAGG + Intergenic
954196683 3:49001336-49001358 TGAGGGACATGCAGTACCCCAGG + Intronic
954266437 3:49473473-49473495 AAGAGGAAATGCAGTACCCCAGG - Intronic
954489631 3:50890954-50890976 TGGTGGAGATACCGAAACCCAGG + Intronic
954880519 3:53833043-53833065 TGGTGCAAATGAAAACCCCCAGG - Intronic
955331131 3:58048362-58048384 GGCTGGAAATGCAGATTCCCAGG - Intronic
955488550 3:59459628-59459650 TGTTAGAAATGCAGAATCTCAGG + Intergenic
955494434 3:59516989-59517011 TGCTAGAAATGCAGAATCTCAGG + Intergenic
955571588 3:60312611-60312633 TATTGGAAATGCAGAATCTCAGG - Intronic
955941278 3:64149152-64149174 TGATGAGAAGGCAGAACCCCTGG - Intronic
956135090 3:66090439-66090461 TGCTAGAAATGCAGACTCCCAGG + Intergenic
956173274 3:66449923-66449945 TGTTAGAAATGCAGAACCTCAGG - Intronic
956553208 3:70485431-70485453 TGCTAGAAATGCAGAATCTCAGG + Intergenic
956677761 3:71752194-71752216 TGTTAGAAATGCAGAACCTCCGG + Intronic
956729915 3:72187104-72187126 AGTTGGAAATGCAGAATCCCAGG + Intergenic
956743679 3:72294650-72294672 TGTTGGAAATGCAGGATCTCTGG - Intergenic
956772166 3:72535898-72535920 TGGGGGAGATGCAGAGCCACTGG - Intergenic
956861101 3:73324467-73324489 GGTTAGAAATGCAGAATCCCAGG - Intergenic
956979526 3:74619366-74619388 TGGATGAAATGCAGAGTCCCAGG - Intergenic
958107856 3:89101139-89101161 TGTTGGAAATGCAGAATCTCAGG + Intergenic
958731870 3:97968508-97968530 TGTTAGAAATGCAGAACCTCAGG - Intronic
958788424 3:98623972-98623994 TGTTAGAAATGCAGAATCTCAGG + Intergenic
958800569 3:98750594-98750616 TGCTGGAAATGCAGATAACCAGG + Intronic
959480948 3:106872031-106872053 TTGTTAAAATGCAGAATCCCAGG + Intergenic
959677446 3:109052426-109052448 TGTTAGAAATGCAGAATCCCAGG - Intronic
960017204 3:112905057-112905079 TGTTAGAAATGCAGAACACTAGG + Intergenic
961051082 3:123747617-123747639 GGCTGGAAATGCAGACTCCCAGG + Intronic
961074560 3:123969774-123969796 TGTTAGAAATGCAGAATCTCAGG - Intronic
961161770 3:124732487-124732509 TGTTAGAAATGCACAACCTCAGG - Intronic
961309122 3:125982684-125982706 TGTTAGAAATGCAGAATCTCAGG + Intronic
961933082 3:130554515-130554537 GGGTGGCAATGCAGAGCCACTGG + Intergenic
962186751 3:133268371-133268393 TTGTAGAAATGCAGACTCCCAGG + Intronic
962547332 3:136450273-136450295 TGTTAGAAATGCAGAATCTCAGG + Intronic
963001459 3:140685478-140685500 TGTTAGAAATGCAGAATCTCAGG + Intronic
963312481 3:143723823-143723845 TGTTGAAAATGCAGAATCCCAGG + Intronic
963765391 3:149329665-149329687 TGGTAGAAATGCAGGAGCACTGG + Intronic
965641334 3:170831639-170831661 TGTTAGAAATGCAGAAACTCAGG - Intronic
965690555 3:171352079-171352101 TGTTGGAAATGCAGAATCTCAGG - Intronic
966385488 3:179393329-179393351 TGTTAGAAATGCACAATCCCGGG + Exonic
966557061 3:181274466-181274488 TGTTAGAAATGCAGAATCTCAGG + Intergenic
966911021 3:184560208-184560230 TGTTAAAAATGCAGAACCCTGGG + Intronic
967347930 3:188479376-188479398 TGTTGGAAATGCAGAATCTCTGG + Intronic
967679763 3:192347310-192347332 TGTTGGAAAGGCAGAATCTCAGG + Intronic
967854061 3:194103336-194103358 TGTTTGAAATGCAGAATCTCAGG - Intergenic
968682397 4:1930014-1930036 TGCTAGAAATGCAGACTCCCGGG - Intronic
969241709 4:5903006-5903028 GGGTGAAAATGCAGAGGCCCAGG - Intronic
969272679 4:6113426-6113448 GGATGGAAATGCAGATTCCCTGG - Intronic
969471152 4:7390007-7390029 TCCTGGAAATGCAGACCCACAGG - Intronic
969739438 4:9013459-9013481 TGGTGGAAATGCAGTGCCTTGGG - Intergenic
970028488 4:11649990-11650012 TGCTAGAAATGCAGAATTCCAGG + Intergenic
972315248 4:37920347-37920369 AGGTGGTTTTGCAGAACCCCAGG - Intronic
972574347 4:40338339-40338361 TTGTAGAAATGCAGAATCACAGG - Intronic
972730967 4:41794699-41794721 AGTTGGAAGTGCAGAATCCCAGG + Intergenic
972864747 4:43217126-43217148 TGGTGGAAATGCACAAACTCAGG - Intergenic
973170731 4:47139810-47139832 TGTTGGAAATGCAGAAGCTCAGG - Intronic
973839235 4:54844157-54844179 TGGGGGAAATGCAAATCCGCTGG + Intergenic
973885998 4:55322339-55322361 TGTTAGAAATGCAGAATCCCTGG + Intergenic
973908481 4:55554151-55554173 TGTTAGAAATGCAGAATCTCTGG - Intergenic
974823210 4:67094651-67094673 TGTTAGAAATGCAGAATCTCAGG - Intergenic
976099494 4:81545755-81545777 TGTTGGAAATGCAGAACCTCAGG + Intronic
977238213 4:94534590-94534612 TTGTGGAGATGCAGAAACCTGGG + Intronic
979388294 4:120096348-120096370 TGTTAGAAATGCAGAACCTCAGG - Intergenic
981143570 4:141299760-141299782 TGTTAGAAATGCAGAATCTCAGG - Intergenic
982082968 4:151808048-151808070 TGTTAGAAATGCAGAATCCCAGG + Intergenic
982148420 4:152425011-152425033 TGTTAGAAATGCAGAATCTCGGG - Intronic
982679017 4:158407857-158407879 TGTTAGACATGCAGAACCTCAGG - Intronic
983646167 4:169993654-169993676 AGGAGGAACTGTAGAACCCCGGG - Intronic
984779731 4:183514310-183514332 TGCTAGAAATGCAGACCCTCGGG - Intergenic
985298907 4:188466209-188466231 TTGGGGAAATGCAGAAATCCAGG - Intergenic
985668376 5:1193511-1193533 TGGTGGAAAGGCTGGACGCCAGG + Intergenic
985763602 5:1764804-1764826 TGTTGGAGAAGCAGAACCCAAGG - Intergenic
985961825 5:3308359-3308381 TGGTGGAAATGCAGCTCGGCAGG + Intergenic
985973973 5:3400654-3400676 TTGTAAAAATGCAGAATCCCGGG - Intergenic
986023245 5:3824699-3824721 GGATGGAGATGCAGAAACCCTGG + Intergenic
986492699 5:8308396-8308418 TGGTGGCAATTTAGAACCCAAGG - Intergenic
986559913 5:9050149-9050171 TGATGGGAATGCAGATCCTCAGG - Intronic
986710613 5:10485826-10485848 TGTTGGAAAAGCAGACCCTCAGG - Intergenic
986726564 5:10602291-10602313 TGTTAGAAATGCAGATCCTCAGG - Intronic
988229308 5:28453559-28453581 TCGTGGCAATGCAGAATGCCTGG + Intergenic
988849521 5:35165178-35165200 TGATGGAAGAGCAGAACACCTGG - Intronic
989090264 5:37723264-37723286 TGGTGGAACTGGACAAACCCAGG - Intronic
989206149 5:38810544-38810566 TGCTGAAAATGCAGCACACCCGG + Intergenic
990620250 5:57550959-57550981 TGGTAGAAATGCAGAATCTTGGG + Intergenic
990728805 5:58786268-58786290 TGGTGGAGTTTCAAAACCCCAGG - Intronic
991200399 5:63985321-63985343 TGGTAAAAATGCAGACTCCCAGG + Intergenic
991296148 5:65083806-65083828 TGCTAGAAATTCAGAACCTCAGG + Intergenic
991422187 5:66453085-66453107 TGACAGAAATGCAGAATCCCAGG - Intergenic
991431340 5:66550622-66550644 TGTTGTAAATGCAAAATCCCAGG - Intergenic
991587128 5:68212984-68213006 TGTTAGAAAGGCAGAATCCCAGG - Intergenic
991721219 5:69495384-69495406 TGTTAGAAAGGCAGAATCCCAGG - Intronic
992027242 5:72682069-72682091 AGGTGGAGAGGCAGCACCCCTGG - Intergenic
992400962 5:76411059-76411081 TGTTGGAAAGGCAGATGCCCAGG + Intronic
993347590 5:86804246-86804268 TGTTAGAAATGCAGAATCTCAGG - Intergenic
993447131 5:88027277-88027299 TTGGGGAAAGGCTGAACCCCAGG + Intergenic
994559183 5:101346182-101346204 TGGTGGAATTATGGAACCCCAGG - Intergenic
995472191 5:112514284-112514306 TGGTGGATATGCCTAGCCCCAGG + Intergenic
995677948 5:114684552-114684574 TGTTAGAAATGCAGAATCTCGGG - Intergenic
996077405 5:119213028-119213050 TGGAGGAAAAGCACAAACCCTGG + Intronic
997675910 5:135713139-135713161 TGTTGGAAATGCAGAATCTCAGG + Intergenic
997762324 5:136461859-136461881 TTGCGGAAATGCAGAATCTCCGG + Intergenic
998240507 5:140439049-140439071 TGTGAGAAATGCAGAATCCCGGG + Intronic
998462343 5:142319219-142319241 TGGTTGCATTGCAGAGCCCCAGG - Intronic
998551368 5:143080920-143080942 TGGTGGAAATGCTGAACAGTGGG + Intronic
998868409 5:146529047-146529069 TGTTAGAAATGCAGAATCCCAGG + Intergenic
998992527 5:147833661-147833683 TGCAGGAAATGCAGAAACCCAGG - Intergenic
999249998 5:150176834-150176856 TGCTGAAAATGCAGATTCCCAGG - Intronic
999324077 5:150632234-150632256 TGTTAGAAATGCAGAATCCCAGG + Intronic
999630716 5:153568342-153568364 TGTTAGAAATGCAGAATCTCAGG + Intronic
999701403 5:154231854-154231876 TGTTGGTAATCCAGAAACCCAGG + Intronic
999707973 5:154291387-154291409 TGTTAGAAATGCAGAATCTCAGG + Intronic
999893162 5:156000697-156000719 TGGTCTAAAGGCAGAACCCTAGG - Intronic
999975985 5:156912586-156912608 TATTAGAAATGCAGAATCCCAGG - Intergenic
1000254621 5:159525985-159526007 TGTTAGAAATGCAAAACCTCAGG - Intergenic
1000459723 5:161499540-161499562 TGATGGAATTTCAGAACCTCTGG + Intronic
1000827344 5:166061597-166061619 TGTTGGAAATGCAGAGTCTCAGG - Intergenic
1001300657 5:170531339-170531361 TATTGGAAATGCAGGATCCCAGG - Intronic
1001314826 5:170634412-170634434 TGTTGGAAATGTAGAACCTTGGG - Intronic
1001588442 5:172849344-172849366 TGGTGAAAATGCAGATTCCCAGG - Intronic
1001695010 5:173663544-173663566 TGCTGGAAACACAGGACCCCAGG - Intergenic
1002076342 5:176710707-176710729 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1002261652 5:177997390-177997412 TGTTGGAAATGCAGATCCCTGGG + Intergenic
1002574820 5:180168517-180168539 CGACGGAAATGCAGAGCCCCAGG - Intronic
1002782840 6:380197-380219 TGATGGAAATGCAGATTCCTGGG + Intergenic
1003105080 6:3209305-3209327 TGGTGGAAATGTAGAATCTCTGG + Intergenic
1003373701 6:5553791-5553813 TGTTAGAAATGCAGAATCCCAGG - Intronic
1004084141 6:12427904-12427926 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1004109316 6:12699776-12699798 TGTTAGACATGCAGAATCCCAGG - Intergenic
1004118485 6:12795090-12795112 TGTTAGAAATATAGAACCCCTGG - Intronic
1004290910 6:14366414-14366436 TGCTAGAAATGCAGAATCTCAGG + Intergenic
1004450953 6:15745878-15745900 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1004480776 6:16017524-16017546 TGGAGGGGATGCAGAAGCCCGGG + Intergenic
1004517501 6:16332883-16332905 TGCTGGAAATGCAGACTCTCAGG + Intronic
1004525096 6:16400020-16400042 TGTGGGAAATGCAGAATCTCAGG + Intronic
1004984943 6:21070883-21070905 TGCTGGAAATGCAGACTCTCAGG + Intronic
1005057727 6:21745742-21745764 TGGTGGAAAAGATGAACCACTGG - Intergenic
1005232774 6:23723401-23723423 TGTCAGAAATGCAGAATCCCAGG - Intergenic
1006164293 6:32055667-32055689 TGTTGGAAATGCAGAATCTCTGG + Intronic
1006431572 6:34000475-34000497 TGGTGGCAGTCCAGCACCCCAGG - Intergenic
1007697537 6:43743330-43743352 TGGTTCAAATGCAGACCCCAGGG + Intergenic
1008364290 6:50658222-50658244 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1009265411 6:61548443-61548465 TGGTAGAAATGCAGACTCTCAGG - Intergenic
1010007978 6:71016377-71016399 TGATTGAAATGCAGAATCTCAGG - Intergenic
1010694993 6:78961502-78961524 TGTTAGAAATGCAGAATCTCAGG + Intronic
1010777787 6:79906766-79906788 TGATGTAAATGCACAACCCTGGG + Intergenic
1011938423 6:92812096-92812118 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1011966679 6:93167013-93167035 TGTTAGAAATGCAGAATCCCAGG + Intergenic
1012053233 6:94370888-94370910 TGTTGAAAATGCAGAATCTCAGG + Intergenic
1012389179 6:98717544-98717566 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012835464 6:104259521-104259543 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1012921658 6:105226364-105226386 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1012949827 6:105505965-105505987 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1013076291 6:106774656-106774678 TGGTAGAAATGCAGATTCTCAGG + Intergenic
1013652601 6:112211136-112211158 TGTTAGAAATGCAGACCCTCAGG - Intronic
1013655501 6:112242573-112242595 TGTTAGAGATGCAGAACCTCAGG - Intronic
1014284510 6:119481535-119481557 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1014911912 6:127104712-127104734 TGTTAGAAATGCAGAACATCAGG - Intergenic
1015090790 6:129355580-129355602 TGGTGGAATTGCATAAGGCCTGG + Intronic
1015331887 6:131989531-131989553 TGGTAAAAATGCAGAAGCCTGGG - Intergenic
1015842753 6:137491296-137491318 TGATTGAAATGCAACACCCCAGG - Intergenic
1015864773 6:137717004-137717026 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1016868078 6:148789304-148789326 TGTTAGAAATGCAGAATCTCAGG + Intronic
1017561606 6:155634157-155634179 TGTTAGAAATGCAGAATCCAGGG - Intergenic
1017604641 6:156120940-156120962 TGGTGAAAATGTAGAACATCTGG + Intergenic
1017824286 6:158070252-158070274 TGGTGGAAATTCAAAAGCCATGG - Intronic
1017987475 6:159456218-159456240 GGGTGGAAATGCAGAATCTTAGG + Intergenic
1018171694 6:161148406-161148428 TGGTGGGAATGTAGGGCCCCTGG + Intronic
1018187524 6:161279676-161279698 TGTTGGAAATGCAGAGTCTCAGG + Intergenic
1019111062 6:169714391-169714413 TGTTGGAAATGCAGAATCTCAGG - Intronic
1019724082 7:2591328-2591350 TCATGGAACTCCAGAACCCCCGG - Intronic
1019791891 7:3019595-3019617 TGTTGGAAATGCAGACTCTCAGG - Intronic
1020583993 7:10042699-10042721 TAGTGGAAATGAAGAATCACAGG + Intergenic
1020762142 7:12281883-12281905 TGTTAGAAATGCAGAATTCCAGG - Intergenic
1020912838 7:14154994-14155016 TGTTAGAAATGCAGACTCCCCGG + Intronic
1021038571 7:15832088-15832110 TGTTAGAAATGCAGAAACTCAGG - Intergenic
1021521768 7:21545776-21545798 GGTTAGAAATGCAGAACCTCGGG - Intronic
1021682778 7:23151535-23151557 TGTTAGAAATGCTGAATCCCAGG - Intronic
1021717823 7:23474774-23474796 TGGCGCAAATCCAGAACCTCCGG - Intergenic
1022377285 7:29826330-29826352 TGTTAGAAATGCAGAATCCCAGG + Intronic
1022531697 7:31070826-31070848 TGCTGGAAATGCAGATGCTCAGG - Intronic
1022535937 7:31098491-31098513 TCTTAGAAATGCAGAATCCCAGG - Intronic
1022825726 7:34011269-34011291 TGGTAGAAATACAGAATCTCGGG - Intronic
1022834495 7:34100980-34101002 TGTTAGAAATGCAGACTCCCAGG + Intronic
1022886040 7:34644939-34644961 TTGTTAAAATGCAGAAGCCCAGG + Intergenic
1022944415 7:35267823-35267845 TTGTTGAAATGCAGAATCTCTGG - Intergenic
1023044846 7:36201997-36202019 TGTTGGAAATGCAGAATCTCGGG + Intronic
1024569151 7:50709808-50709830 TGGTAGAAATGCAGGCTCCCAGG + Intronic
1026059257 7:67011492-67011514 TGCTAGAAATGCAGAATCTCAGG + Intronic
1026459308 7:70599500-70599522 TGTTAGAAATGCTGAACCTCAGG + Intronic
1026718838 7:72813555-72813577 TGCTAGAAATGCAGAATCTCAGG - Intronic
1027414601 7:77961878-77961900 TGCTAGAAAAGCAGAAACCCAGG + Intergenic
1028377481 7:90160841-90160863 TGGTGCAAATGCAAAAGCACAGG - Exonic
1028936321 7:96468347-96468369 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1029202124 7:98846225-98846247 TGTTGGAAATGCAGACCCTTGGG - Intergenic
1029561900 7:101308562-101308584 TGGGGGAACTGCATAGCCCCGGG - Intergenic
1030059612 7:105612422-105612444 TGTTAGAAATGCAGACTCCCAGG + Intronic
1030704236 7:112674777-112674799 TGTTGGAAAAGCAGAATCTCAGG - Intergenic
1030741614 7:113116411-113116433 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1031009948 7:116515467-116515489 TGTTAGAAATGCAGAATCCCAGG - Intergenic
1031013839 7:116551114-116551136 TGGTAAAAATACAGATCCCCAGG + Intronic
1031137042 7:117895987-117896009 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1031288842 7:119907486-119907508 TGTTGGGAAGGCAGTACCCCAGG - Intergenic
1032598090 7:133262654-133262676 TGTTAGAAATGCAGAATCTCAGG + Intronic
1032714448 7:134493480-134493502 TGAAGGAAATGAAGAAACCCAGG + Intergenic
1033029101 7:137807732-137807754 TGCTGGAAATGCAGACTCTCAGG - Intronic
1034009525 7:147513832-147513854 TGGTGAAAACGCATATCCCCCGG - Intronic
1034784938 7:153917084-153917106 TGTTAGAAATGCAGAATCCCAGG - Intronic
1034948013 7:155276573-155276595 TGCTGGAAATGCAGAAGCCTGGG + Intergenic
1034972771 7:155429501-155429523 TGATGGAAATGTGGAACCCATGG + Intergenic
1035009336 7:155699289-155699311 TGTTAGAAATGCAGAACCCCAGG + Intronic
1035046337 7:155969821-155969843 TGGTGAAAATGGAGAGCCCTGGG - Intergenic
1035451077 7:158977247-158977269 TGTTGGAAATGCAGAGGCTCTGG + Intergenic
1036594202 8:10197615-10197637 TGGCTGAAATGCAGATCCCCAGG + Intronic
1036712035 8:11085919-11085941 TGGTGGAAATGCAGATTCCTGGG - Intronic
1037385157 8:18332171-18332193 TGGTGGAATAGAAGATCCCCTGG + Intergenic
1038500754 8:28041689-28041711 GGCTAGAAATGCAGAATCCCAGG - Intronic
1039619760 8:38985775-38985797 TGTTGGAAAGGCAGAATCCCAGG + Intronic
1039721558 8:40169721-40169743 TGTTGGAAATGCAGATCCTCAGG - Intergenic
1040072084 8:43196568-43196590 TGCAGGGAATGCAGAAGCCCAGG - Intronic
1040366013 8:46716900-46716922 TAGTGGAAATGCAGAAGTCTAGG + Intergenic
1041974216 8:63778531-63778553 TGTCAGAAATGCAGAACCTCAGG + Intergenic
1042099648 8:65261144-65261166 CAGAGGAACTGCAGAACCCCTGG + Intergenic
1042215560 8:66427523-66427545 TGTTGGAAATGCAGAACGTCAGG - Intergenic
1042477666 8:69267157-69267179 TGCTAGAAAAGCAGAACCCTGGG - Intergenic
1042477930 8:69270261-69270283 TGTTAGAAATGCAGAATCCTGGG - Intergenic
1043107605 8:76134735-76134757 TGTTGGAAATGCCAAACCTCAGG + Intergenic
1043461323 8:80463127-80463149 TGGTGGTATTGTTGAACCCCTGG - Intergenic
1043960345 8:86410527-86410549 TGTTAAAAATGCAGATCCCCAGG + Intronic
1044693468 8:94900598-94900620 TGATGGAAATCCAGAAGCTCTGG + Intronic
1044695941 8:94922419-94922441 TGCTAGAAATGCAGAATCTCTGG + Intronic
1045057375 8:98381326-98381348 GGGTGGAAATGCAGATCTCAGGG - Intergenic
1045243733 8:100424871-100424893 TGGGGAAAATGCAGAACAACAGG - Intergenic
1045281917 8:100756859-100756881 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1045662179 8:104449471-104449493 TGCTAGAAATGCAGAATCTCAGG + Intronic
1045891055 8:107157890-107157912 TGGTAGAAATGCAGAATCTCTGG - Intergenic
1045999590 8:108403323-108403345 TGGTGGAAATGCAGCATTCTAGG - Intronic
1047372190 8:124265308-124265330 TGCTGGCCATGCAGAAACCCGGG - Intergenic
1047380267 8:124355505-124355527 TGTTAGAAATGCAGAATCTCAGG + Intronic
1047516267 8:125557114-125557136 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1048103694 8:131383483-131383505 TGTCAGAAATGCAGAACCTCAGG + Intergenic
1049308844 8:141922717-141922739 TGTTAGAAATGCAGACTCCCAGG - Intergenic
1050088734 9:1994030-1994052 TATTGGAAATGCAGAATCTCAGG + Intergenic
1050224342 9:3434079-3434101 TGTTAGAAATGCAGAATCTCAGG - Intronic
1050256498 9:3797492-3797514 TGTTAGAAATGCAGAACCTCAGG + Intergenic
1050461991 9:5885052-5885074 TGGAGGAAATGGAGGACCACAGG - Intronic
1050467664 9:5947279-5947301 TGTTAGAAATGCAGAATCCAAGG - Intronic
1050838415 9:10113790-10113812 TGTTAGAAATGCAGAATCACAGG - Intronic
1051103069 9:13545047-13545069 TGTTGGAAATGCAGAATCTCAGG - Intergenic
1051191269 9:14515766-14515788 TGTGGGAAATGCAGAAACTCAGG - Intergenic
1051690186 9:19704187-19704209 TGTTGGAAATGCATAATCTCAGG - Intronic
1051715545 9:19979280-19979302 TAGTGGAAATGAAGAAACTCAGG - Intergenic
1052321629 9:27173631-27173653 TGTTAGAAATGCAGAACCTCGGG - Intronic
1052379000 9:27749882-27749904 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1052746766 9:32448985-32449007 TGGTGAGAATGCAGATGCCCTGG + Exonic
1054822303 9:69535267-69535289 TAGAGGAAATACAGAATCCCAGG - Intronic
1055046559 9:71931978-71932000 TGTTTAAAATGCAGAATCCCAGG + Intronic
1055481826 9:76716305-76716327 TGTTGGAAATGCAGAGTCTCCGG + Intronic
1055583406 9:77731727-77731749 TGTTAGAAATGCAGACCCTCGGG - Intronic
1055856949 9:80700035-80700057 TGGTGGAGATACAGAACAGCTGG - Intergenic
1055963299 9:81841351-81841373 TGATGGAAATGCAGATCATCAGG + Intergenic
1056013682 9:82359225-82359247 TGTTGGAAATGCAGAGTCTCAGG + Intergenic
1056036181 9:82608505-82608527 TGTTGGAGATGCAGAATTCCAGG - Intergenic
1056067084 9:82947654-82947676 TGTTAGAAATTCAGAATCCCAGG - Intergenic
1056114264 9:83426570-83426592 TGCTGGAAATGCAGAATCTCAGG + Intronic
1056157773 9:83856186-83856208 TGTTAGAAATGCAGATCCTCAGG - Intronic
1056352772 9:85767898-85767920 TGTTAGAAATGCAGATCCTCAGG + Intergenic
1056835181 9:89949175-89949197 TGTTAGAAATGCAGAATCTCAGG - Intergenic
1056898329 9:90572864-90572886 TGTTGGAAATGCAGAACCTTGGG - Intergenic
1056901890 9:90607602-90607624 TGATAGAAATGCAGACTCCCGGG + Intergenic
1057203614 9:93157424-93157446 TGTTGGAAATGCAGATTCTCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057472078 9:95367032-95367054 TGTTGGAAATGCAGAATCCAGGG - Intergenic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057794976 9:98149303-98149325 TGTTGGAGATGCAGATTCCCTGG + Intronic
1057902013 9:98956783-98956805 TGGCAGAAATGCAGAATCTCTGG + Intronic
1057915588 9:99052933-99052955 TGTTAGAAATGCAGAACTTCAGG + Intronic
1057944095 9:99309587-99309609 TGTTTGAAATGCAGAATCCCAGG - Intergenic
1058068005 9:100570730-100570752 TGGTAGACTTGCAGCACCCCTGG + Intronic
1058420353 9:104827597-104827619 TTGTGGGAATGCAGAATCCATGG - Intronic
1059640361 9:116210801-116210823 TAGTAGAAATGCAGAATCTCGGG - Intronic
1059644331 9:116249649-116249671 AAGTGGAAATGCAGAGCACCGGG + Intronic
1059716439 9:116917566-116917588 TGTTAGAAATGCAGAATCCCAGG + Intronic
1059725353 9:117003310-117003332 TGTTAGAAATGCAGAACCTCAGG + Intronic
1059834692 9:118138216-118138238 TAGTGAGAATGTAGAACCCCTGG + Intergenic
1061492601 9:130954366-130954388 TGTTGAAAATGGGGAACCCCTGG - Intergenic
1061584976 9:131559695-131559717 TATTAGAAATGCAGAACCTCAGG - Intergenic
1061700629 9:132412301-132412323 TGGTGGAAGAAGAGAACCCCAGG - Intronic
1061775491 9:132960389-132960411 TGTAGGCAACGCAGAACCCCTGG + Intronic
1062227487 9:135461171-135461193 TGGTGGAAATGGACAATCCTGGG - Intergenic
1186159687 X:6763872-6763894 TGGTGCCAGTTCAGAACCCCTGG - Intergenic
1186249042 X:7646310-7646332 TGCTAGAAATGCAGAATCCCAGG + Intergenic
1186516544 X:10170594-10170616 TGTTAGAAATGCAGATTCCCCGG + Intronic
1186603173 X:11060545-11060567 TGTTGGAAATGCAGAACCTTGGG - Intergenic
1186663799 X:11698068-11698090 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1186683145 X:11896897-11896919 TGCTAGAAATGCAGAATCCCAGG - Intergenic
1186763518 X:12747649-12747671 TGCTAGAAATGCAGATTCCCTGG - Intergenic
1186884385 X:13898479-13898501 TGTCAGAAATGCAGAATCCCAGG + Intronic
1186932713 X:14412548-14412570 TGTTAGAAATGCAGAACCTTTGG - Intergenic
1187118256 X:16375690-16375712 TGTTGGAAATGCAGAATCTCAGG - Intergenic
1187232750 X:17438181-17438203 TGTGAGAAATGCAGAATCCCAGG - Intronic
1187297695 X:18018025-18018047 TGCTAGAAATGCAGAATCTCAGG - Intergenic
1187581028 X:20607508-20607530 TGTTGGAGATGCAGAATCTCAGG - Intergenic
1187688602 X:21841022-21841044 TGTTAGAAATGCAGAATCCCAGG + Intronic
1188003220 X:25001192-25001214 TGGAGGACATGCAGAGCCCCAGG - Intergenic
1188114076 X:26222818-26222840 TGGTGGGAATAGAGAAGCCCTGG + Intergenic
1188353716 X:29163323-29163345 TGTTAGAAATGCAGACTCCCAGG - Intronic
1188580145 X:31701791-31701813 TGTTAGAAATGCAGAATCTCAGG + Intronic
1188597311 X:31917137-31917159 GGGGGGAAATGCAGAACCTCAGG + Intronic
1188650362 X:32624619-32624641 TGTTAGAAATGCAGAATCTCAGG - Intronic
1188691190 X:33131151-33131173 TATTGGAAATGCAGAATCTCAGG - Intronic
1189122522 X:38409616-38409638 TGGTAGAAATGCAGATTCTCAGG - Intronic
1191892681 X:65960914-65960936 TGATAGAAATGCAGAATCTCAGG - Intergenic
1194426997 X:93751063-93751085 TGATAGAAATGCAGAATCTCAGG + Intergenic
1194818707 X:98478782-98478804 TGTTAGAAATGCAGAATCCTGGG + Intergenic
1195367962 X:104144509-104144531 AGTTGGAAATGCAGAATCACTGG + Intronic
1195386192 X:104315464-104315486 TGTTAGAAATGCAGAAGCTCAGG + Intergenic
1195835503 X:109110714-109110736 TAGTAGAAATGCAGAATCTCAGG + Intergenic
1195863391 X:109404917-109404939 TGGAGGAGAGGTAGAACCCCTGG - Intronic
1196018439 X:110964397-110964419 TGTTAGAAATGCAGAAGCTCAGG - Intronic
1198391073 X:136174437-136174459 TGTTGGAAATGCAGGATCTCAGG - Intronic
1198851441 X:140968806-140968828 TGTTGGGAATGCAGAATCTCAGG + Intergenic
1199463265 X:148107295-148107317 TGTTAGAAATGCAGAATCTCAGG + Intergenic
1200075578 X:153549072-153549094 TTGTGCAGATGCTGAACCCCTGG - Intronic