ID: 950987410

View in Genome Browser
Species Human (GRCh38)
Location 3:17389700-17389722
Sequence TTGAATCTACAACTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950987410_950987415 28 Left 950987410 3:17389700-17389722 CCCTGCTCAAGTTGTAGATTCAA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 950987415 3:17389751-17389773 TTGGGGTGATTTCAATGCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 145
950987410_950987412 9 Left 950987410 3:17389700-17389722 CCCTGCTCAAGTTGTAGATTCAA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 950987412 3:17389732-17389754 AAATTCTGTTGTTTTAAACTTGG 0: 1
1: 0
2: 6
3: 36
4: 578
950987410_950987414 11 Left 950987410 3:17389700-17389722 CCCTGCTCAAGTTGTAGATTCAA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 950987414 3:17389734-17389756 ATTCTGTTGTTTTAAACTTGGGG 0: 1
1: 0
2: 3
3: 46
4: 450
950987410_950987413 10 Left 950987410 3:17389700-17389722 CCCTGCTCAAGTTGTAGATTCAA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 950987413 3:17389733-17389755 AATTCTGTTGTTTTAAACTTGGG 0: 1
1: 0
2: 6
3: 65
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950987410 Original CRISPR TTGAATCTACAACTTGAGCA GGG (reversed) Intronic
901883319 1:12206657-12206679 CTGAATCTGCATCTTGGGCAGGG + Intronic
904938092 1:34145955-34145977 ATGAATCTAAATCTTGAGAATGG - Intronic
909365172 1:74812329-74812351 TTTCATCTGCAACTTGTGCAAGG - Intergenic
910013847 1:82496930-82496952 TTGAATCTAGAACTTTAAAAGGG - Intergenic
910776478 1:90881495-90881517 ATGAAACTGCAACTTGAGCAGGG - Intergenic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
913092599 1:115489174-115489196 TTGAATCTATAGCTCGAGCTGGG - Intergenic
916163714 1:161945098-161945120 TTAAATACACAACTTGAGTAAGG + Intronic
918372343 1:183873757-183873779 TTGAATGAACACCCTGAGCAAGG + Intronic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
919372392 1:196744572-196744594 TTAAATCTACAACTGGAATATGG + Intronic
922109168 1:222540617-222540639 TTGAAGCTGCAACTTGCTCAGGG - Intronic
922442336 1:225666259-225666281 TAGAAACTTGAACTTGAGCATGG - Intergenic
1064826609 10:19410241-19410263 TTAAATCTACAACTTGACATTGG - Intronic
1065792033 10:29269221-29269243 TTGAAAATACAATTTGAGCAAGG - Intergenic
1066011775 10:31201169-31201191 TTGAATCTGCTAGTTGAACATGG + Intergenic
1068563763 10:58547890-58547912 TTGATTCTAGCACTGGAGCAGGG - Intronic
1075674662 10:124287963-124287985 TGGAATCTCCCAGTTGAGCAAGG - Intergenic
1076545585 10:131243890-131243912 GTGAATCTCCAATTTGAGCTGGG - Intronic
1077201759 11:1311064-1311086 GTTAAGCTACAACTTGAGGAAGG - Intergenic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1081244104 11:40742999-40743021 CTGAATCTACAACTTGGGAAAGG + Intronic
1081754355 11:45534080-45534102 TTGAATCTAGAACGAGAGCGTGG + Intergenic
1085467053 11:76731230-76731252 ATGAATCTACAATTTGGGCAGGG + Intergenic
1085981105 11:81727053-81727075 TTTAATAAACAACTTCAGCAAGG - Intergenic
1092492385 12:8957022-8957044 GTGAATCTTGATCTTGAGCAGGG + Intronic
1093254402 12:16848836-16848858 TTGTATATACAAACTGAGCATGG - Intergenic
1095471796 12:42544869-42544891 TTGATTTTACAACTTGAGTCTGG + Intronic
1099256749 12:80323927-80323949 TAGCATATACAACTTGAGAATGG - Intronic
1103182000 12:118920981-118921003 GTGCATCTGCCACTTGAGCAGGG - Intergenic
1104031995 12:125071498-125071520 TTGCATCTCCACCTTGTGCAGGG - Intronic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1110462851 13:75765412-75765434 TTGGATCTGCAACTTGAGCATGG + Intronic
1112258798 13:97858918-97858940 TAGAATCTACACATTAAGCAAGG - Intergenic
1115586675 14:34821122-34821144 TTGAACCTACAAATTAAGTAGGG + Intronic
1115678322 14:35706911-35706933 TTGAATCTACAGATTAAGTAGGG + Intronic
1118121947 14:62855488-62855510 ATGAATCTACAATTTGCACAGGG - Intronic
1118561530 14:67088999-67089021 TTGCATATACATCTTGAGCAAGG - Exonic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120066593 14:80048194-80048216 TTAAATCTACAAATAAAGCACGG - Intergenic
1125401070 15:39303836-39303858 CTGAAACTACACCTAGAGCATGG + Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1131742430 15:95408720-95408742 TTAAATATACATCTTGAGGAGGG + Intergenic
1134390319 16:13813992-13814014 ATGAATCTACAAATTGGGCAGGG + Intergenic
1137929893 16:52576874-52576896 CTGACTCTACCACTTCAGCAAGG + Intergenic
1139243325 16:65416621-65416643 TTGGATCTACCATTTGGGCAGGG - Intergenic
1142864715 17:2783691-2783713 ATGAATCTGCAACATGGGCAGGG + Intronic
1144047543 17:11467339-11467361 TTAAATCTACAACTTGAGGGTGG - Intronic
1149280583 17:55100984-55101006 TTCAATCTACAGGTTGAGCATGG - Intronic
1149510951 17:57241001-57241023 TTGGATCTAGAATGTGAGCAGGG + Intergenic
1153647925 18:7211658-7211680 TTGAATCTACCACTTCCACAAGG + Intergenic
1154482466 18:14846493-14846515 CTTATTCTACCACTTGAGCAAGG + Intronic
1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG + Intergenic
926290779 2:11528036-11528058 TTGATTTTACAACCTGAGAAAGG - Intergenic
926624580 2:15080568-15080590 ATGGATCAAGAACTTGAGCAAGG + Intergenic
927932621 2:27054941-27054963 CTGAATCTGCAAGTGGAGCAGGG - Intronic
928298836 2:30108193-30108215 ATGAATCTATAATTTGGGCAGGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929577226 2:43059537-43059559 CTGAATCTACAGTTTGGGCAGGG + Intergenic
935525087 2:104155862-104155884 TTGAATCGTAAACTTGATCAGGG + Intergenic
937138635 2:119577922-119577944 ATGGATCTACAACTTGGGCATGG + Intronic
939458627 2:142469772-142469794 TTGAAGCTATAACATCAGCAGGG - Intergenic
940644045 2:156371830-156371852 TTGAATCTACAAATTAACCTTGG + Intergenic
941462816 2:165792132-165792154 TTGAATCTCCAAAGTGAGAAAGG + Intronic
942074518 2:172344317-172344339 ATGAATCTACAATGTGGGCAGGG + Intergenic
943638150 2:190328517-190328539 TTGAATCAACACTCTGAGCATGG - Intronic
944998312 2:205319696-205319718 TTGAATGTACACTATGAGCAAGG - Intronic
945423668 2:209671349-209671371 TTTACTCTCCAAATTGAGCAAGG + Intronic
945994037 2:216420983-216421005 CTGATTCTGGAACTTGAGCATGG + Intronic
946049021 2:216845650-216845672 TGGAAACCACATCTTGAGCATGG + Intergenic
1169825308 20:9761456-9761478 TTGAATCTATAGATTGTGCAGGG - Intronic
1172749228 20:37238205-37238227 TTGAATCGAATACATGAGCAGGG - Intronic
1173470575 20:43320446-43320468 TTGATTCTAGAAGTTGAGAAAGG - Intergenic
1173691350 20:44963565-44963587 AGAAATCTACAATTTGAGCATGG - Intergenic
1175272778 20:57746581-57746603 TTGGATCTCCCACTTGAACATGG + Intergenic
1175610552 20:60347662-60347684 TTGAAGCTACAAATATAGCAGGG + Intergenic
1175830731 20:61964348-61964370 TTGAATCTACAAATTGATTTGGG - Intronic
1176798137 21:13390121-13390143 CTTATTCTACCACTTGAGCAAGG - Intergenic
1180915223 22:19481202-19481224 TTGCTTCTACAACTTGGGCGTGG - Intronic
1181402536 22:22660003-22660025 CTGAATCTACACCTAGACCAAGG + Intergenic
1181738533 22:24901321-24901343 TTAGATCTTCAACTTGAGTAGGG + Intronic
950987410 3:17389700-17389722 TTGAATCTACAACTTGAGCAGGG - Intronic
956033922 3:65069694-65069716 TAGATTCTACAACTGCAGCAAGG + Intergenic
957934520 3:86925460-86925482 ATTATTCTACAACTTAAGCAGGG + Intergenic
958163147 3:89843997-89844019 TTGGATCTATAAGTTGTGCAGGG - Intergenic
959906317 3:111714595-111714617 TTGAAGCTACAGCATGGGCATGG - Intronic
961128539 3:124443931-124443953 TTGAAGCTTCCACCTGAGCAGGG + Intronic
962183276 3:133231355-133231377 ATGAATCTGTAATTTGAGCAGGG + Intronic
962561117 3:136607881-136607903 TTGATTCTAGAACTGGGGCAAGG - Intronic
964330811 3:155600373-155600395 TGGAATCTACCAATAGAGCATGG - Intronic
967295509 3:187960477-187960499 TTGAATCTCCAACTTGATGCTGG + Intergenic
967870026 3:194222184-194222206 TTTAAACTACAACCTGAGCCCGG + Intergenic
970897715 4:21122809-21122831 TAGAAACTAGAACTGGAGCAAGG - Intronic
973880539 4:55267399-55267421 TGGAATCTAAAATATGAGCATGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975721192 4:77250196-77250218 TAGAAACCACAACTAGAGCATGG + Intronic
977480494 4:97568679-97568701 CTGAGTCCAGAACTTGAGCAAGG + Intronic
979614041 4:122721524-122721546 ATGAATCTACAATTTAGGCAGGG + Intergenic
980209861 4:129773172-129773194 TTGAATATACAAGTTGGGGACGG - Intergenic
985778862 5:1859221-1859243 TTAAACCTGCAACTGGAGCATGG + Intergenic
990952883 5:61315476-61315498 CAGAATCTACAACTAGATCATGG - Intergenic
991519680 5:67482085-67482107 GTGAATCTGCAACTTGAGCAGGG + Intergenic
991940617 5:71848839-71848861 ATACATCTACAATTTGAGCAAGG + Intergenic
992940379 5:81754887-81754909 GTCAATCTAGAGCTTGAGCAGGG - Intergenic
993423174 5:87728410-87728432 TTAAATCTACATCTTCAGCGGGG + Intergenic
994910629 5:105901172-105901194 TAGAAACTACAATTTTAGCATGG + Intergenic
996166734 5:120232980-120233002 TTGAATCTACAAATTGCTTAGGG + Intergenic
1001691080 5:173632921-173632943 TTCAATCGACAAGTTGAGCGAGG + Intergenic
1003095495 6:3139930-3139952 TTAATTATACAACTTGCGCACGG - Intronic
1006424290 6:33954588-33954610 CTGAATCCACAATTTTAGCATGG + Intergenic
1006796071 6:36733160-36733182 TTGAATATACAACATGTGCCAGG + Exonic
1007692536 6:43711974-43711996 GTGAACTTACCACTTGAGCAGGG + Intergenic
1011531535 6:88327601-88327623 TAGAATCTAGAGCTTGAGGAAGG - Intergenic
1012258215 6:97058306-97058328 TTGAATCTATAAATTGAGTTGGG + Intronic
1016269898 6:142276789-142276811 TTGAATTTGCCACTTGAGCCAGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1017284217 6:152655743-152655765 TTGATTCCATAACTTGAACATGG - Intergenic
1017427630 6:154339165-154339187 TTGAACCTAAATCTTGAGAATGG - Intronic
1018124368 6:160667992-160668014 TAGAATCTGCTATTTGAGCAAGG + Intergenic
1019108658 6:169691438-169691460 TAGACTCTGTAACTTGAGCATGG + Intronic
1020405422 7:7828159-7828181 TTGAATTTACAACCTGGCCAGGG + Intronic
1021679717 7:23117861-23117883 TTGAATCTACAATCTGCTCAGGG + Intronic
1026304762 7:69131233-69131255 TTGAATGTGCAATTTGGGCAGGG + Intergenic
1029025637 7:97414139-97414161 TTGGATCTACATCTATAGCAGGG + Intergenic
1030669896 7:112324823-112324845 TTGAATCTCCAACTTGCAGATGG - Intronic
1042376138 8:68055226-68055248 TTGAAACTGCAGGTTGAGCAAGG + Intronic
1042825933 8:72979213-72979235 ATGAATCTGCAATTTGAACAGGG - Intergenic
1047878116 8:129162944-129162966 ATGAATCTGCAATTTGGGCAAGG + Intergenic
1048244579 8:132779141-132779163 TTGAAGCTACAATTTGAGATGGG + Intronic
1048313745 8:133346751-133346773 TTGATTCTACAATTTGGACAGGG - Intergenic
1048954620 8:139525702-139525724 TGGAATCTAGGACTTGAGCCTGG - Intergenic
1051585035 9:18718451-18718473 TTGAATGTACAATTTGTTCAAGG - Intronic
1055021345 9:71673501-71673523 ATGAATCTTCAAGTTTAGCAAGG + Intergenic
1055812146 9:80161716-80161738 CTGCATCTACACCTTGACCATGG + Intergenic
1057060422 9:91999143-91999165 TTGAATCAGCAACCTGAGTAAGG + Intergenic
1058117125 9:101097115-101097137 GTGGATCTCAAACTTGAGCATGG + Intronic
1058564380 9:106266082-106266104 ATGACTCTATGACTTGAGCAAGG - Intergenic
1186411707 X:9349738-9349760 TTGAAGGGACAACTTCAGCAAGG - Intergenic
1187340458 X:18416661-18416683 GTGAATTTGCAATTTGAGCAAGG + Intergenic
1189849205 X:45162266-45162288 ATGAATATGCAACTTGAGCAGGG - Intronic
1193577969 X:83227029-83227051 TTGAATCTATAACTTGCTCTGGG + Intergenic
1194339693 X:92693370-92693392 TTGATTCTATAACTTCAGTAAGG + Intergenic
1197237574 X:124085210-124085232 TTGAATGTACAAAATGTGCATGG + Intronic
1197433998 X:126402068-126402090 TTTAGTCTACAAATTGATCAAGG - Intergenic
1197901051 X:131372516-131372538 TTGATTCTAGAACTGGAGCAGGG + Intronic
1198692437 X:139298934-139298956 TTCATTCTAAAACTTAAGCAAGG + Intergenic
1200601000 Y:5205927-5205949 TTGAATATACAATTTCGGCAAGG - Intronic
1200648078 Y:5810149-5810171 TTGATTCTATAACTTCAGTAAGG + Intergenic