ID: 950999997

View in Genome Browser
Species Human (GRCh38)
Location 3:17547034-17547056
Sequence CACCTAGATCTGCTACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950999997_951000001 -3 Left 950999997 3:17547034-17547056 CCAATCAGTAGCAGATCTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 951000001 3:17547054-17547076 GTGTAATCAACAGCAGCAGGGGG 0: 1
1: 0
2: 2
3: 25
4: 179
950999997_950999999 -5 Left 950999997 3:17547034-17547056 CCAATCAGTAGCAGATCTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 950999999 3:17547052-17547074 AGGTGTAATCAACAGCAGCAGGG 0: 1
1: 1
2: 0
3: 16
4: 143
950999997_951000002 30 Left 950999997 3:17547034-17547056 CCAATCAGTAGCAGATCTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 951000002 3:17547087-17547109 CAAAACAAAACAAAAACAGTAGG 0: 1
1: 34
2: 204
3: 1122
4: 6987
950999997_950999998 -6 Left 950999997 3:17547034-17547056 CCAATCAGTAGCAGATCTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 950999998 3:17547051-17547073 TAGGTGTAATCAACAGCAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 295
950999997_951000000 -4 Left 950999997 3:17547034-17547056 CCAATCAGTAGCAGATCTAGGTG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 951000000 3:17547053-17547075 GGTGTAATCAACAGCAGCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950999997 Original CRISPR CACCTAGATCTGCTACTGAT TGG (reversed) Intronic
903141014 1:21339174-21339196 GTTCTAGTTCTGCTACTGATTGG + Intronic
906899370 1:49816859-49816881 CAGTTAAATCTGCTACTGATGGG - Intronic
908916956 1:69139247-69139269 AGCCTAGATCTGCCACTGAAGGG - Intergenic
913698472 1:121351224-121351246 CACCTAGATGTGGAATTGATGGG - Intronic
914139076 1:144928819-144928841 CACCTAGATGTGGAATTGATGGG + Intronic
915701400 1:157800303-157800325 GTCCTAGATCTGGTACTAATTGG - Intronic
920485876 1:206369880-206369902 CACCTAGATGTGGAATTGATGGG - Intronic
922392723 1:225162834-225162856 CATATAGAAATGCTACTGATTGG + Intronic
923568542 1:235094393-235094415 TACTTAGATCTTCAACTGATTGG + Intergenic
1063173604 10:3532193-3532215 CACATGGAGCTGCTACCGATTGG - Intergenic
1064059064 10:12122053-12122075 GACCTAGATTTGCTAGTGTTGGG - Exonic
1067899132 10:50219743-50219765 GCCCTACATCTGCTTCTGATAGG - Intronic
1071419477 10:85477532-85477554 CACCTACTTCTCCTACTGCTTGG + Intergenic
1088562122 11:111125876-111125898 TACCTATATCTGATACTTATTGG + Intergenic
1093626430 12:21353702-21353724 CACACAGATCTGCAACTGCTTGG - Intronic
1094497335 12:30996517-30996539 CACCTAGATCAGCTAAGGACAGG - Exonic
1097182603 12:57179851-57179873 CACATTGATCTGCTTCTTATTGG - Exonic
1100211646 12:92405005-92405027 CACCTAGTTCAGCCACTGCTAGG + Intergenic
1101272592 12:103163298-103163320 CACCTCAATCTGCCATTGATTGG - Intronic
1115409122 14:33052369-33052391 CACATAGCTCTGTTCCTGATTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1117708657 14:58500072-58500094 CAACTATATATGCTAGTGATTGG - Intronic
1117708911 14:58502861-58502883 CAACTATATATGCTAGTGATTGG + Intronic
1123390990 15:19872268-19872290 CACCTAGAGATGCAACTAATTGG + Intergenic
1131234232 15:90682331-90682353 CACCTAGCTCCCCTACTTATGGG + Intergenic
1131973269 15:97914266-97914288 CCCCTACCTCTGCTACAGATAGG + Intergenic
1133095803 16:3444283-3444305 CCCCAAGCTCTGCCACTGATTGG + Intronic
1137708404 16:50550039-50550061 CCCCTAGATCTGCTACCCAGAGG - Intronic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1151277406 17:73046001-73046023 CAGCTAGATCTGGAACAGATTGG - Intronic
1153775267 18:8447788-8447810 CACCTATATGTCTTACTGATTGG + Intergenic
1155554493 18:27003349-27003371 GACCTAGATCTACCACTCATGGG + Intronic
1156567111 18:38204307-38204329 AACCTTCATATGCTACTGATTGG - Intergenic
1157065687 18:44347682-44347704 CATGTAGAAATGCTACTGATCGG + Intergenic
1157802054 18:50628664-50628686 GCCCTAGTTCTGCTCCTGATGGG - Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
928761248 2:34586150-34586172 CAGGTAGAGCTGCTACTAATGGG - Intergenic
937400250 2:121576325-121576347 AACCTAGATCTGTTCCTGCTGGG - Intronic
939194609 2:138956477-138956499 CAGCCAAATCAGCTACTGATTGG + Intergenic
943628114 2:190221517-190221539 AACCTGGCTCTGATACTGATAGG + Intronic
945809716 2:214534022-214534044 CACCAATATCTGCAACTGAAGGG - Intronic
946433842 2:219639531-219639553 CACCTGGACCTGCTCCTCATTGG + Exonic
948136255 2:235638642-235638664 CTCCTAGTTCTCCTACTAATTGG - Intronic
1172063644 20:32204501-32204523 CACCTTGATCTGCTTTTAATGGG + Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178063946 21:28882946-28882968 CATCTAGATCTTCCACTGACAGG - Intronic
950503817 3:13380939-13380961 CACCTGGAACTGCAAATGATGGG + Intronic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
951444527 3:22763406-22763428 CTCTTAGATCTCCTACTGTTAGG + Intergenic
951616585 3:24553198-24553220 TACCTAGAAGTGCAACTGATGGG + Intergenic
951686619 3:25351473-25351495 CACCTAGATCTGTCACTTGTGGG + Intronic
959406406 3:105966556-105966578 CTCCTAGTACTGCTACTGGTCGG - Intergenic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
963849953 3:150201275-150201297 AACTTAGATCTACTCCTGATGGG - Intergenic
966319129 3:178680959-178680981 CTCCTGGAGCTTCTACTGATTGG - Intronic
967852077 3:194089850-194089872 CACCGAGATCTGCGACGGAGAGG + Intergenic
969509163 4:7607807-7607829 CACCTATCTCTGCTACTCATTGG - Intronic
972393323 4:38633839-38633861 CTCCTAGATCTACTGCAGATTGG + Intergenic
975087316 4:70357441-70357463 AACCTAGATCTGCTTGTAATGGG + Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
981143311 4:141296085-141296107 CACCTAGCTGTGCTCCTGCTGGG + Intergenic
981329091 4:143487866-143487888 CACCCAGATTTGCTGCTGCTTGG - Intergenic
983201676 4:164867322-164867344 CCACTGCATCTGCTACTGATTGG + Intergenic
984446129 4:179838084-179838106 TATGTAGATCTGATACTGATAGG + Intergenic
985826106 5:2192705-2192727 CACCTGGCTCTGCTGCTGAGGGG - Intergenic
992664840 5:78997808-78997830 CACCTAAATGTTTTACTGATTGG + Exonic
995153169 5:108875896-108875918 CAAATATATCTACTACTGATAGG - Intronic
995948302 5:117678496-117678518 CACCTAGAACTGCTATTGTTAGG + Intergenic
996387478 5:122924818-122924840 CACCCAGATCTGCTACTTCCTGG - Intronic
997452640 5:133995943-133995965 CACCCAGATCTGCTCCAAATCGG + Intronic
1001438218 5:171717639-171717661 TACCTACATCCCCTACTGATCGG - Intergenic
1010128462 6:72463313-72463335 CACCTAGAGATGCCACTGACAGG - Intergenic
1018517104 6:164595243-164595265 CACAAAGCTCAGCTACTGATTGG + Intergenic
1023716743 7:43052568-43052590 CACCAACATCTGCTTCTGGTAGG - Intergenic
1032501873 7:132405657-132405679 CACCTGGCTCTGCAAGTGATGGG - Intronic
1037222233 8:16537992-16538014 CACCCAAATCTGGTACTGATTGG + Intronic
1037393756 8:18420718-18420740 CACCAACATCTGCTTCTGATGGG - Intergenic
1039486054 8:37910653-37910675 CACCAACATCTACTTCTGATGGG - Intergenic
1040994825 8:53390982-53391004 CACCTTGCTTTGCTTCTGATAGG + Intergenic
1044250144 8:89996807-89996829 CACTTAGATTTGCCACTCATAGG - Intronic
1047721249 8:127642138-127642160 GACCTAGTTCTACTAATGATAGG - Intergenic
1048770734 8:137891872-137891894 AATGTAGAGCTGCTACTGATGGG + Intergenic
1049572987 8:143378261-143378283 CACTGAGATCAGCTCCTGATGGG - Exonic
1052784229 9:32813831-32813853 CACCTATGTCTGCCACTGCTGGG + Intergenic
1053474271 9:38370632-38370654 CACCGAGCTGTGCTCCTGATGGG - Intergenic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1058663266 9:107284459-107284481 CCCCTTGAACTGCTACTGTTTGG - Intronic
1189165773 X:38859397-38859419 CTCCTAGAACTGCTATGGATAGG + Intergenic
1193945609 X:87729430-87729452 CAACAACATCTGCTTCTGATGGG + Intergenic
1194938658 X:99982516-99982538 CACCTACATTTATTACTGATGGG - Intergenic
1196899408 X:120368225-120368247 TACTTAGATCTGCTACTCAGAGG - Intronic
1197125628 X:122942597-122942619 CATCTAGATCTGCTATCCATTGG - Intergenic
1201271330 Y:12258173-12258195 CACCGAGCTCTGCTGCTGAATGG + Intergenic
1201906127 Y:19087208-19087230 CACCTATTGCTGCTCCTGATTGG + Intergenic