ID: 951002052

View in Genome Browser
Species Human (GRCh38)
Location 3:17574253-17574275
Sequence CTTAATTTGGAGGCAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951002052_951002061 10 Left 951002052 3:17574253-17574275 CCTTCCATTGCCTCCAAATTAAG 0: 1
1: 0
2: 3
3: 7
4: 190
Right 951002061 3:17574286-17574308 CCTCATCTGTTCCCCCGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951002052 Original CRISPR CTTAATTTGGAGGCAATGGA AGG (reversed) Intronic
900146863 1:1162338-1162360 CTTAATTTTGGAGCAATGAAGGG - Intergenic
901506887 1:9690467-9690489 CTTAATTGGTCAGCAATGGAAGG + Intronic
903402479 1:23065556-23065578 CTTAACTAGGTGGAAATGGATGG + Intronic
903805711 1:26004243-26004265 CTTAATTTAAAGGGAAAGGAAGG - Intergenic
905222068 1:36454984-36455006 CTTAACTTGGTGTAAATGGATGG + Intergenic
905786907 1:40765667-40765689 CTCAATTTAGAGGAAATGAAAGG - Intronic
907262513 1:53230672-53230694 CTTAATTGGGAGGCCAAGGTGGG - Intronic
907583568 1:55593927-55593949 CCTAATTTGAAGGAGATGGAAGG - Intergenic
908978044 1:69921782-69921804 TTTAGCTTGAAGGCAATGGAAGG - Intronic
913543112 1:119840836-119840858 CTTGATATGGAGGCATTTGATGG - Intergenic
919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG + Intronic
920170645 1:204070505-204070527 CTTAATTTGGTGGCAGTGAGTGG + Intergenic
920516815 1:206591079-206591101 CTTAACGTGGAGGTCATGGAAGG - Intronic
920853986 1:209648797-209648819 CATAATTTGGAGGTTATGGGTGG + Intronic
1065696490 10:28385368-28385390 CTTAACTTGAAGTCAATAGAAGG - Intergenic
1069290295 10:66770687-66770709 CTTTATTTGGTGGGAATGGTGGG - Intronic
1069530064 10:69211072-69211094 CTTCCTTTGGAGGGAAAGGAGGG + Intergenic
1070487609 10:76945488-76945510 CTCAATTTGGAGGCTATGGATGG + Intronic
1070493451 10:76999070-76999092 CTGATTTTGGAGGCAAGGGAGGG + Intronic
1071387656 10:85138632-85138654 CTTGATTTGGAGTCAAATGAAGG + Intergenic
1072479474 10:95796830-95796852 ATTATTTGGGAGGCTATGGAAGG + Intronic
1073130557 10:101186212-101186234 CTTGATGTGGAGGGAAGGGAGGG + Intergenic
1074026506 10:109641315-109641337 CATCATTTGTAGGAAATGGAAGG + Intergenic
1074391474 10:113061604-113061626 CAGACTTTGGAGGCAAGGGAGGG + Intronic
1075549827 10:123383903-123383925 CTAAACTAGGTGGCAATGGAAGG + Intergenic
1077840656 11:5971236-5971258 CTTCATTTGGAGGAAATACAAGG - Intergenic
1078699481 11:13667984-13668006 ATTATTTTGGAGGAAGTGGAAGG + Intergenic
1078937794 11:15966751-15966773 CTTAATTATGAGGCAGAGGAGGG + Exonic
1080069683 11:28066605-28066627 CTTAATCTTGTGTCAATGGAAGG + Intronic
1080432947 11:32215442-32215464 CTTGATTGGGAGACAAAGGAGGG + Intergenic
1083354546 11:62056461-62056483 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1083355475 11:62063054-62063076 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1084633769 11:70375911-70375933 TCTAATGTGGAGTCAATGGATGG - Intronic
1085547640 11:77334759-77334781 CTTAAAATGGAGTCAAGGGAGGG - Intronic
1088510292 11:110566602-110566624 CAAAACCTGGAGGCAATGGAAGG + Intergenic
1088751427 11:112845260-112845282 TTTGATTTGGAGGCCAAGGAAGG - Intergenic
1088953190 11:114590720-114590742 CTTGATTTGCAGGTAAAGGATGG + Intronic
1090369230 11:126236242-126236264 CTTACTTAGGAGGCTATGCAAGG - Intronic
1092924504 12:13261134-13261156 CTTAATGTGTAGGGAAGGGAGGG + Intergenic
1093786817 12:23201381-23201403 CTTAATTTTTTGGCAATGCATGG + Intergenic
1094104184 12:26792270-26792292 CTGAATTTGAAGATAATGGAAGG + Intronic
1095189282 12:39237558-39237580 CATAACTTAGAGGAAATGGACGG - Intergenic
1095200354 12:39377348-39377370 CCTAATTTTGGGGAAATGGAAGG - Intronic
1096595643 12:52693305-52693327 CTGAACGTGGAGCCAATGGAGGG - Intronic
1097402945 12:59151751-59151773 CTTCATTTTAAGGCAATAGAGGG - Intergenic
1099937223 12:89141134-89141156 CTTAATATGGTGTCCATGGAAGG - Intergenic
1101637582 12:106558320-106558342 CTTCCTTTGGAGGTAATGGCTGG - Intronic
1102841631 12:116131202-116131224 CTTATTTTGGAGAGAAAGGAAGG + Intronic
1103445884 12:120994881-120994903 ATGAAGTTGGATGCAATGGATGG - Intronic
1103445893 12:120994943-120994965 ATGAAGTTGGAGGGAATGGATGG - Intronic
1104030003 12:125058140-125058162 CAGAATTTGGAGGCCAGGGAGGG + Intergenic
1105299504 13:19119262-19119284 CTTAGTTTGGAGTAGATGGAGGG + Intergenic
1106214353 13:27681492-27681514 CTTAAATTGTAGGCAAGAGAAGG - Intergenic
1107300641 13:38962415-38962437 CATAATTAGGATGCACTGGAAGG + Intergenic
1109740671 13:66550578-66550600 CTTAAGTTAAAGGCAATGCATGG + Intronic
1110268006 13:73560349-73560371 CTTGATTTGTAGGAAATGAAGGG - Intergenic
1112327922 13:98456050-98456072 TTCAATTTTGAGGCAATTGAAGG - Intronic
1114253268 14:20979922-20979944 TTTAATTTTGAGGCAGTGGAGGG + Intergenic
1114519816 14:23326027-23326049 TTTTATTTGGAGGGAATGGGAGG + Exonic
1115085524 14:29510798-29510820 CCTAATGGGGAGGCATTGGATGG - Intergenic
1116988909 14:51252295-51252317 GTTAATTTGGAGGGATTGAAAGG + Intronic
1118060497 14:62132737-62132759 CTTAGGTTGGAAACAATGGAAGG + Intergenic
1119304131 14:73593448-73593470 GCTACTTGGGAGGCAATGGAGGG - Intronic
1120735622 14:88048626-88048648 CTTATTTTGGAGGGAATGTCAGG - Intergenic
1122566353 14:102659764-102659786 CTGAATTTGGAGGCAGAGAAAGG + Intronic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1125106534 15:35978324-35978346 ATTAATTCGGAGTCTATGGATGG + Intergenic
1127963124 15:63904998-63905020 CTTATTTTGGAAGCAAATGAAGG - Intergenic
1128930498 15:71700487-71700509 ATTAATTTGGGGGAAATTGATGG - Intronic
1129853140 15:78806441-78806463 GTAAAATGGGAGGCAATGGAGGG + Intronic
1130932154 15:88437210-88437232 CTAAATTTCTAGCCAATGGAAGG + Intergenic
1132239695 15:100248293-100248315 CTCAATTTGGAGGCACGGGTAGG + Intronic
1138493105 16:57388407-57388429 CCTAATTTGGAGGCAGTGCAGGG - Intergenic
1143447751 17:7019078-7019100 GTTAGTTTGGGGGCTATGGAGGG - Intergenic
1146606957 17:34268855-34268877 ATTAATTTGGGAGCAATGCAAGG - Intergenic
1147055783 17:37833769-37833791 CTCAATTTGGAGGGACTGAAGGG + Intergenic
1147681736 17:42252562-42252584 CCTAAATTGGGGGAAATGGATGG + Intronic
1149952716 17:61007900-61007922 TTTTTTTTGGAGGCAATCGATGG - Intronic
1153032878 18:731675-731697 CTTAATTTTGAGGCCAGGCACGG + Intronic
1154250263 18:12738326-12738348 ATGACTTTGGAGGCAAGGGACGG + Intergenic
1155333558 18:24742223-24742245 ATTAATTTGAATACAATGGAGGG + Intergenic
1157644674 18:49255701-49255723 CTTACTTTTGGGGCAATGCAGGG - Intronic
1158394359 18:57068173-57068195 CTTGATGTGTAGGAAATGGAGGG + Intergenic
1158829903 18:61265278-61265300 CTTAATTTGGAGGCAAAAATTGG - Intergenic
1159043661 18:63347924-63347946 CTTAGTTTGGGGGCAAAGGGAGG + Intronic
1161162152 19:2767539-2767561 CTTATTTTGGGGGCAGTGGCTGG + Intronic
1161601823 19:5188852-5188874 CATGATTTGCAGGCAATGTAGGG + Intronic
1162351369 19:10151776-10151798 TTAAATTTGGTGGCAGTGGACGG - Exonic
1165775030 19:38399276-38399298 CCTGATTTGGGGGCAATGAAGGG - Intergenic
1167323940 19:48812735-48812757 GCTAATTAGGAGGTAATGGAGGG - Intergenic
926462936 2:13155666-13155688 CTTAACCTGGAGCCCATGGATGG + Intergenic
926734052 2:16058980-16059002 CTTCATTTTCAGGCAGTGGAAGG - Intergenic
929874935 2:45788564-45788586 AGTAAATTAGAGGCAATGGAGGG - Intronic
930718446 2:54615327-54615349 CTACAGCTGGAGGCAATGGATGG + Intronic
930740954 2:54832209-54832231 CCTAAGTTGGAAGCAATGGGTGG - Intronic
935285109 2:101557517-101557539 CTTATTATGGAGACAATGGGAGG - Intergenic
937614614 2:123907049-123907071 CATACTTTGGCAGCAATGGAAGG - Intergenic
937701357 2:124866315-124866337 ATTAAATTGGAGGCTATGGAAGG + Intronic
939629942 2:144517997-144518019 CTTAATTTGGGGGCGAGGGTGGG - Intronic
942248831 2:174030974-174030996 TTTCATTTGTAGGCAATGGGAGG - Intergenic
942541234 2:177017507-177017529 CTTCACTTGGAGGCTATGGTTGG - Intergenic
942933129 2:181520433-181520455 CTTATCTTGAAGGCAATGTATGG + Intronic
944299239 2:198103850-198103872 CATAATTTGGGGGCAAAAGAAGG + Exonic
1168785303 20:534329-534351 TTAAATTTGGAGGCAAGGTAGGG + Intronic
1169298831 20:4424364-4424386 CTAAATTTGGAGGCAGGGTAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169823534 20:9741057-9741079 GTTAACTTAGAGGCAATTGATGG - Intronic
1174174307 20:48635440-48635462 TTTAATCTGGAAGCAGTGGAGGG - Intronic
1177657555 21:24038633-24038655 CTTATTTTCAAGGCAAAGGAAGG - Intergenic
1182012281 22:27010949-27010971 CTTTATTGGGAGGGCATGGAAGG - Intergenic
1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG + Intergenic
1182860889 22:33558306-33558328 CTTCATTTGGAGATAAGGGAAGG + Intronic
949161800 3:892211-892233 CTTGATGTGTAGGGAATGGAGGG + Intergenic
949446709 3:4142826-4142848 CTTAACCTGGAGTCCATGGATGG - Intronic
951002052 3:17574253-17574275 CTTAATTTGGAGGCAATGGAAGG - Intronic
952660650 3:35842535-35842557 ATTAATTTGTAGCAAATGGATGG + Intergenic
952773439 3:37022415-37022437 TTCAATTTGGTGGGAATGGATGG + Intronic
953076841 3:39579347-39579369 CTTGATGTGGAGGGAAGGGAGGG + Intergenic
953615134 3:44483105-44483127 CTGAATTTGGAGGCAAAGCTGGG + Intergenic
953763414 3:45712783-45712805 CCTAAACTGGAGGCAAGGGAAGG + Intronic
955657136 3:61256379-61256401 CTTAATTTGGAGGCAAAATGGGG + Intergenic
957950046 3:87112737-87112759 CTCAATCTGGAGCCCATGGATGG - Intergenic
958736939 3:98020322-98020344 CTTAATTTGTAGTCAATAAATGG + Intronic
960489836 3:118302599-118302621 GTTAATATGGAGACATTGGAAGG - Intergenic
961614641 3:128169169-128169191 TTTAGTTTGGAGGCCAGGGAAGG + Intronic
963312428 3:143723385-143723407 CTTAAACTTGAGGCAATGGCAGG - Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
965104959 3:164343675-164343697 CTTAATGTGTAGGGAAGGGAGGG + Intergenic
967547439 3:190748568-190748590 ATTAGTGTGGAGGCAATGAAGGG + Intergenic
967584794 3:191199044-191199066 CTAAATATGGAGGGAAAGGAGGG + Intergenic
972968473 4:44542584-44542606 CTTATTTTGGTGGTAAAGGATGG + Intergenic
972997317 4:44896812-44896834 CTTTATTTGGAGGGAAAGAAAGG + Intergenic
973883336 4:55295821-55295843 TTTATTTTGAGGGCAATGGAAGG + Intergenic
975226462 4:71877919-71877941 CTTCATTTACAGGCAAGGGATGG + Intergenic
975643802 4:76526534-76526556 ATTAATTTGCAGGCATAGGAAGG + Intronic
975976574 4:80104138-80104160 CTTAATTTGTAGACAGTGGTGGG - Intronic
977574456 4:98661089-98661111 CTCAACTTAGAGGCAATAGAAGG + Intergenic
977979985 4:103309905-103309927 AGAAATTTGGAGGCATTGGAGGG + Intergenic
983315124 4:166122365-166122387 CTACATTAGGACGCAATGGAAGG + Intergenic
984366075 4:178801815-178801837 CTTCATTTGGAGGAAAGAGATGG + Intergenic
985606552 5:861212-861234 CTGAATTGGGAGGCAGAGGAGGG - Intronic
988540026 5:32100309-32100331 GTTAATTGGGAGGCAGAGGAAGG - Intronic
989268749 5:39507052-39507074 CCTAATCTGGAGGCAACAGAGGG + Intergenic
994989829 5:106982533-106982555 CTTAATGTGTAGGGAAGGGAGGG - Intergenic
996445015 5:123537763-123537785 CTTAATTGGGAGGAAATACATGG - Intronic
997262760 5:132476915-132476937 CTGATTGTGGAGGCAGTGGAGGG - Intergenic
997678449 5:135732509-135732531 CTTGATGTGTAGGGAATGGAGGG + Intergenic
1000607284 5:163338572-163338594 CTTAATGTGTAGGGAAGGGAGGG - Intergenic
1000849528 5:166322848-166322870 CTTTATTTGGTGGCAATTTAAGG - Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1003631532 6:7791885-7791907 CTTAAGTAGGAGGCAAAGGGTGG - Intronic
1004746703 6:18516189-18516211 CTTAATTAGCAGGAAATGGAGGG - Intergenic
1004889235 6:20082825-20082847 CTTAGTTTGGAAGCAAAAGAAGG - Intergenic
1007683184 6:43648586-43648608 CTTAATTGGAAGCCATTGGAAGG + Intronic
1008714285 6:54269508-54269530 TTTAATTTGGTGAAAATGGAAGG + Intergenic
1009379473 6:63009894-63009916 CTTGATATGTAGGAAATGGAGGG - Intergenic
1009524414 6:64725918-64725940 TTTAATTTGTAGGCATTAGAAGG - Intronic
1012571297 6:100732916-100732938 GTTAAATTGCAGGAAATGGAAGG - Intronic
1013703063 6:112797162-112797184 CTTAATTATGAGGGAAAGGAAGG + Intergenic
1014270355 6:119329463-119329485 CTTAATTTGGAGTCAGTGGGTGG - Intronic
1015062345 6:128981777-128981799 GTTATTTTGGAGGAACTGGAAGG - Intronic
1016228314 6:141770579-141770601 CTTAAGTGGGAGGCAGAGGAAGG - Intergenic
1016686663 6:146889709-146889731 GCTAAATTGGGGGCAATGGAGGG + Intergenic
1022709750 7:32839462-32839484 CTTAATGTGTAGGGAAGGGAGGG + Intergenic
1024620479 7:51152907-51152929 CTTGATCTGGGGGCCATGGATGG - Intronic
1026812323 7:73478914-73478936 CTTAATCTGGGGTCCATGGATGG - Intronic
1027344359 7:77241964-77241986 ATTAAGTTGGAGGTAATTGAAGG + Intronic
1027453470 7:78359030-78359052 CTTAAGCTGGGGGCAAGGGAAGG + Intronic
1027810990 7:82898103-82898125 CTTAATTTGGACTTAATAGAAGG + Intronic
1030925630 7:115450309-115450331 CTTAACATGGAGGCAATGGAGGG - Intergenic
1031777729 7:125922570-125922592 CTTAATGTGTAGGGAAGGGAGGG - Intergenic
1033201081 7:139370865-139370887 CTTATGTTGGAAGAAATGGAGGG + Intronic
1037957709 8:23071728-23071750 CTGAAATTGGAGGCTGTGGATGG + Intergenic
1038136580 8:24792433-24792455 CTTGTTTTTGAGGCAATGAATGG + Intergenic
1038451226 8:27640115-27640137 CTTTATCGGGAGGCAAGGGAAGG + Intronic
1038902782 8:31862851-31862873 CTTAATTTGCAGGCACTGTGGGG + Intronic
1043723054 8:83572161-83572183 CATAATTTGGTGGTATTGGAAGG + Intergenic
1048550019 8:135425479-135425501 CATTATTTGGAGGCAACGAAAGG + Intergenic
1050240962 9:3634731-3634753 ATTAATTTTGAGGTATTGGAGGG - Intergenic
1050245330 9:3683445-3683467 CTGGATTTGGATACAATGGATGG - Intergenic
1050363032 9:4848787-4848809 GTTAATTTGGAAGAAAGGGAAGG + Intronic
1052616095 9:30843798-30843820 TGAAATTTGGAGGCAATGGATGG - Intergenic
1052727754 9:32250386-32250408 CTTAATATGGAGGAAAGGAAAGG + Intergenic
1053404959 9:37864880-37864902 TTTAATTTGGAGGTAATAGTGGG + Intronic
1053705718 9:40750993-40751015 CTTAAGTTTGAGGCAAGGGTAGG + Intergenic
1054415795 9:64874600-64874622 CTTAAGTTTGAGGCAAGGGTAGG + Intergenic
1055347428 9:75353333-75353355 CTTGATGTGTAGGGAATGGAGGG + Intergenic
1055997968 9:82182216-82182238 CAGGATTTGGAGGCAATAGAAGG + Intergenic
1056232266 9:84558883-84558905 CTTAAGTTTAAGGCCATGGAAGG - Intergenic
1058620267 9:106875567-106875589 CATAATTTGGAGGAAAGGAAGGG - Intronic
1186784365 X:12943996-12944018 CTTAATGTGTAGGGAAGGGAGGG - Intergenic
1188195152 X:27223947-27223969 CGTAATTTGGAAGCAAGGGGAGG + Intergenic
1188468606 X:30511531-30511553 TTTAATTTGGAAGCAATGTGAGG + Intergenic
1189753081 X:44242793-44242815 GTTACTTTGGAGGCAATGGAGGG - Intronic
1189777223 X:44481341-44481363 CTTATTGTTGAGGAAATGGAAGG + Intergenic
1193386409 X:80877127-80877149 CAGAATTTGGAGACAAAGGAGGG - Intergenic
1195272037 X:103241795-103241817 CTACATTTGGAAGAAATGGAAGG - Intergenic
1198179345 X:134190360-134190382 CTTAGTTTGCAGGAAATAGAGGG + Intergenic
1198407339 X:136326570-136326592 CTTCCTTTGGAGGTAATGGCTGG + Intronic
1198592107 X:138195225-138195247 TTTAATATGGAGGCAAAGGCAGG - Intergenic
1198710464 X:139495904-139495926 TTGAATTGGGTGGCAATGGAAGG - Intergenic