ID: 951005348

View in Genome Browser
Species Human (GRCh38)
Location 3:17609557-17609579
Sequence AGGTAGCCAAAGATAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951005348_951005351 2 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005351 3:17609582-17609604 TTTCTCACCTTATCTTTTTTGGG 0: 1
1: 0
2: 4
3: 67
4: 778
951005348_951005357 11 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005357 3:17609591-17609613 TTATCTTTTTTGGGGGTTTGGGG 0: 1
1: 1
2: 11
3: 92
4: 710
951005348_951005350 1 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005350 3:17609581-17609603 TTTTCTCACCTTATCTTTTTTGG 0: 1
1: 0
2: 3
3: 58
4: 776
951005348_951005356 10 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005356 3:17609590-17609612 CTTATCTTTTTTGGGGGTTTGGG 0: 1
1: 0
2: 3
3: 59
4: 426
951005348_951005353 4 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005353 3:17609584-17609606 TCTCACCTTATCTTTTTTGGGGG 0: 1
1: 0
2: 0
3: 32
4: 393
951005348_951005352 3 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005352 3:17609583-17609605 TTCTCACCTTATCTTTTTTGGGG 0: 1
1: 0
2: 2
3: 39
4: 467
951005348_951005355 9 Left 951005348 3:17609557-17609579 CCAAGCTCTATCTTTGGCTACCT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 951005355 3:17609589-17609611 CCTTATCTTTTTTGGGGGTTTGG 0: 1
1: 0
2: 6
3: 43
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951005348 Original CRISPR AGGTAGCCAAAGATAGAGCT TGG (reversed) Intronic
901003946 1:6162699-6162721 TGGAAGCCAAAGATACAGCCAGG + Intronic
901324736 1:8359670-8359692 AGGCAGCCAAGGGCAGAGCTCGG + Intronic
903125905 1:21247440-21247462 AGGAAGCAAAGGAAAGAGCTTGG + Intronic
903893634 1:26587502-26587524 AGGTAGTAAGAGACAGAGCTGGG + Intergenic
907956900 1:59237605-59237627 AGGGAGAAAAAGATAGAGCAGGG - Intergenic
909764151 1:79333893-79333915 AGGTAGCCAATGATGTAGCAGGG + Intergenic
910515557 1:88055835-88055857 AGCTTGCCCAAGGTAGAGCTGGG + Intergenic
910718611 1:90259624-90259646 AGGCAGCAAAAGGCAGAGCTGGG + Intergenic
911286103 1:95995235-95995257 AGGTAACCAATGTTAGAGCCTGG + Intergenic
912746094 1:112246876-112246898 AAGTACTCAAAGATAGAGCTGGG - Intergenic
912905221 1:113698883-113698905 TGGTGGCCATAGCTAGAGCTTGG + Intronic
914746309 1:150504185-150504207 GGGTAGCGTATGATAGAGCTAGG + Intronic
921385189 1:214561428-214561450 AGCTGGTCAATGATAGAGCTGGG + Intergenic
922001880 1:221487100-221487122 AAGTAGCCAAATAAAGAGCTGGG - Intergenic
923439797 1:234006389-234006411 AGGTAACCAAAGATTGCTCTTGG - Intronic
923571768 1:235122335-235122357 AGCTTGCCAAGGAGAGAGCTGGG - Exonic
924727815 1:246686491-246686513 AGCTGGCCCAAGATGGAGCTGGG - Intergenic
1063225001 10:4007401-4007423 AGGTACCCAAAGTATGAGCTGGG - Intergenic
1064237645 10:13590784-13590806 AGCTAGCAAGAGATAGAGCCTGG + Intronic
1064587321 10:16851993-16852015 AGGGAGGCAAAGATAGAGGGAGG - Intronic
1064587422 10:16852360-16852382 AGGGAGGCAAAGATAGAGGGAGG - Intronic
1064587453 10:16852480-16852502 AGGGAGGCAAAGATAGAGTGAGG - Intronic
1064587459 10:16852520-16852542 AGGGAGGCAAAGATAGAGTGAGG - Intronic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1068082630 10:52338604-52338626 AGCTAGCAGAAGGTAGAGCTGGG - Intergenic
1068788552 10:61002252-61002274 AGGTGGCCACACTTAGAGCTTGG - Intergenic
1069081774 10:64096156-64096178 AAGTAGCTAAACAGAGAGCTTGG + Intergenic
1069405334 10:68092888-68092910 AGCTAGTGAGAGATAGAGCTGGG + Intergenic
1070642912 10:78181973-78181995 ATGGAGCCAAAGTTAGAACTGGG + Intergenic
1074229240 10:111517207-111517229 AGGTATCGAAGGACAGAGCTAGG - Intergenic
1074351888 10:112745896-112745918 AGGTAGCAAGAGACAGAGCTAGG + Intronic
1077012748 11:386096-386118 AGGGAGGCCAAGATGGAGCTGGG + Intergenic
1078346705 11:10556107-10556129 AGGTAGCTAAAGTTAGGGCTTGG - Intergenic
1078424526 11:11238514-11238536 AGATGGCCAACGATGGAGCTGGG + Intergenic
1080011240 11:27461813-27461835 AGGTTCCCAAAGATTGAGTTAGG + Intronic
1080906124 11:36546961-36546983 GGGCAGCCAGAGATAGAGGTCGG - Intronic
1080961029 11:37160500-37160522 AAGTAGCTATAGATAGATCTGGG + Intergenic
1081614067 11:44580003-44580025 AGGGAGCCACAGACAGAGATAGG + Intronic
1081853458 11:46289845-46289867 AGGGAGCCAACGATAGTTCTGGG + Intronic
1083351070 11:62029389-62029411 AGCTAGCAAGAGATAGAGCCGGG + Intergenic
1087002558 11:93435376-93435398 AGGTAGCCAAAGACAAAGGCTGG + Intronic
1087410366 11:97783862-97783884 AGGCAGCCAAAGAGAAAGGTTGG - Intergenic
1088585689 11:111358188-111358210 AGGCTGCCAGGGATAGAGCTAGG - Intronic
1088798296 11:113283137-113283159 AGGGAGACAAGGCTAGAGCTTGG + Intergenic
1089357167 11:117861630-117861652 AGGAAGCCAAGGACAGAGTTGGG - Intronic
1091263261 11:134250726-134250748 AGGTAACCTAAGATTGAGGTTGG + Intronic
1092830661 12:12441354-12441376 AGGTAGTCAGAGATGGAGCCAGG - Intronic
1093731099 12:22567035-22567057 AGGTAGCCAAAGAAAGAAGGAGG - Intergenic
1093740737 12:22683589-22683611 AGGTACTCAGAGATAGAGCCTGG + Intronic
1094040801 12:26120080-26120102 AGGTAGACAAAGCCAGAGCCTGG + Exonic
1094062195 12:26326176-26326198 AGGTAGGAAGAGGTAGAGCTTGG + Intergenic
1095381231 12:41595825-41595847 AGGTAGGCAAAGAAAAGGCTGGG + Intergenic
1097799318 12:63895745-63895767 ACGTAGACAAAGATAGAAGTTGG + Intronic
1097970475 12:65627861-65627883 AGGTCTCCAAAGATAGCCCTTGG + Intergenic
1098383303 12:69892270-69892292 AGGTAGTAAATGATAGAGCTCGG + Intronic
1098471122 12:70845547-70845569 AGGAAGGCAAAGAGAGAGATAGG - Intronic
1099002320 12:77193293-77193315 AGGTTGCCAAAAATACAGGTTGG + Intergenic
1099810630 12:87578059-87578081 AGGGTGCCAAGGATGGAGCTGGG + Intergenic
1104713555 12:131002702-131002724 AGGCAGCCAGAGATAGCTCTGGG + Intronic
1106485380 13:30167684-30167706 TGGCAGGCAAAGAGAGAGCTTGG - Intergenic
1106552434 13:30783805-30783827 AGATAGCCAAAGACAGAGGATGG - Intergenic
1109862575 13:68219639-68219661 AGTTAGCAAGTGATAGAGCTGGG + Intergenic
1110181114 13:72618086-72618108 AAGTAGACAAATATATAGCTTGG - Intergenic
1111230965 13:85343368-85343390 AGGTAGTTAAAGAGAGAGATAGG + Intergenic
1111677133 13:91400389-91400411 AGGTATACAAAGAAATAGCTGGG - Intronic
1113302431 13:109036852-109036874 AAGTAGCCAAAGATAGAGGCTGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113913951 13:113860155-113860177 AGGGAGACAAAGAAAGAGATGGG + Intronic
1114667301 14:24386803-24386825 AGCTTGCCAGAGACAGAGCTGGG + Intergenic
1115643006 14:35347386-35347408 AGGTAGTCAATGGTAGACCTGGG + Intergenic
1117900475 14:60527656-60527678 AGGCAGCCAGAGAGAAAGCTTGG - Intergenic
1118775552 14:68971855-68971877 AGGCAGCCAAAGATGGAAATCGG - Intronic
1120678392 14:87450026-87450048 AGGTAGGCAAAAAGAGGGCTGGG + Intergenic
1121556912 14:94845072-94845094 AGGTAGCAAGAGGCAGAGCTGGG - Intergenic
1121801979 14:96782308-96782330 AGGTACCCAGAGTTAGAACTTGG - Intergenic
1121954151 14:98198692-98198714 AGGTGGCCACTGAGAGAGCTCGG - Intergenic
1126466318 15:48964395-48964417 AGGAAGCCAAAACCAGAGCTGGG + Intergenic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1130870989 15:87972174-87972196 AGGTCTCCAAAGGCAGAGCTAGG + Intronic
1131418256 15:92279381-92279403 AGGTGGTGAAAAATAGAGCTAGG + Intergenic
1133915172 16:10102793-10102815 AGCTAGCAAGAGGTAGAGCTAGG + Intronic
1134590006 16:15444824-15444846 AGATAGCAAAAGATTGAGGTGGG - Intronic
1135548710 16:23382292-23382314 AGGTACCCAAAGAGAGATCAGGG + Intergenic
1137238549 16:46635291-46635313 TGGTAGCCAGAGATAGAGAGAGG + Intergenic
1138092690 16:54189235-54189257 AGGTAGCCAAGGGCAGAGCTGGG + Intergenic
1139178248 16:64715372-64715394 AGTGAGCCAATGATAGAGCCAGG - Intergenic
1139227558 16:65247882-65247904 AGTTAGACAAAGACAGATCTGGG + Intergenic
1140166827 16:72561293-72561315 AGGTGGACAAAGATACAGTTGGG + Intergenic
1140345110 16:74205945-74205967 AAGGAGCCAAAGAAAGAGCTGGG + Intergenic
1140836400 16:78798121-78798143 AGGGAGCAAAGGACAGAGCTTGG + Intronic
1141067727 16:80927461-80927483 AGGAAGGGAAATATAGAGCTGGG + Intergenic
1143179772 17:4977230-4977252 AGGTAGCCAGAGAAGGAGCCAGG - Intronic
1144393952 17:14825151-14825173 AGGGAGCAAAAGAGAGAGCAGGG - Intergenic
1144471085 17:15542085-15542107 TGGTGGCCAAAGAAAGAGCCAGG + Intronic
1144925382 17:18802592-18802614 TGGTGGCCAAAGAAAGAGCCAGG - Intronic
1146270435 17:31481815-31481837 AGGTTGACACAAATAGAGCTTGG + Intronic
1146629748 17:34461222-34461244 AGGAAGCAAAAGATAGAAATGGG + Intergenic
1147265093 17:39229800-39229822 AGGAAGCAAAAGGCAGAGCTGGG - Intergenic
1148188342 17:45660799-45660821 AGGTCTCCAAAGCTAGAGTTTGG - Intergenic
1149403643 17:56324842-56324864 GGGTGGCCAAAGGAAGAGCTTGG - Intronic
1150051053 17:61963372-61963394 AGGTGGCTACAGGTAGAGCTAGG + Intronic
1151292974 17:73163869-73163891 GGGTACCCCAAGATACAGCTTGG + Intergenic
1151924595 17:77185553-77185575 AGGTAGCCTTAGCTAGAACTAGG - Intronic
1153826616 18:8881275-8881297 AGGGAGTCAAAGAGAGAGATAGG - Intergenic
1157052664 18:44185559-44185581 AGGTAGCAAATGCCAGAGCTGGG + Intergenic
1157180486 18:45493569-45493591 AGGTAGTCAAGGAAAGAGCCAGG + Intronic
1158154259 18:54407569-54407591 AGGTAGACTAACATAGAGATGGG + Intergenic
1159518809 18:69492908-69492930 AGGTAGTAAATGACAGAGCTGGG - Intronic
1159554035 18:69926329-69926351 AGTTAGCCAAAGAAAGGGCAGGG - Intronic
1161658821 19:5533394-5533416 AGGGAACCAAAGAGAGATCTAGG + Intergenic
1165896215 19:39142753-39142775 AGGCAGCCAAGGGTAGAGCTGGG - Intronic
926563693 2:14445753-14445775 AGTGAGCCACAGATACAGCTAGG - Intergenic
927851111 2:26500162-26500184 AGTTAGCCAAGGTTAGAGCCAGG - Intronic
928173976 2:29021935-29021957 AGTCAGCCAAAGGTAGAGTTAGG + Intronic
930727625 2:54697085-54697107 AGGTAGAGAAAGAGAGAGATGGG + Intergenic
930749361 2:54918167-54918189 AGGTATTCAAAGATACAGATAGG - Intronic
930860713 2:56070256-56070278 AGGTAGCCAGAGCCAGAGCACGG - Intergenic
931418855 2:62106995-62107017 AGGTAAGCAAATGTAGAGCTGGG - Intronic
931877321 2:66528209-66528231 AGGAGGCCAAAGATAGAATTTGG + Intronic
932996120 2:76855544-76855566 AGGAAGACAAAGAAAGAGATTGG - Intronic
933774247 2:85762258-85762280 AGCTAGACAAAGCTAGAGCCAGG + Intronic
935524724 2:104151745-104151767 AGGTGGTCAAAGAAGGAGCTAGG + Intergenic
936710689 2:115127444-115127466 TGGTAGGCAAAGACAGAGGTGGG - Intronic
938949541 2:136244078-136244100 AGCTTGCCAAAGACAGACCTTGG + Intergenic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
941074681 2:160993285-160993307 AGGTAGCAGGAGACAGAGCTAGG + Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
941881236 2:170482454-170482476 CGGCAGGCAAAGAGAGAGCTTGG - Intronic
942457025 2:176145292-176145314 AGAAAGCCAAGGAAAGAGCTTGG - Intergenic
945618029 2:212097951-212097973 AAGTAGCCAAAGATATATATGGG + Intronic
947025045 2:225728027-225728049 AGTTTGCCAAATACAGAGCTTGG + Intergenic
948698969 2:239748827-239748849 AGGCAGCCAAGGGCAGAGCTGGG + Intergenic
948964200 2:241363590-241363612 AGGTTGCCAAAGACGGAACTCGG + Intronic
1169919884 20:10723857-10723879 AGCTAGCAAAAGATGGAGCCAGG + Intergenic
1171368235 20:24641726-24641748 AGGCAGCCAAGGATGGAGCACGG + Intronic
1172510603 20:35498210-35498232 AGCTAGCAAATGGTAGAGCTGGG - Intronic
1172522872 20:35579508-35579530 AGGTAGCCACAGAGACAGGTAGG + Intergenic
1172588642 20:36102408-36102430 AGGGAGCCAATGGCAGAGCTGGG + Intronic
1172824742 20:37771852-37771874 AGCTAGTTAGAGATAGAGCTAGG + Intronic
1172843591 20:37916311-37916333 AGGGAGCCAGAGATAGGGCAGGG - Intronic
1173168381 20:40702092-40702114 AGGTAGTAAATGACAGAGCTGGG - Intergenic
1173563908 20:44025797-44025819 AGATTGCCCAGGATAGAGCTGGG - Intronic
1174747971 20:53083032-53083054 TGTCAGCCAAAGACAGAGCTGGG - Intronic
1174763893 20:53233625-53233647 AGCTAGCAAGTGATAGAGCTGGG + Intronic
1176903639 21:14473971-14473993 AGGTAGCCAAAGAAAGAGTAAGG + Intergenic
1177590414 21:23157662-23157684 AGGAAGTCACACATAGAGCTGGG + Intergenic
1177830650 21:26135164-26135186 AGCAAGCCAAAGATAAAGCCAGG + Intronic
1179440805 21:41392714-41392736 AGGTAGCTAAAGACAGAGCAGGG + Intronic
1181672598 22:24432704-24432726 AGGGAGCCATGGATAGTGCTGGG + Exonic
1182017293 22:27051493-27051515 AGTCAGCCAAAGGCAGAGCTGGG + Intergenic
1184222420 22:43109755-43109777 AGGTAGCAAACGACAGAGCTGGG + Intergenic
1184251676 22:43264102-43264124 ATGTCGCCAAGGGTAGAGCTGGG + Intronic
950251212 3:11467200-11467222 AGGAAGCCAAAGAGATAGCATGG + Intronic
950473913 3:13203981-13204003 AGTGAGCCAAAGGTAGAACTGGG + Intergenic
950626673 3:14252591-14252613 AGGTAGACACAGAGAGAGCTAGG + Intergenic
951005348 3:17609557-17609579 AGGTAGCCAAAGATAGAGCTTGG - Intronic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
953398840 3:42594157-42594179 AGGTGCGCAAAGATAGATCTGGG + Intronic
953637115 3:44672915-44672937 AGGTAGTCAAGGATAGAGGAGGG + Intergenic
954497336 3:50977548-50977570 GGGTAGCCAAAGAGAAAGGTCGG - Intronic
955754887 3:62216880-62216902 AGTTAGCCAAACAGAGAGTTGGG - Intronic
956326169 3:68055383-68055405 AGGGAGCAAAATATAGTGCTGGG - Intronic
958427863 3:94000175-94000197 AGGTACCTAAACATAGAGTTGGG - Intronic
959216785 3:103460630-103460652 AGTTAGTCAAAGATAGAAATGGG + Intergenic
959218384 3:103482578-103482600 AGGTAGCCAGAGAGAAAGGTTGG - Intergenic
959278384 3:104306037-104306059 GGGCAGCCAAAGATAAAGGTCGG + Intergenic
959887348 3:111517889-111517911 AGCTAGTAAATGATAGAGCTAGG + Intronic
960763055 3:121095191-121095213 AGGCAGCCAGAGAGAGAGGTCGG - Intronic
962358163 3:134712880-134712902 AGGGAGGCAAGGAGAGAGCTGGG + Intronic
962423253 3:135246572-135246594 ATCTAGCAAAAGATAGGGCTGGG - Intronic
963281211 3:143386222-143386244 GGGTCGCCAAAGACAGAGCAAGG - Intronic
966047628 3:175571991-175572013 AGGTAGACAAAGAAAGAGAGAGG + Intronic
968269519 3:197392667-197392689 AGGTGGGCAAAGACAGAGATGGG - Intergenic
968722415 4:2217333-2217355 AGGCAGGAAAAGTTAGAGCTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
973055515 4:45652907-45652929 GGGTAGCCAAAGAGAAAGGTCGG + Intergenic
974871908 4:67654274-67654296 AGGCAGCCAGAGAGAGAGATTGG + Intronic
976133888 4:81913851-81913873 AGGGAGCAAAGGAAAGAGCTGGG - Intronic
976631296 4:87239577-87239599 AGGTACCCAGAGGTAAAGCTTGG - Intronic
976705852 4:88017974-88017996 AGGCAGCCAAAGATTAGGCTCGG - Intronic
978325726 4:107551857-107551879 AGGTTGCCAACCATAGATCTTGG + Intergenic
979855899 4:125633961-125633983 AGGTATTCAAAGAAAGAGGTGGG + Intergenic
984285403 4:177722161-177722183 AGCTAGCCAAAGAATGACCTAGG + Intergenic
987410978 5:17614845-17614867 AGGTCGCCAATGGTAGCGCTTGG + Intergenic
989436223 5:41416651-41416673 CCAGAGCCAAAGATAGAGCTGGG + Intronic
990264057 5:54056787-54056809 AGTTAGTAAAAGACAGAGCTAGG - Intronic
991129786 5:63109359-63109381 AGGTAGCCAGAGCTAGAGGTAGG + Intergenic
992377050 5:76198377-76198399 AGGAAGCAAAAGAGAGGGCTGGG - Intronic
992756635 5:79912707-79912729 GGGTAGCCAAAGAGAAAGGTCGG + Intergenic
993653875 5:90554902-90554924 AGGAAGCCAGAGAGAGAGCTGGG - Intronic
995502884 5:112827858-112827880 TAGTAGCCAAAAATAAAGCTTGG + Intronic
995790465 5:115881606-115881628 AGGTAGCCAGAGAGAAAGGTTGG - Intronic
996618659 5:125472602-125472624 AGGGGGCCAAAGACAGAGGTAGG + Intergenic
997433367 5:133856930-133856952 AGCTAGTAAAAGATAGAGCTGGG - Intergenic
997502593 5:134388483-134388505 AGGTAACCAATGGCAGAGCTTGG + Intronic
999702044 5:154237033-154237055 AGATTGGCAAAGATAGAGCTAGG + Intronic
999927665 5:156396878-156396900 AGGTAGTAAGAGATAAAGCTAGG + Intronic
1000213075 5:159127423-159127445 AGCTAGCAAAAGAAAGAACTAGG - Intergenic
1001712398 5:173789260-173789282 AGGAAGCCAATGGAAGAGCTGGG - Intergenic
1003790666 6:9543843-9543865 AGGGAGCCAGAGAGAGAGGTGGG + Intergenic
1004674297 6:17826182-17826204 TGGTAGCCAAAGAGATAACTAGG + Intronic
1006651110 6:35552595-35552617 AGGAAGCCCAAGATAGAACAAGG - Intergenic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1010316687 6:74459405-74459427 AGCTAACAAATGATAGAGCTGGG + Intergenic
1012754441 6:103207286-103207308 AGTGGGCCAAAGACAGAGCTGGG - Intergenic
1013390430 6:109680692-109680714 GGGTAGCCAGAGAAAAAGCTTGG + Intronic
1015259149 6:131214920-131214942 AGCTAGTAAGAGATAGAGCTTGG - Intronic
1015570966 6:134621107-134621129 AGGTAGAAGAAGACAGAGCTAGG + Intergenic
1016724019 6:147339367-147339389 TGGTAGCCAATGATATAGGTAGG + Exonic
1017594605 6:156014932-156014954 AGGAAGCATCAGATAGAGCTGGG - Intergenic
1018338570 6:162824045-162824067 AGGCAGGCAAAGACAGAGCTGGG - Intronic
1021127989 7:16876268-16876290 ATATAGCCAGAGATAGAGATAGG - Intronic
1021749953 7:23787134-23787156 CGTTAGCCAGAGGTAGAGCTGGG + Intronic
1024975832 7:55112783-55112805 AGGTAGCCATTGGTAGAGCAGGG + Intronic
1026000067 7:66554080-66554102 AGCTTGCCAAGGAGAGAGCTGGG - Intergenic
1026096381 7:67349693-67349715 AGATGGCCAAATACAGAGCTGGG - Intergenic
1026295565 7:69049015-69049037 AGTTAGCCAGAGATAGTTCTGGG + Intergenic
1026452524 7:70541822-70541844 AGTTGGCCAAGGAAAGAGCTAGG + Intronic
1027710956 7:81600774-81600796 AAGAAGCCAAAGATAGACTTTGG + Intergenic
1027885969 7:83905168-83905190 AACTAGGCAAAGATAGACCTTGG + Intergenic
1028050209 7:86175658-86175680 AGGTAGCCAGAGAGAAAGGTCGG + Intergenic
1028598182 7:92569024-92569046 TAGTAGACAGAGATAGAGCTGGG + Intronic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1030157316 7:106468251-106468273 AGGCAGGCAATGAGAGAGCTTGG + Intergenic
1031521096 7:122766837-122766859 AACTAGCAAATGATAGAGCTGGG - Intronic
1032151869 7:129435561-129435583 AGGTAGTAAATGATAGGGCTAGG - Intronic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1035189341 7:157152190-157152212 AGGTAGTCAGGGACAGAGCTGGG + Intronic
1035189347 7:157152217-157152239 AGGTAGTCAGGGAGAGAGCTGGG + Intronic
1036280306 8:7394433-7394455 GGGTAGGCAAAGAGAGGGCTGGG + Intergenic
1036341221 8:7917450-7917472 GGGTAGGCAAAGAGAGGGCTGGG - Intergenic
1038423986 8:27452834-27452856 AGGAAGCCCAAGCCAGAGCTGGG + Intronic
1040585327 8:48735350-48735372 ACGTAGCCAAAGCTACAGCTGGG + Intergenic
1042910931 8:73825470-73825492 AGCTAGCAAAAGACAGAGCCAGG + Intronic
1043176232 8:77026380-77026402 AGGCAGGCACAGACAGAGCTGGG + Intergenic
1043328723 8:79086427-79086449 AGGTAGCCCAATATTGAGATGGG - Intergenic
1043747942 8:83899489-83899511 GGGTAGCCAAAGAAAAAGGTCGG + Intergenic
1044923851 8:97192972-97192994 AGGTTTCCACAGAAAGAGCTGGG + Intergenic
1046985551 8:120384121-120384143 AGGTGGGCCAAGATAAAGCTGGG - Intronic
1047023695 8:120804830-120804852 AGGTAGCCTAAGAAAGAGTCTGG - Intronic
1047187023 8:122642866-122642888 AGGTAGCCACAGAGAGATCTGGG + Intergenic
1048212792 8:132469512-132469534 GGGTAGCCCAAGATAGCTCTGGG - Intronic
1048472210 8:134713365-134713387 AGGTAGTGAGAGGTAGAGCTGGG - Intergenic
1051256946 9:15223445-15223467 AGGCAGCCAAGGAGAGAGTTTGG - Intronic
1052539693 9:29794076-29794098 AGCTAGCCCAAAATAGATCTTGG - Intergenic
1055436893 9:76300714-76300736 AGCTAGCAAAACACAGAGCTGGG - Intronic
1055455358 9:76466882-76466904 AGGGAGCCAAACACAAAGCTTGG - Intronic
1055543299 9:77338416-77338438 AGCTAGCAAATGACAGAGCTAGG - Intronic
1055710487 9:79055680-79055702 AGGTAGAGAAAGAGAGAGGTAGG - Intergenic
1058558877 9:106202741-106202763 GGGCAGCCAAAGAGAAAGCTCGG - Intergenic
1060085427 9:120695710-120695732 AGGTAGCCAAAGAAAGGGTGTGG + Intronic
1060100016 9:120832199-120832221 GTGTAGCTAAACATAGAGCTGGG - Intronic
1060750209 9:126163816-126163838 AGGTCACCAAAGGCAGAGCTGGG + Intergenic
1062176533 9:135166297-135166319 AGGTGGGCGAAGAGAGAGCTTGG + Intergenic
1062415629 9:136448132-136448154 AGGTAGCCAACGAAAGAACCAGG + Exonic
1186773132 X:12837757-12837779 AGGCAGCCAAAGAAAAAGGTCGG - Intergenic
1188574111 X:31625380-31625402 AGGTAGAAAAAGAGAGAGCTTGG - Intronic
1190965974 X:55302058-55302080 AGGTAGCCAGAGAGAAAGGTCGG - Intergenic
1191687845 X:63910768-63910790 ATGTAGCCAATGGTAGGGCTGGG + Intergenic
1191801103 X:65080276-65080298 AGGTAGAGAAAGAAAGAGATAGG + Intergenic
1191907230 X:66106705-66106727 AGGCAGCCAGAGATAAAGGTTGG - Intergenic
1192410628 X:70929809-70929831 AGGTGGCCAAAGATAAAGCAGGG - Exonic
1192678281 X:73223260-73223282 AGCTTGCCAAGGAGAGAGCTGGG + Intergenic
1193615835 X:83687323-83687345 AGGCAGCCAAAGAGAAAGGTCGG - Intergenic
1195418730 X:104649133-104649155 AGATAGCAAAAGATAGAGTCAGG - Intronic
1196749488 X:119102138-119102160 AGCCAATCAAAGATAGAGCTGGG - Intronic
1196907624 X:120453100-120453122 AAGTAGCCTAAGAATGAGCTGGG - Intronic
1197532322 X:127644928-127644950 AGGTGGGCAAACATAAAGCTGGG + Intergenic
1197541224 X:127764352-127764374 AGGTACCCAGAGAGAGACCTTGG - Intergenic
1197992068 X:132329065-132329087 AGGTAGCCCAAGCTGCAGCTGGG + Intergenic
1198173704 X:134133550-134133572 ATGTATCCAAAGATAGACCATGG + Intergenic