ID: 951011187

View in Genome Browser
Species Human (GRCh38)
Location 3:17681968-17681990
Sequence GTTAGATTCTCATAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 13, 2: 58, 3: 83, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951011187_951011191 15 Left 951011187 3:17681968-17681990 CCTGCACCTTATGAGAATCTAAC 0: 1
1: 13
2: 58
3: 83
4: 149
Right 951011191 3:17682006-17682028 TGAGGTGGAACAGTTTCTTCTGG 0: 1
1: 23
2: 40
3: 52
4: 202
951011187_951011190 0 Left 951011187 3:17681968-17681990 CCTGCACCTTATGAGAATCTAAC 0: 1
1: 13
2: 58
3: 83
4: 149
Right 951011190 3:17681991-17682013 TAATGCTTGATGATCTGAGGTGG 0: 50
1: 901
2: 1057
3: 655
4: 407
951011187_951011189 -3 Left 951011187 3:17681968-17681990 CCTGCACCTTATGAGAATCTAAC 0: 1
1: 13
2: 58
3: 83
4: 149
Right 951011189 3:17681988-17682010 AACTAATGCTTGATGATCTGAGG 0: 19
1: 364
2: 1056
3: 886
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951011187 Original CRISPR GTTAGATTCTCATAAGGTGC AGG (reversed) Intronic
901581503 1:10247896-10247918 GTTAGATTCTCATAAGGAGCGGG + Intronic
902313444 1:15599647-15599669 GTTAGATTCTCATAAGGAGTGGG + Intergenic
903542569 1:24105207-24105229 GTTAAATTCTCATCACATGCAGG + Intronic
903623545 1:24715196-24715218 GTCACCTTGTCATAAGGTGCTGG - Intergenic
904294659 1:29511506-29511528 GTTAGATTTTCATAAGGAGCAGG + Intergenic
904789233 1:33006114-33006136 ATTAGATTCTCACAAGGAGCGGG + Intergenic
904811535 1:33166112-33166134 ATTAGATTCTCATAAGGAGCAGG - Intronic
905082897 1:35340565-35340587 ATTAGATTCTCATAATGGGCAGG + Intronic
906089879 1:43169928-43169950 ATTAGATTCTCATAAGGAGCAGG - Intronic
908172203 1:61516459-61516481 GTTAGATTCTCATAAGGAGCAGG - Intergenic
909185145 1:72477992-72478014 GTTATATACTCTTAAGATGCAGG - Intergenic
909235388 1:73146795-73146817 ATTAGATTCTCATAAGAAGCAGG - Intergenic
909660489 1:78076493-78076515 ATTAGATTATCATAAGGTGCAGG + Intronic
910545224 1:88408316-88408338 ATTAGATTCTCATAAGAAGCAGG + Intergenic
910868927 1:91813876-91813898 GTGAGATTCTCATAAGGAGCAGG + Intronic
911131051 1:94388901-94388923 GTTAGATCCTCAGAAGGTCTTGG - Intergenic
911147059 1:94562557-94562579 ATTAGACTCTCATAAGGAGCGGG + Intergenic
911293952 1:96090617-96090639 GTTAGTTTCTCATAAGGAATGGG - Intergenic
911494678 1:98616599-98616621 ATTAGATTCTCATAAGAAGGGGG - Intergenic
911898198 1:103466873-103466895 ATTAGATTCTCATAAGGAGTGGG + Intergenic
912062580 1:105690975-105690997 ATTAGATTGTCATAAGGAGCAGG - Intergenic
913579427 1:120211051-120211073 ATTAGATCCTCATAAGAAGCAGG - Intergenic
913628745 1:120687337-120687359 ATTAGATCCTCATAAGAAGCAGG + Intergenic
914198980 1:145467579-145467601 TTTAGAATCTCATAAGTTGGAGG + Intergenic
914478090 1:148040715-148040737 TTTAGAATCTCATAAGTTGGAGG + Intergenic
918489981 1:185071113-185071135 GTTACATTCTTATAAGGCTCTGG + Intronic
918762744 1:188434771-188434793 ATTAGATTCTTATAAGGAGTGGG + Intergenic
921006001 1:211094192-211094214 ATTAGATTCTCATAAGGAGCAGG + Intronic
921697169 1:218224972-218224994 GTTACATTCTCAGAGAGTGCAGG + Intergenic
924072744 1:240298675-240298697 ATTAGGTTCTCATAAAGAGCAGG - Intronic
1063027387 10:2193758-2193780 TGCAGATTCTCAAAAGGTGCAGG - Intergenic
1065931554 10:30483766-30483788 ATTAGATTTTCATAAGGAGCAGG - Intergenic
1066242102 10:33547985-33548007 TTTAGATTCTTATAAGGAGAGGG + Intergenic
1066280574 10:33913779-33913801 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1068603317 10:58978523-58978545 GTTAGAGTCGCATAAGGAGCGGG + Intergenic
1069358450 10:67614493-67614515 ATTAGATTCTCATAAGGAGTAGG + Intronic
1070842722 10:79498786-79498808 GTAAGATTCTCATAAGGAGCCGG - Intergenic
1070847993 10:79539467-79539489 GTTAGATTCTCAAAAAATGTAGG - Intergenic
1072672305 10:97439489-97439511 ATTAGATTCTCATAAGGAGTGGG - Intronic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1073199932 10:101727117-101727139 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1073519845 10:104117843-104117865 GTTAGATTCTTAAAAGGTAATGG - Intergenic
1074821931 10:117186132-117186154 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1075880622 10:125847799-125847821 ATTAGATTCTCATAAGGAGCGGG + Intronic
1075927840 10:126267510-126267532 ATTAGATTCTCATAAGGAGCAGG + Intronic
1075977939 10:126713018-126713040 ATTAGATTCTTATAAGGAGAGGG - Intergenic
1075993447 10:126857549-126857571 ATTAGATCCTCACAAGGAGCTGG - Intergenic
1076201340 10:128561067-128561089 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1076621221 10:131789382-131789404 ATTAGATTCTCATAAGCAGTGGG - Intergenic
1082895466 11:58185417-58185439 TTTAGGCTCTCATAAGATGCTGG - Intergenic
1084158888 11:67333637-67333659 ATTAGATTCTCATAAGGAGCTGG - Intronic
1084768818 11:71329542-71329564 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1085503899 11:77044911-77044933 AGTAGATTCTCATAAGGAGCAGG + Intergenic
1085938254 11:81176751-81176773 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1087656472 11:100929184-100929206 GTTAGATTCTCATAAGGAGCAGG + Intronic
1088141552 11:106622870-106622892 CTTATATTCTCGTAAGGTGGAGG - Intergenic
1088961118 11:114666031-114666053 GAAGGATTCTCATAAGATGCAGG - Intergenic
1090485386 11:127107970-127107992 ATTAGATTCTTATAAGGAGCAGG - Intergenic
1091672534 12:2462494-2462516 GTTACATTCTCATGAGGTAAGGG - Intronic
1091936069 12:4435378-4435400 GTTAGATTCTCAGAAGGAGCAGG - Intronic
1092496941 12:9005785-9005807 GTTAGATTTTCTTAAGGAGCAGG + Intronic
1093065906 12:14657688-14657710 GTTAGATTCTCATAAGGATAAGG - Intronic
1093981572 12:25480692-25480714 GTTAGAAGCAGATAAGGTGCTGG - Intronic
1094344124 12:29448136-29448158 ACTAGATTATCATAAGGAGCAGG + Intronic
1095581267 12:43802330-43802352 GTTAGATTCTCAGAATGCCCAGG - Exonic
1096061320 12:48703037-48703059 ATTAGATTCTCATAAAGAGCAGG - Intronic
1096691368 12:53324148-53324170 GTTGGATTCTCATAAAAAGCGGG + Intronic
1097050114 12:56217805-56217827 ATTAGATTCTCATAGGGAGTGGG - Intronic
1100092792 12:90992133-90992155 ATTAGATTCTCATAAGAAGCAGG + Intronic
1100324827 12:93531016-93531038 ATTAGATTTTCATAAGGAGCGGG + Intergenic
1100715662 12:97302565-97302587 ATTAGATGCTCATAAGGAGTGGG + Intergenic
1101971366 12:109315290-109315312 GTTATTTTCTCATATCGTGCAGG + Intergenic
1103529499 12:121590943-121590965 GTTTGTTTCTCAGAAGTTGCAGG - Intergenic
1104624557 12:130340426-130340448 ATTAGATTCTCATAAGGAGCAGG + Intronic
1104680302 12:130746531-130746553 ATTGGATTCTCCTAAGGAGCAGG + Intergenic
1107797195 13:44064921-44064943 ACTAGATTCTCATAAGGAGCAGG + Intergenic
1108588879 13:51894947-51894969 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1109373563 13:61458138-61458160 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1110358375 13:74595574-74595596 GTTGGATTATCATAAGGAGTGGG + Intergenic
1111371436 13:87323050-87323072 GTTGGATGCTCATAAGGTTGCGG + Intergenic
1111592665 13:90370184-90370206 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1111917843 13:94380129-94380151 TTTAGATTCCCATAACGTGGAGG + Intronic
1112022507 13:95383956-95383978 ATTAGATTCTCATAAGGAGGGGG - Intergenic
1112032971 13:95474223-95474245 ATTAGATTCTGATAAGGAGGAGG + Intronic
1113259798 13:108549077-108549099 GTTAGATTCCCATATGTTGTAGG + Intergenic
1113360390 13:109625567-109625589 GTAAGATTCTTAGAAGCTGCTGG + Intergenic
1114890444 14:26915091-26915113 ATTAGATTCTCATAAAGAGCAGG + Intergenic
1116643538 14:47496936-47496958 ATTAGATTCTCATAAGGAGCAGG + Intronic
1116966078 14:51016395-51016417 ATTAGATTCTCATAAGGAGCGGG - Intronic
1117256367 14:53981914-53981936 GTCAGAATCTCTAAAGGTGCGGG + Intergenic
1118008506 14:61586807-61586829 GCTGGATTCTCATAAGGTAAGGG + Intronic
1119012147 14:71004489-71004511 ATTGGATTCTCATAAGGAGTGGG - Intronic
1119121581 14:72084191-72084213 ATTAGATTCTCATAAGGAGTGGG + Intronic
1119122246 14:72090462-72090484 ATTAGATTCTCATAAGGAGCAGG - Intronic
1119203732 14:72778382-72778404 ATTAGATTCTCATAAGGAGTGGG - Intronic
1119772693 14:77230652-77230674 GTTAGAGTCTCATAAGGAGCAGG - Intronic
1202894258 14_KI270722v1_random:189074-189096 ATTAGATTATCATAAGGAGCAGG - Intergenic
1125860746 15:42997213-42997235 ATTAGATTTTCATAAGGAGTGGG - Intronic
1126434162 15:48618860-48618882 ATTAGATTCTCATAAGGAGTGGG - Intronic
1127884085 15:63183932-63183954 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1128110546 15:65073402-65073424 ATTAGATTGTCATAAGGAGCAGG + Intronic
1128855954 15:71015390-71015412 ATTAGATTCTCATAAGGAGTGGG + Intronic
1132170814 15:99652263-99652285 ATTAGATTCTCATAAGGAATGGG + Intronic
1134355177 16:13475825-13475847 GTTAGATTTTCATAAGGAACAGG + Intergenic
1135191433 16:20357869-20357891 ATTAGATTCTCATAAGGAGCCGG + Intergenic
1135850914 16:25962903-25962925 GTTGAATTCTTATTAGGTGCTGG - Intronic
1135853335 16:25984317-25984339 ATTAGATTCTCATAAGGAGCAGG + Intronic
1138100968 16:54252223-54252245 ATTAGATTCTCATAAGGAGCAGG - Intronic
1140382269 16:74500229-74500251 CTTATTTTCTCATAATGTGCAGG - Intronic
1141281418 16:82632904-82632926 ATTAGACTCTCATAAGGAGAAGG + Intronic
1146012084 17:29204237-29204259 GTTAGATTCTCAGAATGCCCAGG - Intergenic
1146168467 17:30612352-30612374 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1146221435 17:31025852-31025874 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1146393328 17:32442846-32442868 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1149314707 17:55428108-55428130 ATTAGATTCTCATAAGGAGCGGG - Intergenic
1150366364 17:64589654-64589676 ATGAGAGTCTCATAAGGAGCTGG - Intronic
1151413425 17:73946235-73946257 ATTAGATTCTCATAAGAGGCTGG + Intergenic
1151573712 17:74940652-74940674 ATTAGATTCTCATGAGGAGTGGG - Intronic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1151824043 17:76513631-76513653 GATCGATTCTCTTAGGGTGCTGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153144594 18:2016248-2016270 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1153342342 18:3988507-3988529 ATTAGATTCTCATAAGGAGCGGG + Intronic
1155394153 18:25368471-25368493 ATTAGATTCTCATAAGGAGCTGG + Intergenic
1155668759 18:28344071-28344093 ATTAGATTCTCATAACGAGCAGG + Intergenic
1155908308 18:31478860-31478882 ATTAGATTATCATAAGGAGCAGG + Intergenic
1156053033 18:32961651-32961673 ATTCGATTCTCATAAGGAGCAGG + Intronic
1156215739 18:34996333-34996355 ATTAGATTTTCATAAGCAGCGGG + Intronic
1157474055 18:48010120-48010142 GTTAGATCCTCATAAGGAGCAGG - Intergenic
1158421080 18:57294885-57294907 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1159899142 18:74026738-74026760 TTAAAATTCTCATAAAGTGCTGG + Intergenic
1159993901 18:74942814-74942836 AGTGGATTCTCATAAGATGCTGG - Intronic
1161922088 19:7274190-7274212 GTTAGATTCTCATAAGGAGCAGG + Intronic
1163010628 19:14423376-14423398 GTTAGATTCTCATAAGGAATGGG + Intergenic
1165479233 19:36052348-36052370 ATTAGATTCTCATAAAAAGCGGG - Intronic
1166017177 19:39991083-39991105 ATCAGATTCTCATAAGGAGCGGG + Intronic
1166233749 19:41441394-41441416 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1167006326 19:46778542-46778564 AGGAGATTCTCATAAGGTCCTGG - Intronic
925526333 2:4806280-4806302 TTTAGATTTTCCTGAGGTGCAGG - Intergenic
925892983 2:8451075-8451097 ATTAGATTCTCATAAGGAGCAGG + Intergenic
926374746 2:12215359-12215381 ATTAGATTCTCACAAGGAGCAGG - Intergenic
928768901 2:34681726-34681748 GTTAGATGCTCTAAAGGTGGAGG - Intergenic
929040583 2:37740619-37740641 ATTAGATTCCCATAAAGTGCAGG + Intergenic
929527085 2:42714780-42714802 GTTAGAGGCTCATAAGGAGCAGG + Intronic
930797168 2:55405742-55405764 ATTAGATTCTCATAAGGAGTGGG - Intronic
930997602 2:57739680-57739702 GTTGGATTTTCATAAGGTTGTGG + Intergenic
933227833 2:79771572-79771594 ATTAAATTCTCATAAGGATCTGG + Intronic
935472539 2:103477719-103477741 ATTAGATTCTAATTAGGTCCTGG - Intergenic
936027218 2:109042086-109042108 CTTACTTTCTCATAAGGTCCTGG + Intergenic
937014216 2:118588884-118588906 CTTAGATTCTCATAAGGAGGAGG + Intergenic
940311429 2:152282983-152283005 ATAAGATTCTCAGAAGGTCCTGG - Intergenic
940646067 2:156394086-156394108 ATTAGATTCTTATAAGGAGCCGG + Intergenic
941350059 2:164420738-164420760 GTTAGATTCTCATAAGGAGCAGG + Intergenic
942477648 2:176344818-176344840 GTTAGATTCTTATAAGGATCAGG - Intergenic
942565062 2:177257828-177257850 ATTAGATTGTCCTAAGGAGCTGG - Intronic
943120019 2:183724142-183724164 ATTAGATTCTCGTAAGGAACAGG - Intergenic
943244674 2:185431417-185431439 AATAGATTCTCATAAGGAGTAGG - Intergenic
943529984 2:189067384-189067406 GATAAATTCTCTTAAAGTGCTGG - Intronic
945511169 2:210704555-210704577 ATAAGGTTCTCATAAGGTGGGGG + Intergenic
946596386 2:221310136-221310158 GTGAGATTCTCAGAGGGAGCAGG + Intergenic
948654724 2:239469469-239469491 ATTAGATTCTCATAAGAGGCAGG + Intergenic
948757622 2:240168573-240168595 GTTAGATTCCCATAAGGAGGGGG + Intergenic
1168917529 20:1503113-1503135 CTTAGATTCTCATAGTGTGTAGG + Intergenic
1169421758 20:5466182-5466204 GTTAGATTTTCTTAAGGCACAGG + Intergenic
1174906470 20:54557333-54557355 ATTAGATTCTCATAAGGAGCAGG + Intronic
1175345663 20:58272768-58272790 GTCAGATTGTCAGAAGATGCAGG - Intergenic
1177127419 21:17212821-17212843 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1177597552 21:23265591-23265613 GTTAGATTATCTTAAGGAACAGG - Intergenic
1178672948 21:34608002-34608024 ATTAGATTCTCATAAGGAGTGGG - Intronic
1178793746 21:35723981-35724003 GGTAGATACTCCTAGGGTGCAGG - Intronic
1179916880 21:44483440-44483462 GTTTGTTTCTCACAAGGTCCAGG + Intergenic
1183226427 22:36553348-36553370 GTTAGAGTCTCATAAGGAACAGG + Intergenic
1203292860 22_KI270736v1_random:12221-12243 ATTAGATTCCCATAAAGTGCAGG + Intergenic
949417658 3:3831278-3831300 GTGAGATACTCCTAAGGTGAAGG - Intronic
950250243 3:11458962-11458984 GTTAGAATCTCATAAGCTGCGGG - Intronic
951011187 3:17681968-17681990 GTTAGATTCTCATAAGGTGCAGG - Intronic
953073048 3:39542466-39542488 GTTACATTCTCAAAAGCTGATGG + Intergenic
953861592 3:46548838-46548860 ATTAGATTCTCATAAGCAGTGGG + Intronic
955291995 3:57700803-57700825 ATTAGATTCTCCTAAGGAGCAGG + Intergenic
955572810 3:60326360-60326382 ATTAGGTTCTCATAAGGAGCGGG + Intronic
955698881 3:61663757-61663779 ATTAGAGCCTCATAAGGAGCGGG + Intronic
956338215 3:68189167-68189189 GGTAGATGCTCAGTAGGTGCTGG + Intronic
956727492 3:72168448-72168470 ATTAGATTGTCATAAGGAGCGGG - Intergenic
957212787 3:77281806-77281828 AGTAGATTCTCATAAGGAGCAGG + Intronic
957218827 3:77355780-77355802 GTTAAATTTGCATAAGGTGAAGG + Intronic
957377070 3:79371965-79371987 ATTAGATTCTCATAGGGAGCAGG + Intronic
959638638 3:108605565-108605587 ATTAGATTCTCACAAGGAGTGGG + Intronic
961230536 3:125303564-125303586 ATTAGGTTCTCATAAGGAGCAGG - Intronic
965492607 3:169358014-169358036 GTTGGATTTACATAAGGCGCTGG - Intronic
965676569 3:171203610-171203632 GTTTGGTTCACATAAGGTGGTGG - Intronic
965724905 3:171704902-171704924 GTTAGACTCTCATAAGGAGCGGG + Intronic
966158679 3:176945775-176945797 GTTAGATTCTCATAAGGAGCGGG - Intergenic
966363418 3:179154399-179154421 ATTAGATTCTCATTAGGAGCAGG - Intronic
966556817 3:181271656-181271678 ATTAGATCCCCATAAGGAGCAGG - Intergenic
966859001 3:184218086-184218108 GTTAGATTCTCATGAGGAGCAGG - Intronic
967208673 3:187147637-187147659 ATTAGATTACCATAAGGAGCGGG + Intronic
967269641 3:187722409-187722431 GGTAGATTCTGAGAAGGGGCTGG + Exonic
968034532 3:195535165-195535187 ATTAGACTCTCATAAGGAGTGGG + Intronic
970438015 4:16054461-16054483 CTTTTATTCTCAAAAGGTGCCGG + Intronic
971541095 4:27817624-27817646 ATTAGATTTTCATAAGGAACAGG - Intergenic
972368645 4:38399823-38399845 ATTAGATTCTCACAAGGAGCAGG - Intergenic
972660468 4:41111040-41111062 ATTAGATTCTCATAACGAGTGGG + Intronic
973829844 4:54747626-54747648 ATTAGATTCTCATAAGAAGTGGG + Intergenic
974354484 4:60794705-60794727 GTTAAACTCTCACAAGGAGCGGG - Intergenic
974401723 4:61416976-61416998 ATTAGATTCTCATAAGAAACAGG + Intronic
976508501 4:85879893-85879915 ATTAGATTCTCATAAGGAGCAGG + Intronic
976705605 4:88016012-88016034 GTGAGATTCTCATAAGGAGCAGG + Intronic
977810539 4:101350270-101350292 ATTAGATTCTCATAAGGAGCGGG + Intergenic
977817490 4:101431735-101431757 GTTATATTCTCATAAGGAGTGGG + Intronic
977910134 4:102524748-102524770 GTTAGATTCTCATAAGGAGCGGG + Intronic
978754496 4:112287301-112287323 ATTAGATTCTCATAAGAAGCGGG + Intronic
979055147 4:115984174-115984196 ATTAGATTCTCATAAGGTGTGGG - Intergenic
979351146 4:119645955-119645977 GTTAGATTCTTATAAGGAATGGG - Intergenic
979478257 4:121183766-121183788 ATTAGATTCTCATAAGGAGCAGG - Intronic
979952172 4:126906771-126906793 GTGAGATTCTCCTAAGGTGCAGG - Intergenic
982261702 4:153499719-153499741 GTAAGAATGTCATAAGGGGCTGG - Intronic
983289209 4:165780261-165780283 TTTAGCTTCTCCTAAAGTGCCGG + Intergenic
983700114 4:170581480-170581502 GTTAGATTCTCATAAGGAGCAGG + Intergenic
984079817 4:175233422-175233444 ATTAGATTCTCATAAGGAGCGGG - Intergenic
984123131 4:175770947-175770969 GTTTTATTCTCAGAAGGTGCAGG - Intronic
984967317 4:185150951-185150973 GTTAGGTTCCCATGAGCTGCTGG - Intergenic
986021421 5:3807605-3807627 ATTAGATTCTCCTAAGGAGTGGG - Intergenic
986293374 5:6417991-6418013 ATTAGATTCTCATTAGGAGCTGG - Intergenic
987835163 5:23151104-23151126 ATTAGATTATTATAAGGAGCGGG - Intergenic
990397198 5:55394511-55394533 CTTAGATTCTCATAACGACCAGG + Intronic
990972934 5:61529465-61529487 GGAAGATTTTCATAAGGTGATGG + Intronic
991170695 5:63621952-63621974 GTTAGTTTCTCATGAGTTGATGG - Intergenic
992096375 5:73366641-73366663 GTTAGATTCTCATAAGGAGCAGG + Intergenic
992151207 5:73905218-73905240 ATTAGATTCTCATAAGGAGGGGG - Intronic
994423021 5:99546114-99546136 GTTAGATTTTGATATGCTGCTGG + Intergenic
994501882 5:100589371-100589393 GCTAGAATCTGATGAGGTGCAGG - Intergenic
994841717 5:104932497-104932519 GTTCGATTCTCATGAGGAGCAGG + Intergenic
996614356 5:125422631-125422653 TTTAGATTCTCACAAGGAGCAGG - Intergenic
997272672 5:132555003-132555025 ATTAGATTCTCATAAGGAATGGG + Intronic
997693868 5:135846158-135846180 ATCAGATTCTCATAAAGAGCGGG - Intronic
1000308759 5:160020699-160020721 ATTAGATTCTTGTAAGGAGCAGG - Intronic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1001910810 5:175515953-175515975 ACTAGATTCTCATAAGGAGCGGG + Intronic
1002559676 5:180072632-180072654 GTTAGATTCTCGTAAGAAGTGGG + Intergenic
1003451314 6:6235661-6235683 TTTAGACTCTCATATGCTGCTGG + Intronic
1004148460 6:13091738-13091760 ATTAGATTCTCATAAGAAGCGGG + Intronic
1004790794 6:19024029-19024051 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1004875193 6:19944356-19944378 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1005638952 6:27776546-27776568 ATTAGATTCTCATAAAGAGTGGG + Intergenic
1005939993 6:30553520-30553542 GTCACATACTCATAAAGTGCTGG + Exonic
1007133520 6:39499162-39499184 GTTAGAGTCCCATAGGGTACAGG + Intronic
1007141981 6:39585273-39585295 ATTAGATTCTCATAAGGAGCGGG + Intronic
1009681463 6:66898029-66898051 GTTAGAACCTGATAAGGTGGTGG + Intergenic
1010040984 6:71383529-71383551 GTTACATTCTCTTAAGGAGCGGG + Intergenic
1013227082 6:108127580-108127602 ATTAGATTCTCATAAGGAGCGGG + Intronic
1013355928 6:109346018-109346040 GCTAGATTCTCATAAGGAGCAGG - Intergenic
1014118555 6:117695469-117695491 ATTAGGGTCTCATAGGGTGCAGG - Intronic
1014474672 6:121857848-121857870 GTTAGATTCTCATAAGAAGCAGG - Intergenic
1015593472 6:134844084-134844106 ATTAGATTCCTATAAGGAGCAGG + Intergenic
1016462847 6:144296322-144296344 ATTAGATTCTCATAAGGAGCAGG - Intronic
1023243884 7:38179318-38179340 GATGGATTCTGATAAGGTGGTGG + Intronic
1024393501 7:48840976-48840998 ATTAGATTCTCATAAGGCTCAGG - Intergenic
1025625573 7:63218371-63218393 ATTAGACTCTCATAAGGAGTAGG + Intergenic
1025656533 7:63524758-63524780 ATTAGACTCTCATAAGGAGTAGG - Intergenic
1026260130 7:68747856-68747878 ATTAGATTTTCATAAGGAGCCGG + Intergenic
1027426654 7:78068171-78068193 ATTACATGCTCATAAGGAGCAGG + Intronic
1028684797 7:93579467-93579489 GTAAAATTCTCATAAAGTGCTGG + Intergenic
1030291872 7:107880801-107880823 GCTAGATTCTCATAAGGAACAGG + Intergenic
1032073413 7:128823969-128823991 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1032293537 7:130613178-130613200 ATTAGATTCTCATATGAGGCCGG + Intronic
1032795591 7:135273644-135273666 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1032982950 7:137306083-137306105 GCCAGATTCTCATTAGGTCCTGG + Intronic
1033997770 7:147373006-147373028 GTTAGATTTTAATAATGTGATGG - Intronic
1034319635 7:150168377-150168399 ATTAGATTCTCATAAGGATCAGG - Intergenic
1034680497 7:152924665-152924687 GTCAGATTCAGATATGGTGCAGG + Intergenic
1034773121 7:153798842-153798864 ATTAGATTCTCATAAGGATCAGG + Intergenic
1035015040 7:155758419-155758441 ATTAGAGTCTTATAAGGAGCTGG + Intronic
1038195046 8:25359658-25359680 GTGAGATTCACATAAGGAGCTGG - Intronic
1039003692 8:33010205-33010227 GTGAAACTCTCATAAGCTGCAGG - Intergenic
1039757203 8:40536433-40536455 TTTATTTTCTCAGAAGGTGCTGG - Intronic
1039822167 8:41144140-41144162 GTTTCCTTCTCATAATGTGCAGG - Intergenic
1040905290 8:52463586-52463608 GTTAGATTATCTTAAGGAGCAGG + Intergenic
1040907475 8:52483512-52483534 ATTAGATTCTCATAAGAAGCAGG + Intergenic
1041260496 8:56017238-56017260 GTGAGCTTCTCATACCGTGCTGG + Intergenic
1041436665 8:57849199-57849221 ATTACATTCTCATAGGGGGCTGG - Intergenic
1042020885 8:64370667-64370689 GTTACATTTTCATAAGTTCCAGG + Intergenic
1048779413 8:137985292-137985314 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1048802128 8:138203895-138203917 ATTAGATTCTCATAAGGAATGGG + Intronic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1050712061 9:8476230-8476252 ATTAGATTCTCATAAAGAGCCGG + Intronic
1050871151 9:10571770-10571792 ACTAGATTCTCATAAGGAACAGG + Intronic
1054850543 9:69842754-69842776 GTTAGGATCTCATAAAATGCTGG + Intronic
1055374664 9:75636041-75636063 ATTACATTCTCATAAGGAGCAGG - Intergenic
1056751660 9:89356225-89356247 GTTAGATTCTCATAAGGAGCAGG - Intronic
1058646117 9:107132856-107132878 ATAAGATTCTCATAATGAGCAGG - Intergenic
1059473021 9:114521434-114521456 GTTACATTCTAATAAGATACTGG + Intergenic
1059747768 9:117219681-117219703 TTGAAATTCTCATAAGGTGATGG - Intronic
1060333941 9:122704086-122704108 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1060344694 9:122805982-122806004 ATTAGATTCTCATAAGGAGCAGG - Intronic
1203491274 Un_GL000224v1:107735-107757 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203503898 Un_KI270741v1:49605-49627 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1186079903 X:5919697-5919719 ATTAGATTCTCATAAGGAGCAGG - Intronic
1186565143 X:10654490-10654512 GTTAGATTACCATAAGGAGTGGG + Intronic
1188129324 X:26411797-26411819 GTTAGATTTTCATCAGATTCAGG + Intergenic
1189115173 X:38334964-38334986 GTTAGAGTCTCATAACGAACGGG - Intronic
1189641939 X:43082075-43082097 ATTAGATTCTAATAAAGAGCAGG - Intergenic
1191974501 X:66857118-66857140 GTTAAAAACTCATAAGGTGAAGG + Intergenic
1199778395 X:151035836-151035858 GTTAGACTCTCAGTAGGTGGTGG + Intergenic
1200330435 X:155291139-155291161 GTTAGATTCTCAGAATGCCCAGG - Intronic